Next Article in Journal
Single-Cell Analysis in the Omics Era: Technologies and Applications in Cancer
Previous Article in Journal
Revisiting the Role of Autophagy in Cardiac Differentiation: A Comprehensive Review of Interplay with Other Signaling Pathways
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 14
Issue 7
10.3390/genes14071329
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The APOBEC3B c.783delG Truncating Mutation Is Not Associated with an Increased Risk of Breast Cancer in the Polish Population

by
Katarzyna Gliniewicz
1,
Wojciech Kluźniak
1,
Dominika Wokołorczyk
1,
Tomasz Huzarski
1,2,
Klaudia Stempa
1,
Helena Rudnicka
1,
Anna Jakubowska
1,3,
Marek Szwiec
4,
Joanna Jarkiewicz-Tretyn
5,
Mariusz Naczk
6,
Tomasz Kluz
7,
Tadeusz Dębniak
1,
Jacek Gronwald
1,
Jan Lubiński
1,
Steven A. Narod
8,9,
Mohammad R. Akbari
8,9 and
Cezary Cybulski
1,*
1
International Hereditary Cancer Center, Department of Genetics and Pathology, Pomeranian Medical University in Szczecin, 71-252 Szczecin, Poland
2
Department of Clinical Genetics and Pathology, University of Zielona Góra, 65-046 Zielona Góra, Poland
3
Independent Laboratory of Molecular Biology and Genetic Diagnostics, Pomeranian Medical University in Szczecin, 70-204 Szczecin, Poland
4
Department of Surgery and Oncology, University of Zielona Góra, 65-046 Zielona Góra, Poland
5
Non-Public Health Care Centre, Cancer Genetics Laboratory, 87-100 Toruń, Poland
6
Institute of Health Sciences, Collegium Medicum, University of Zielona Góra, 65-417 Zielona Góra, Poland
7
Department of Gynecology and Obstetrics, Institute of Medical, Sciences, Medical College of Rzeszów University, 35-959 Rzeszów, Poland
8
Women’s College Research Institute, Women’s College Hospital, Toronto, ON M5S 1B2, Canada
9
Dalla Lana School of Public Health, University of Toronto, Toronto, ON M5T 3M7, Canada
*
Author to whom correspondence should be addressed.
Genes 2023, 14(7), 1329; https://doi.org/10.3390/genes14071329
Submission received: 15 May 2023 / Revised: 20 June 2023 / Accepted: 22 June 2023 / Published: 24 June 2023
(This article belongs to the Section Human Genomics and Genetic Diseases)
Versions Notes

Abstract

:
The APOBEC3B gene belongs to a cluster of DNA-editing enzymes on chromosome 22 and encodes an activation-induced cytidine deaminase. A large deletion of APOBEC3B was associated with increased breast cancer risk, but the evidence is inconclusive. To investigate whether or not APOBEC3B is a breast cancer susceptibility gene, we sequenced this gene in 617 Polish patients with hereditary breast cancer. We detected a single recurrent truncating mutation (c.783delG, p.Val262Phefs) in four of the 617 (0.65%) hereditary cases by sequencing. We then genotyped an additional 12,484 women with unselected breast cancer and 3740 cancer-free women for the c.783delG mutation. The APOBEC3B c.783delG allele was detected in 60 (0.48%) unselected cases and 19 (0.51%) controls (OR = 0.95, 95% CI 0.56–1.59, p = 0.94). The allele was present in 8 of 1968 (0.41%) familial breast cancer patients from unselected cases (OR = 0.80, 95% CI 0.35–1.83, p = 0.74). Clinical characteristics of breast tumors in carriers of the APOBEC3B mutation and non-carriers were similar. No cancer type was more frequent in the relatives of mutation carriers than in those of non-carriers. We conclude the APOBEC3B deleterious mutation p.Val262Phefs does not confer breast cancer risk. These data do not support the hypothesis that APOBEC3B is a breast cancer susceptibility gene.

1. Introduction

Breast cancer is the most common malignancy among women. Annually, it is diagnosed in over two million women worldwide, including about 20,000 cases in Poland. The lifetime risk of breast cancer in the Polish population is approximately 8% [1]. However, this risk varies by lifestyle, environmental and genetic factors, including the presence of predisposing mutations in breast cancer susceptibility genes. The risk of breast cancer is higher in families with strong clustering of breast cancer than in those with no or single affected relatives [2].
Approximately 10–15% of all cases of breast cancer are hereditary, and these cases are caused by mutations in high or moderately penetrant breast cancer susceptibility genes. To date, over twenty genes have been associated with a genetic predisposition to breast cancer. Based on the mutation frequencies, the magnitude of cancer risk, and the influence on clinical management with mutation carriers, the most important breast cancer susceptibility genes include BRCA1, BRCA2, PALB2, and CHEK2 [3,4,5,6,7,8]. Other genes which have been associated with breast cancer susceptibility of moderate penetrance, and their mutations are relatively common among breast cancer cases, are ATM, BARD1, RAD51C, and RAD51D, but the importance of identifying pathogenic mutations of these genes in clinical practice has not been well established [9,10,11,12,13,14]. Other breast cancer susceptibility genes such as TP53, PTEN, STK11, and CDH1 are reported to confer a high or moderate increase in the risk of breast cancer, but mutations of these genes are very rare [15,16,17,18]. For several other genes, including BLM, NBN, XRCC2, RECQL, BRIP1, and RAD50, the evidence for an association with breast cancer is weak or mixed [19,20,21,22,23,24].
In 2021, the results of two case–control studies that tested the associations between putative cancer susceptibility genes and the risk of breast cancer were reported. The first report analyzed 34 genes and 113,000 women from 25 countries, and the second study investigated 28 genes in 64,000 women from the United States [24,25]. Variants in BRCA1, BRCA2, PALB2, BARD1, RAD51C, RAD51D, ATM, CHEK2, and TP53 showed significant associations with an increased risk of breast cancer in both studies. However, together, pathogenic mutations in all known breast cancer predisposing genes are responsible for about 10% of unselected cases of breast cancer, and are detected in approximately half of the families with strong aggregation of breast cancer (families with hereditary breast cancer, HBC families).
Other breast cancer susceptibility genes are likely to exist. Most recently, in 2023, we identified a novel gene for hereditary breast cancer called ATRIP. We detected ATRIP c.1152_1155del (p.Gly385Ter) founder mutation in 42 of 16,085 unselected Polish breast cancer patients and in 11 of 9285 cancer-free women (OR = 2.14, 95% CI 1.13–4.28, p = 0.02). By analyzing the sequence data of the UK Biobank, we identified ATRIP loss of function variants in 13 of 15,643 breast cancer patients and 40 of 157,943 female controls (OR = 3.28, 95% CI = 1.76–6.14, p < 0.001). In addition, we performed immunohistochemistry and functional studies that showed weak expression of the allele with the ATRIP c.1152_1155del variant compared to the wild-type allele, and we observed that truncated ATRIP fails to perform its function to prevent replicative stress. We also showed that breast cancers in women who carry a germline ATRIP mutation have a loss of heterozygosity at the site of the mutation and a deficiency in DNA repair by homologous recombination [26].
APOBEC3B is a good candidate gene for breast cancer susceptibility. The APOBEC3B (Apolipoprotein B mRNA editing enzyme catalytic subunit 3B) belongs to a family of proteins called activation-induced cytidine deaminases (AICDA/AID), including APOBEC3A to APOBEC3G, which are encoded by an APOBEC genomic cluster on chromosome 22 and are known to protect human cells from viral infections by inducing mutations of single-stranded DNA [27]. In detail, DNA cytidine deaminases act as inhibitors of retrovirus replication and retrotransposon mobility via deaminase-dependent and -independent mechanisms. After the penetration of retrovirus into cells and the initiation of reverse transcription, they can induce the conversion of cytosine to uracil in the minus-sense single-strand viral DNA, which leads to G-to-A hypermutations in the plus-strand viral DNA. The resultant mutations in the proviral genome, along with a deamination-independent mechanism, exert an antiretroviral effect in infected target cells [28].
A link between the APOBEC3 genes and DNA damage was first reported over two decades ago when it was established that the APOBEC3A protein is capable of hypermutating nuclear DNA and inducing double-stranded DNA breaks [29]. Then, it has been shown that also the APOBEC3B protein is able to edit genomic DNA, and has the capability of introducing mutations in DNA [30]. It was reported that APOBEC3B is involved in the immune response against viruses, regulation of DNA methylation, and CHEK2-inducing DNA damage, which leads to apoptosis [31,32]. APOBEC3B has been demonstrated to induce somatic mutations in several types of malignancies, including breast cancer [32]. It has been described as a strong driver of breast cancer [33]. Expression of APOBEC3B is upregulated in breast cancer and it was associated with kataegis, aggressive clinical and pathological features of breast tumors, and poor prognosis among patients with estrogen receptor-positive (ER+) breast cancer [34]. Expression of APOBEC3B may also be required for estrogen receptor function [35]. A large germline deletion of the APOBEC3B gene was reported as a low-risk variant for breast cancer [36,37,38,39,40], but negative reports have also been published [41,42,43,44].
Although overexpression of APOBEC3B has been associated with the pathogenesis of breast cancer, the role of germline mutations of this gene in the etiology of breast cancer remains unclear. To investigate whether or not germline intragenic mutations of APOBEC3B are present the Polish population and predispose to breast cancer, we studied approximately 13,000 patients with breast cancer and 3700 controls. First, we screened the entire APOBEC3B gene in 617 Polish families with hereditary breast cancer by whole exome sequencing and identified a truncating founder mutation c.783delG (p.Val262Phefs). Then, we genotyped approximately 12,500 unselected cases of breast cancer and 3700 cancer-free controls for the c.783delG founder mutation and compared the clinical characteristics of breast tumors in carriers of the APOBEC3B mutation with cancers diagnosed among non-carriers. To investigate whether the APOBEC3B c.783delG mutation predisposes to different cancers, we reviewed the pedigrees of patients with breast cancer who carry the mutation and compared them with the pedigrees of patients without the mutation.

2. Materials and Methods

2.1. Hereditary Breast Cancer Cases

For the first step, we selected 617 unrelated breast cancer patients from 617 Polish families with a family history of breast cancer. We selected women with a strong family history of breast cancer (in first- or second-degree relatives). Among the 617 probands with breast cancer, 160 women were from families with at least 4 women affected with breast cancer, 378 women were from families with 3 affected, and 79 women were from families with 2 affected (at least 1 had bilateral breast cancer or breast cancer below age 50). The mean number of breast cancers per family was 3.4. Among the 617 probands with breast cancer, 104 women were diagnosed at age 40 years or below, 226 women were diagnosed between age 41 and 50 years, 200 women were diagnosed between ages 51 and 60 years, and 87 women were diagnosed above age 60. The mean age of breast cancer diagnosis among the 617 probands was 46 years (range of 28 to 76 years). Of the 617 patients, 81 also reported a family history of ovarian cancer and 16 reported a family history of male breast cancer. The 617 probands were selected from a registry of 3519 familial breast cancer cases housed at the Hereditary Cancer Center in Szczecin based on the number and age of onset of breast cancer cases among their relatives; all tested negative for a panel of 17 founder Polish mutations in BRCA1, BRCA2, CHEK2, PALB2, NBN, and RECQL [45]. All probands were ethnic Poles.

2.2. Unselected Cases of Breast Cancer

We studied 12,484 prospectively ascertained cases of invasive breast cancer, diagnosed from 1996 to 2012, at 18 different hospitals in Poland (mean age of diagnosis 54.0 years, range 18–93). All women who were diagnosed with first primary invasive breast cancer at one of the participating centers were eligible. Patients with purely intraductal or intralobular cancer were excluded (DCIS or LCIS) but patients with DCIS with micro-invasion were included. Patients were unselected for family history. The patient participation rate among invited women was 76%. Information was recorded on the clinical characteristics of breast cancers through a review of medical records. Family history included the number of first- and second-degree relatives with any cancer and was available for 11,782 of 12,484 (93%) of cases. Of the 11,551 unselected cases, 1968 patients (17%) reported at least one first- or second-degree relative with breast cancer (familial breast cancer cases from unselected series). The definition of a familial case among the unselected cases was the presence of one or more breast cancers in a first- or second-degree relative (i.e., two or more breast cancers in first- or second-degree relatives in the family). Survival data were obtained (status: alive or dead, the date of death) from the Polish Ministry of the Interior and Administration in July 2014. The Ethics Committee of Pomeranian Medical University in Szczecin approved the study (IRB No. KB-0012/97/17).

2.3. Controls

The purpose of the control group was to estimate with accuracy the APOBEC3B mutation frequency in the underlying Polish population. The control group included 3740 Polish cancer-free women between the ages of 18 and 94 years (mean age, 53.0 years). The controls were invited to participate, where they were interviewed and provided peripheral blood samples for DNA isolation between 2007 and 2013. In detail, these subjects were derived from four sources. The first series consisted of 987 women from the region of Szczecin (age range, 24 to 84 years) who were part of a population-based study of the 1.5 million residents of West Pomerania (North-West Poland) designed to identify familial aggregations of cancer, and these women were interviewed in 2007. The second group consisted of 1717 unselected women (age range 32–72) who participated in mammography screening at 8 different centers all over Poland between 2009 and 2011 (Kielce, Legnica, Olsztyn, Poznan, Szczecin, Swidnica, Torun, and Zielona Góra) and provided a blood sample for DNA analysis. The third control group included 1036 women (age range, 20–94 years) selected at random from the computerized patient lists of family practices located in the region of Opole (South Poland). These women were invited to participate by mail and participated in 2012 and 2013.

2.4. Sequencing of the APOBEC3B Gene

We analyzed the entire coding sequence of APOBEC3B from the exome sequencing data of 617 women with hereditary breast cancer (step 1), as described previously [45]. The Agilent SureSelect human exome kit (V6) was used for capturing target regions. The regions were sequenced on Illumina NextSeq 500. The mean depth of coverage was approximately 100×, 97.4% of the CCDS exons were covered at 20× depth of coverage and higher which is used for variant calling. We looked for protein-truncating genetic variants, including frameshift insertions, deletions, stop codon mutations, and variants at the consensus splice sites, which are likely to be dysfunctional.

2.5. Genotyping

We genotyped 12,484 women with breast cancer and 3740 controls for the APOBEC3B mutation, which was detected by sequencing (step 2). DNA was isolated from 5 to 10 mL of peripheral blood. The c.783delG (p.Val262Phefs) mutation was genotyped using a TaqMan assay (Thermo Fisher Scientific, Waltham, MA, USA) in a LightCycler Real-Time PCR 480 System (Roche Life Science, Mannheim, Germany) using probes: APO-delG [HEX]CTTCTTGGACCTGGTTC[BHQ1] and APO-wt [6FAM] CTTCTTGGACCTGTTCC[BHQ1] and primers APO-delG-F AAGAATCTTCTCTGTGGCTTTTTAC and APO-delG-R CGGGTCCAACTGCAAAGAA. All mutations were confirmed by Sanger sequencing. Sequencing reactions were performed using a BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol using primers GGCTAAGAATCTTCTCTGTG and CAGGAGATGAACCAAGTGAC. Sequencing products were analyzed on an ABI Prism 3100 Genetic Analyzer (Thermo Fisher Scientific).

2.6. Statistical Analysis

The prevalence of the APOBEC3B c.783delG (p.Val262Phefs) allele was estimated in 12,484 breast cancer cases and 3740 cancer-free women. Odds ratios were generated from two-by-two tables. Women with breast cancer, with and without an APOBEC3B mutation, were compared for age at diagnosis and clinical features of the breast cancers. Statistical significance was assessed using Fisher exact test or Chi-squared test where appropriate. Means were compared using the t-test. To estimate the survival of women with and without the mutation, we followed the breast cancer patients from the date of diagnosis until the date of death or July 2014. We compared the survival between mutation carriers and non-carriers by log-rank test. An age-adjusted hazard ratio was calculated using Cox regression analysis.

3. Results

We identified a truncating mutation in four of 617 women (0.61%) with hereditary breast cancer by sequencing the entire APOBEC3B gene. All four patients had the c.783delG (p.Val262Phefs) truncating mutation.
The c.783delG (p.Val262Phefs) variant was genotyped in 12,484 women with unselected breast cancer and 3740 cancer-free controls. It was found in 60 (0.48%) unselected cases and in 19 (0.51%) controls (OR = 0.95, 95% CI 0.56–1.59, p = 0.94). The mutation was detected in 8 of 1968 patients (0.41%) with familial breast cancer within the unselected cases (OR = 0.80, 95% CI 0.35–1.83, p = 0.74). The mutation frequency was identical (0.48%) in women diagnosed at the age of 50 years or below (28 of 5778) and in patients diagnosed above the age of 50 years (32 of 6706). The mutation frequency by age and family history of breast cancer is shown in Table 1.
We compared the clinical characteristics of the patients with breast cancer with and without the APOBEC3B mutation (Table 2). There were no statistically significant differences between mutation carriers and non-carriers in the age of diagnosis, tumor histology, tumor size, lymph node status, ER, PR, and HER2 receptor status.
Survival data were available for 12,353 breast cancer cases. After a mean follow-up of 64 months, there were 10 deaths in 59 carriers of the APOBEC3B mutation (16.9%) and 2044 deaths in 12,294 non-carrier patients (16.6%) (HR = 0.99, 95% CI 0.53–1.84, p = 0.98; log-rank test). The 10-year survival was 78% for the carriers compared to 76% for non-carriers. The age-adjusted HR for mortality given the APOBEC3B mutation was 1.00 (95% CI 0.54–1.86; p = 1.00; Cox regression analysis).
We then analyzed the pedigrees of breast cancer patients with the APOBEC3B mutation to see whether or not there is an excess of different cancers in first- and second-degree relatives. No particular cancer was seen in excess in the relatives of the APOBEC3B mutation carriers, compared to those of non-carriers, including cancers of the breast, prostate, colon, kidney, lung, larynx, pancreas, stomach, cervix, endometrium, ovary, leukemia and lymphoma (Table 3).

4. Discussion

To date, over twenty genes have been associated with a genetic predisposition to breast cancer, but based on the mutation frequencies, the magnitude of cancer risk, and the influence on clinical management with mutation carriers, we consider that the most important breast cancer susceptibility gene to be BRCA1, BRCA2, CHEK2, and PALB2. The two major high-risk susceptibility genes BRCA1 and BRCA2 are routinely screened in familial cases for over two decades [46]. It is established that carriers of BRCA1 and BRCA2 mutations benefit from magnetic resonance imaging (MRI) of the breast, preventive mastectomy, prophylactic oophorectomy, and women with breast or ovarian cancer and a BRCA1/2 mutation benefit from individualized chemotherapy using platins and PARP1 inhibitors [47,48,49,50]. CHEK2 mutations confer about a 3- to 5-fold increased risk of breast cancer in a woman depending on her family history of breast cancer. CHEK2 mutation-associated breast tumors are more likely to be estrogen receptor (ER)-positive than sporadic breast cancers, and patients with breast cancer who carry a CHEK2 mutation respond well to tamoxifen [51,52,53,54]. Recently, we reported that oophorectomy improves the 15-year survival of breast cancer patients with a CHEK2 mutation by about 15% and should be considered in the treatment of CHEK2 mutation-associated breast cancers. The effect of oophorectomy was strongest in women with early-onset breast cancer (50 years or below) and those with adverse prognostic factors [52]. PALB2 mutations confer about a 5-fold increase in the risk of breast cancer and about a 3-fold increase in the risk of ovarian cancer [55,56]. In our previous large study, two PALB2 founder mutations (c.509_510delGA and c.172_175delTTGT) were associated with a 4.5-fold increased risk of breast cancer [56]. We have reported the prognosis of breast cancer associated with a PALB2 mutation to be poor. For PALB2 mutation carriers breast MRI is recommended and preventive mastectomy and oophorectomy should be discussed [56,57,58].
Poland is a genetically homogenous country, and this is expressed by the high frequency of founder mutations. Previously, we have identified pathogenic mutations of BRCA1, BRCA2, CHEK2, and PALB2 in about half of 1018 Polish families with hereditary breast cancer, and we have observed that 18 founder mutations are responsible for about 80% of all the mutations detected in these genes [45]. Based on our results, in Poland, we use a panel of founder mutations in BRCA1, BRCA2, CHEK2, and PALB2 as an initial screening tool for all patients with breast cancer and unaffected individuals with a positive family history of breast cancer. The advantages of testing for founder mutations include quick turnaround time and low cost. In patients who are found not to carry a founder mutation, we perform full sequencing using gene panels including BRCA1, BRCA2, CHEK2, and PALB2 in breast cancer cases with familial clustering of this cancer and/or in patients with early onset disease (diagnosed at age 45 or below). In addition, we offer TP53 sequencing for women with breast cancer diagnosed at the age of 30 or below, as it was reported that about 5% of these women carry a TP53 mutation, and radiotherapy is contraindicated for TP53 mutation positive cases [59]. Such a sequential testing approach could be also used in other homogeneous groups, i.e., Ashkenazi Jewish, Icelandic individuals, and French-Canadians, in which the range of mutations is limited [60]. However, it is not possible to apply this approach in genetically heterogeneous Western European countries or in North American populations where the background genetic variation is wide and common founder alleles are not present. In heterogeneous populations, genetic testing is usually based on NGS multigene genetic testing panels that include breast cancer susceptibility genes.
To optimize genetic testing it is necessary to describe the full spectrum of breast cancer predisposing mutations in different populations, and to identify all breast cancer susceptibility genes. In the current study, we asked whether or not APOBEC3B mutations are present in Poland and whether they predispose to breast cancer. The APOBEC3B gene encodes an activation-induced cytidine deaminase (AICDA/AID), which is involved in the immune response against viruses, regulation of DNA methylation, and inducing DNA damage and apoptosis [31,32]. APOBEC3B has been described as a driver of breast cancer [33]. APOBEC3B expression is regulated by estrogen [61], a hormone critical in the pathogenesis of breast cancer. Somatic deletions of the APOBEC3B gene have been detected in breast cancer tumor tissue [36]. In addition, the germline APOBEC3B deletion of ~30 kb, which extends between the last exon of APOBEC3A and the eighth exon of APOBEC3B and removes the entire APOBEC3B protein-coding region, was associated with increased breast cancer risk in Asian populations [37].
In this study, we approached the question if APOBEC3B mutations predispose women to breast cancer in several ways, including the sequencing of the entire APOBEC3B gene in familial cases, and conducted a large case–control study and a pedigree analysis. We also investigated whether or not breast cancers in women with APOBEC3B mutations are associated with specific clinical characteristics and survival among patients. In none of these analyses was there evidence of cancer predisposition for carriers of an APOBEC3B truncating mutation.
Notably, we identified a single truncating mutation of the APOBEC3B gene by sequencing 617 hereditary cases (c.783delG, p.Val262Phefs). In a large case–control study, we showed that the c.783delG founder mutation was not associated with an increased risk of breast cancer in Polish women (OR = 0.95, p = 0.94). The mutation frequency was the same (0.48%) in 5778 women diagnosed at the age of 50 years or below and in 6706 patients diagnosed above the age of 50. These results contrast with those reported by Radmanesh et al., who published that the same c.783delG mutation of the APOBEC3B gene confers an increased risk of unselected breast cancer by 2.3 fold (95% CI 1.04–5.03, p = 0.04) and early onset breast cancer risk (below age of 50) by 3.2 fold (95% CI 1.37; 7.56, p = 0.007) in Belarus, Russia, Germany, and Iran [62]. There are several explanations for the discrepancy between our results and those of Radmanesh et al. [62]. It is likely that the difference is by chance. It is not likely that the difference was due to different mutations because the same APOBEC3B p.Val262Phefs mutation was analyzed in both studies. In our study, we identified a total of 83 mutation carriers, compared to 33 in the previous study. Based on our study there is insufficient evidence that the APOBEC3B p.Val262Phefs truncating mutation predisposes to breast cancer.
The c.783delG mutation results in a frameshift within exon 6 and creates premature termination of the protein 42 codons downstream (p.Val262PhefsTer42, NM_004900). It is located adjacent to the active site at Glu255 and eliminates the metal-binding sites of APOBAC3B, and therefore is predicted to lead to a loss of enzymatic function. In our study, the mutation was detected with an allele frequency of approximately 0.3% in Poland. The mutation has been reported by the Exome Aggregation Consortium (ExAC) at an overall MAF of 0.8%, with the highest prevalence in the African/African American population (5%), and much lower frequencies in European populations (0.3%), Ashkenazi Jews (0.3%) and the South Asian population (0.8%). Our study does not exclude a modest increase in breast cancer risk associated with the c.783delG allele and further studies in other ethnic groups are needed.
Our study is large and benefits from the genetic homogeneity of the Polish population which is populated by ethnic Slavs. The Polish population is well suited for association studies and false results due to admixture have not been reported. Our cases of breast cancer were not selected for family history. We have previously shown that the frequency of Polish founder alleles (i.e., in BRCA1, CHEK2, NBN, RECQL and ATRIP) is similar in different regions of Poland [26].
In summary, our results suggest that the APOBEC3B p.Val262Phefs founder mutation is not associated with an elevated risk of breast cancer in Poland. It was reported that a large deletion of the APOBEC3B gene of 30kb may confer a small increase in the risk of breast cancer risk in Asian populations, but it was not associated with breast cancer risk in non-Asian populations, including the Polish population [44]. It is unlikely that germline APOBEC3B mutations confer a clinically important risk of breast cancer (and probably other cancers). This data does not support the hypothesis that APOBEC3B is a cancer susceptibility gene.

Author Contributions

Conceptualization, K.G., W.K. and C.C.; data curation, K.G., W.K., D.W., T.H., K.S., H.R., A.J., M.S., J.J.-T., M.N., T.K., T.D., J.G., J.L., S.A.N., M.R.A. and C.C.; formal analysis, K.G., D.W., K.S., J.L., S.A.N., M.R.A. and C.C.; investigation, K.G., D.W., K.S. and H.R.; methodology, K.G., W.K., D.W., K.S., H.R., A.J., S.A.N., M.R.A. and C.C.; resources, T.H., M.S., J.J.-T., M.N., T.K., T.D., J.G., J.L. and C.C.; software, K.G., W.K., H.R., A.J. and M.R.A.; supervision, C.C.; validation, K.G., T.H., T.D., J.G., J.L., S.A.N., M.R.A. and C.C.; visualization, K.G., W.K., M.S., T.K. and C.C.; writing—original draft, K.G., M.R.A. and C.C.; writing—review and editing, K.G. and C.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Science Centre, Poland, project number: 2015/17/B/NZ5/02543.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of the Pomeranian Medical University in Szczecin (IRB approval No. KB-0012/97/17). Patient clinical data have been obtained in a manner conforming to IRB ethical guidelines.

Informed Consent Statement

Written informed consent was obtained from all individual participants included in the study.

Data Availability Statement

The main research data supporting the results of this study are included in Table 1, Table 2 and Table 3. As per the consent obtained from the Polish studied subjects, we are not able to share their individual sequence data with any third parties. Other data such as mutation frequencies generated for this study could be shared upon request.

Acknowledgments

We thank Daria Zanoza and Ewa Putresza for their help with managing databases. Thanks the Polish Hereditary Breast Cancer Consortium, other members of the Polish Hereditary Breast Cancer Consortium are: M. Lener, M. Stawicka, P. Domagała, M. Cechowska, M. Bębenek, D. Godlewski, S. Gozdecka-Grodecka, S. Goźdź, O. Haus, H. Janiszewska, M. Jasiówka, E. Kilar, R. Kordek, B. Kozak-Klonowska, G. Książkiewicz, A. Mackiewicz, E. Marczak, J. Mituś, Z. Morawiec, S. Niepsuj, R. Sibilski, M. Siołek, J. Sir, D. Surdyka, A. Synowiec, C. Szczylik, R. Uciński, B. Waśko, R. Wiśniowski, T. Byrski, and B. Górski.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Arnold, M.; Morgan, E.; Rumgay, H.; Mafra, A.; Singh, D.; Laversanne, M.; Vignat, J.; Gralow, J.R.; Cardoso, F.; Siesling, S.; et al. Current and Future Burden of Breast Cancer: Global Statistics for 2020 and 2040. Breast 2022, 66, 15–23. [Google Scholar] [CrossRef]
  2. Narod, S.A.; Foulkes, W.D. BRCA1 and BRCA2: 1994 and beyond. Nat. Rev. Cancer 2004, 4, 665–676. [Google Scholar] [CrossRef]
  3. Friend, S.H. Breast cancer susceptibility testing: Realities in the post-genomic era. Nat. Genet. 1996, 13, 16–17. [Google Scholar] [CrossRef] [PubMed]
  4. Szwiec, M.; Jakubowska, A.; Górski, B.; Huzarski, T.; Tomiczek-Szwiec, J.; Gronwald, J.; Dębniak, T.; Byrski, T.; Kluźniak, W.; Wokołorczyk, D.; et al. Recurrent Mutations of BRCA1 and BRCA2 in Poland: An Update. Clin. Genet. 2015, 87, 288–292. [Google Scholar] [CrossRef] [PubMed]
  5. Rahman, N.; Seal, S.; Thompson, D.; Kelly, P.; Renwick, A.; Elliott, A.; Reid, S.; Spanova, K.; Barfoot, R.; Chagtai, T.; et al. PALB2, Which Encodes a BRCA2-Interacting Protein, Is a Breast Cancer Susceptibility Gene. Nat. Genet. 2007, 39, 165–167. [Google Scholar] [CrossRef] [Green Version]
  6. Antoniou, A.C.; Casadei, S.; Heikkinen, T.; Barrowdale, D.; Pylkäs, K.; Roberts, J.; Lee, A.; Subramanian, D.; De Leeneer, K.; Fostira, F.; et al. Breast-Cancer Risk in Families with Mutations in PALB2. N. Engl. J. Med. 2014, 371, 497–506. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Meijers-Heijboer, H.; van den Ouweland, A.; Klijn, J.; Wasielewski, M.; de Snoo, A.; Oldenburg, R.; Hollestelle, A.; Houben, M.; Crepin, E.; van Veghel-Plandsoen, M.; et al. Low-Penetrance Susceptibility to Breast Cancer due to CHEK2(*)1100delC in Noncarriers of BRCA1 or BRCA2 Mutations. Nat. Genet. 2002, 31, 55–59. [Google Scholar]
  8. Vahteristo, P.; Bartkova, J.; Eerola, H.; Syrjäkoski, K.; Ojala, S.; Kilpivaara, O.; Tamminen, A.; Kononen, J.; Aittomäki, K.; Heikkilä, P.; et al. A CHEK2 Genetic Variant Contributing to a Substantial Fraction of Familial Breast Cancer. Am. J. Hum. Genet. 2002, 71, 432–438. [Google Scholar] [CrossRef] [Green Version]
  9. Goldgar, D.E.; Healey, S.; Dowty, J.G.; Da Silva, L.; Chen, X.; Spurdle, A.B.; Terry, M.B.; Daly, M.J.; Buys, S.M.; Southey, M.C.; et al. Rare Variants in the ATM gene and Risk of Breast Cancer. Breast Cancer Res. 2011, 13, R73. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Ratajska, M.; Antoszewska, E.; Piskorz, A.; Brozek, I.; Borg, Å.; Kusmierek, H.; Biernat, W.; Limon, J. Cancer Predisposing BARD1 Mutations in Breast–ovarian Cancer Families. Breast Cancer Res. Treat. 2012, 131, 89–97. [Google Scholar] [CrossRef] [PubMed]
  11. Suszynska, M.; Kluzniak, W.; Wokolorczyk, D.; Jakubowska, A.; Huzarski, T.; Gronwald, J.; Debniak, T.; Szwiec, M.; Ratajska, M.; Klonowska, K.; et al. BARD1 Is a Low/Moderate Breast Cancer Risk Gene: Evidence Based on An Association Study of the Central European p.Q564X Recurrent Mutation. Cancers 2019, 11, 740. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Heikkinen, K.; Karppinen, S.-M.; Soini, Y.; Mäkinen, M.; Winqvist, R. Mutation Screening of Mre11 Complex Genes: Indication of RAD50 Involvement in Breast and Ovarian Cancer Susceptibility. J. Med. Genet. 2003, 40, e131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Meindl, A.; Hellebrand, H.; Wiek, C.; Erven, V.; Wappenschmidt, B.; Niederacher, D.; Freund, M.; Lichtner, P.; Hartmann, L.; Schaal, H.; et al. Germline Mutations in Breast and Ovarian Cancer Pedigrees Establish RAD51C as a Human Cancer Susceptibility Gene. Nat. Genet. 2010, 42, 410–414. [Google Scholar] [CrossRef]
  14. Osher, D.J.; De Leeneer, K.; Michils, G.; Hamel, N.; Tomiak, E.; Poppe, B.; Leunen, K.; Legius, E.; Shuen, A.; Smith, E.; et al. Mutation Analysis of RAD51D in Non-BRCA1/2 Ovarian and Breast Cancer Families. Br. J. Cancer 2012, 106, 1460–1463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Blanco, A.; Graña, B.; Fachal, L.; Santamariña, M.; Cameselle-Teijeiro, J.; Ruíz-Ponte, C.; Carracedo, A.; Vega, A. Beyond BRCA1 and BRCA2 Wild-Type Breast And/or Ovarian Cancer Families: Germline Mutations in TP53 and PTEN. Clin. Genet. 2010, 77, 193–196. [Google Scholar] [CrossRef]
  16. Guénard, F.; Pedneault, C.S.-L.; Ouellette, G.; Labrie, Y.; Simard, J.; INHERIT; Durocher, F. Evaluation of the Contribution of the Three Breast Cancer Susceptibility Genes CHEK2, STK11, and PALB2 in Non-BRCA1/2 French Canadian Families with High Risk of Breast Cancer. Genet. Test. Mol. Biomark. 2010, 14, 515–526. [Google Scholar] [CrossRef]
  17. Benusiglio, P.R.; Malka, D.; Rouleau, E.; De Pauw, A.; Buecher, B.; Noguès, C.; Fourme, E.; Colas, C.; Coulet, F.; Warcoin, M.; et al. CDH1 Germline Mutations and the Hereditary Diffuse Gastric and Lobular Breast Cancer Syndrome: A Multicentre Study. J. Med. Genet. 2013, 50, 486–489. [Google Scholar] [CrossRef]
  18. Pharoah, P.D.; Guilford, P.; Caldas, C. International Gastric Cancer Linkage Consortium Incidence of Gastric Cancer and Breast Cancer in CDH1 (E-Cadherin) Mutation Carriers from Hereditary Diffuse Gastric Cancer Families. Gastroenterology 2001, 121, 1348–1353. [Google Scholar] [CrossRef] [PubMed]
  19. Kluźniak, W.; Wokołorczyk, D.; Rusak, B.; Huzarski, T.; Kashyap, A.; Stempa, K.; Rudnicka, H.; Jakubowska, A.; Szwiec, M.; Morawska, S.; et al. Inherited Variants in BLM and the Risk and Clinical Characteristics of Breast Cancer. Cancers 2019, 11, 1548. [Google Scholar] [CrossRef] [Green Version]
  20. Górski, B.; Debniak, T.; Masojć, B.; Mierzejewski, M.; Medrek, K.; Cybulski, C.; Jakubowska, A.; Kurzawski, G.; Chosia, M.; Scott, R.; et al. Germline 657del5 Mutation in the NBS1 Gene in Breast Cancer Patients. Int. J. Cancer 2003, 106, 379–381. [Google Scholar] [CrossRef]
  21. Park, D.J.; Lesueur, F.; Nguyen-Dumont, T.; Pertesi, M.; Odefrey, F.; Hammet, F.; Neuhausen, S.L.; John, E.M.; Andrulis, I.L.; Terry, M.B.; et al. Rare Mutations in XRCC2 Increase the Risk of Breast Cancer. Am. J. Hum. Genet. 2012, 90, 734–739. [Google Scholar] [CrossRef] [Green Version]
  22. Akbari, M.R.; Cybulski, C. RECQL: A DNA Helicase in Breast Cancer. Oncotarget 2015, 6, 26558–26559. [Google Scholar] [CrossRef]
  23. Seal, S.; Thompson, D.; Renwick, A.; Elliott, A.; Kelly, P.; Barfoot, R.; Chagtai, T.; Jayatilake, H.; Ahmed, M.; Spanova, K.; et al. Truncating Mutations in the Fanconi Anemia J Gene BRIP1 Are Low-Penetrance Breast Cancer Susceptibility Alleles. Nat. Genet. 2006, 38, 1239–1241. [Google Scholar] [CrossRef] [PubMed]
  24. Breast Cancer Association Consortium; Dorling, L.; Carvalho, S.; Allen, J.; González-Neira, A.; Luccarini, C.; Wahlström, C.; Pooley, K.A.; Parsons, M.T.; Fortuno, C.; et al. Breast Cancer Risk Genes—Association Analysis in More than 113,000 Women. N. Engl. J. Med. 2021, 384, 428–439. [Google Scholar]
  25. Hu, C.; Hart, S.N.; Gnanaolivu, R.; Huang, H.; Lee, K.Y.; Na, J.; Gao, C.; Lilyquist, J.; Yadav, S.; Boddicker, N.J.; et al. A Population-Based Study of Genes Previously Implicated in Breast Cancer. N. Engl. J. Med. 2021, 384, 440–451. [Google Scholar] [CrossRef] [PubMed]
  26. Cybulski, C.; Zamani, N.; Kluźniak, W.; Milano, L.; Wokołorczyk, D.; Stempa, K.; Rudnicka, H.; Zhang, S.; Zadeh, M.; Huzarski, T.; et al. Variants in ATRIP Are Associated with Breast Cancer Susceptibility in the Polish Population and UK Biobank. Am. J. Hum. Genet. 2023, 110, 648–662. [Google Scholar] [CrossRef]
  27. Jarmuz, A.; Chester, A.; Bayliss, J.; Gisbourne, J.; Dunham, I.; Scott, J.; Navaratnam, N. An Anthropoid-Specific Locus of Orphan C to U RNA-Editing Enzymes on Chromosome 22. Genomics 2002, 79, 285–296. [Google Scholar] [CrossRef]
  28. Navaratnam, N.; Sarwar, R. An Overview of Cytidine Deaminases. Int. J. Hematol. 2006, 83, 195–200. [Google Scholar] [CrossRef] [PubMed]
  29. Suspène, R.; Aynaud, M.-M.; Guétard, D.; Henry, M.; Eckhoff, G.; Marchio, A.; Pineau, P.; Dejean, A.; Vartanian, J.-P.; Wain-Hobson, S. Somatic Hypermutation of Human Mitochondrial and Nuclear DNA by APOBEC3 Cytidine Deaminases, a Pathway for DNA Catabolism. Proc. Natl. Acad. Sci. 2011, 108, 4858–4863. [Google Scholar] [CrossRef] [Green Version]
  30. Shinohara, M.; Io, K.; Shindo, K.; Matsui, M.; Sakamoto, T.; Tada, K.; Kobayashi, M.; Kadowaki, N.; Takaori-Kondo, A. APOBEC3B Can Impair Genomic Stability by Inducing Base Substitutions in Genomic DNA in Human Cells. Sci. Rep. 2012, 2, 806. [Google Scholar] [CrossRef] [Green Version]
  31. Refsland, E.W.; Harris, R.S. The APOBEC3 Family of Retroelement Restriction Factors. Curr. Top. Microbiol. Immunol. 2013, 371, 1–27. [Google Scholar]
  32. Mao, Y.; Lv, M.; Zhang, Y.; Nie, G.; Cui, J.; Wang, Y.; Wang, Y.; Cao, W.; Liu, X.; Wang, X.; et al. APOBEC3B expression and its prognostic potential in breast cancer. Oncol Lett. 2020, 4, 3205–3214. [Google Scholar] [CrossRef] [Green Version]
  33. Alexandrov, L.B.; Nik-Zainal, S.; Wedge, D.C.; Aparicio, S.A.J.R.; Behjati, S.; Biankin, A.V.; Bignell, G.R.; Bolli, N.; Borg, A.; Børresen-Dale, A.-L.; et al. Signatures of Mutational Processes in Human Cancer. Nature 2013, 500, 415–421. [Google Scholar] [CrossRef] [Green Version]
  34. Asaoka, M.; Patnaik, S.K.; Ishikawa, T.; Takabe, K. Different Members of the APOBEC3 Family of DNA Mutators Have Opposing Associations with the Landscape of Breast Cancer. Am. J. Cancer Res. 2021, 11, 5111–5125. [Google Scholar] [PubMed]
  35. Kanu, N.; Cerone, M.A.; Goh, G.; Zalmas, L.-P.; Bartkova, J.; Dietzen, M.; McGranahan, N.; Rogers, R.; Law, E.K.; Gromova, I.; et al. DNA Replication Stress Mediates APOBEC3 Family Mutagenesis in Breast Cancer. Genome Biol. 2016, 17, 185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Komatsu, A.; Nagasaki, K.; Fujimori, M.; Amano, J.; Miki, Y. Identification of Novel Deletion Polymorphisms in Breast Cancer. Int. J. Oncol. 2008, 33, 261–270. [Google Scholar]
  37. Long, J.; Delahanty, R.J.; Li, G.; Gao, Y.-T.; Lu, W.; Cai, Q.; Xiang, Y.-B.; Li, C.; Ji, B.-T.; Zheng, Y.; et al. A Common Deletion in the APOBEC3 Genes and Breast Cancer Risk. J. Natl. Cancer Inst. 2013, 105, 573–579. [Google Scholar] [CrossRef]
  38. Rezaei, M.; Hashemi, M.; Hashemi, S.M.; Mashhadi, M.A.; Taheri, M. APOBEC3 Deletion Is Associated with Breast Cancer Risk in a Sample of Southeast Iranian Population. Int. J. Mol. Cell Med. 2015, 4, 103–108. [Google Scholar]
  39. Wen, W.X.; Soo, J.S.-S.; Kwan, P.Y.; Hong, E.; Khang, T.F.; Mariapun, S.; Lee, C.S.-M.; Hasan, S.N.; Rajadurai, P.; Yip, C.H.; et al. Germline APOBEC3B Deletion Is Associated with Breast Cancer Risk in an Asian Multi-Ethnic Cohort and with Immune Cell Presentation. Breast Cancer Res. 2016, 18, 56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Xuan, D.; Li, G.; Cai, Q.; Deming-Halverson, S.; Shrubsole, M.J.; Shu, X.-O.; Kelley, M.C.; Zheng, W.; Long, J. APOBEC3 Deletion Polymorphism Is Associated with Breast Cancer Risk among Women of European Ancestry. Carcinogenesis 2013, 34, 2240–2243. [Google Scholar] [CrossRef] [Green Version]
  41. Göhler, S.; Da Silva Filho, M.I.; Johansson, R.; Enquist-Olsson, K.; Henriksson, R.; Hemminki, K.; Lenner, P.; Försti, A. Impact of Functional Germline Variants and a Deletion Polymorphism in APOBEC3A and APOBEC3B on Breast Cancer Risk and Survival in a Swedish Study Population. J. Cancer Res. Clin. Oncol. 2016, 142, 273–276. [Google Scholar] [CrossRef] [PubMed]
  42. Marouf, C.; Göhler, S.; Filho, M.I.D.S.; Hajji, O.; Hemminki, K.; Nadifi, S.; Försti, A. Analysis of Functional Germline Variants in APOBEC3 and Driver Genes on Breast Cancer Risk in Moroccan Study Population. BMC Cancer 2016, 16, 165. [Google Scholar] [CrossRef] [Green Version]
  43. Revathidevi, S.; Manikandan, M.; Rao, A.K.D.M.; Vinothkumar, V.; Arunkumar, G.; Rajkumar, K.S.; Ramani, R.; Rajaraman, R.; Ajay, C.; Munirajan, A.K. Analysis of APOBEC3A/3B Germline Deletion Polymorphism in Breast, Cervical and Oral Cancers from South India and Its Impact on miRNA Regulation. Tumor Biol. 2016, 37, 11983–11990. [Google Scholar] [CrossRef]
  44. Klonowska, K.; Kluzniak, W.; Rusak, B.; Jakubowska, A.; Ratajska, M.; Krawczynska, N.; Vasilevska, D.; Czubak, K.; Wojciechowska, M.; Cybulski, C.; et al. The 30 Kb Deletion in the APOBEC3 Cluster Decreases APOBEC3A and APOBEC3B Expression and Creates a Transcriptionally Active Hybrid Gene but Does Not Associate with Breast Cancer in the European Population. Oncotarget 2017, 8, 76357–76374. [Google Scholar] [CrossRef] [Green Version]
  45. Cybulski, C.; Kluźniak, W.; Huzarski, T.; Wokołorczyk, D.; Kashyap, A.; Rusak, B.; Stempa, K.; Gronwald, J.; Szymiczek, A.; Bagherzadeh, M.; et al. The Spectrum of Mutations Predisposing to Familial Breast Cancer in Poland. Int. J. Cancer 2019, 145, 3311–3320. [Google Scholar] [CrossRef] [PubMed]
  46. Pujol, P.; Barberis, M.; Beer, P.; Friedman, E.; Piulats, J.M.; Capoluongo, E.D.; Garcia Foncillas, J.; Ray-Coquard, I.; Penault-Llorca, F.; Foulkes, W.D.; et al. Clinical Practice Guidelines for BRCA1 and BRCA2 Genetic Testing. Eur. J. Cancer 2021, 146, 30–47. [Google Scholar] [CrossRef]
  47. Metcalfe, K.; Eisen, A.; Senter, L.; Armel, S.; Bordeleau, L.; Meschino, W.S.; Pal, T.; Lynch, H.T.; Tung, N.M.; Kwong, A.; et al. International Trends in the Uptake of Cancer Risk Reduction Strategies in Women with a BRCA1 or BRCA2 Mutation. Br. J. Cancer 2019, 121, 15–21. [Google Scholar] [CrossRef] [Green Version]
  48. Narod, S.A.; Huzarski, T.; Gronwald, J.; Byrski, T.; Marczyk, E.; Cybulski, C.; Szwiec, M.; Wisniowski, R.; Birkenfeld, B.; Kilar, E.; et al. Predictors of Survival for Breast Cancer Patients with a BRCA1 Mutation. Breast Cancer Res. Treat. 2018, 168, 513–521. [Google Scholar] [CrossRef]
  49. Tutt, A.; Tovey, H.; Cheang, M.C.U.; Kernaghan, S.; Kilburn, L.; Gazinska, P.; Owen, J.; Abraham, J.; Barrett, S.; Barrett-Lee, P.; et al. Carboplatin in BRCA1/2-Mutated and Triple-Negative Breast Cancer BRCAness Subgroups: The TNT Trial. Nat. Med. 2018, 24, 628–637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Cortesi, L.; Rugo, H.S.; Jackisch, C. An Overview of PARP Inhibitors for the Treatment of Breast Cancer. Target. Oncol. 2021, 16, 255–282. [Google Scholar] [CrossRef]
  51. Weischer, M.; Bojesen, S.E.; Ellervik, C.; Tybjaerg-Hansen, A.; Nordestgaard, B.G. CHEK2*1100delC Genotyping for Clinical Assessment of Breast Cancer Risk: Meta-Analyses of 26,000 Patient Cases and 27,000 Controls. J. Clin. Oncol. 2008, 26, 542–548. [Google Scholar] [CrossRef] [Green Version]
  52. Tomiczek-Szwiec, J.; Szwiec, M.; Falco, M.; Cybulski, C.; Wokolorczyk, D.; Jakubowska, A.; Gronwald, J.; Stawicka, M.; Godlewski, D.; Kilar, E.; et al. The Impact of Oophorectomy on Survival from Breast Cancer in Patients with CHEK2 Mutations. Br. J. Cancer 2022, 127, 84–91. [Google Scholar] [CrossRef]
  53. Cybulski, C.; Huzarski, T.; Byrski, T.; Gronwald, J.; Debniak, T.; Jakubowska, A.; Górski, B.; Wokołorczyk, D.; Masojć, B.; Narod, S.A.; et al. Estrogen Receptor Status in CHEK2-Positive Breast Cancers: Implications for Chemoprevention. Clin. Genet. 2009, 75, 72–78. [Google Scholar] [CrossRef]
  54. Cybulski, C.; Wokołorczyk, D.; Jakubowska, A.; Huzarski, T.; Byrski, T.; Gronwald, J.; Masojć, B.; Deebniak, T.; Górski, B.; Blecharz, P.; et al. Risk of Breast Cancer in Women with a CHEK2 Mutation with and without a Family History of Breast Cancer. J. Clin. Oncol. 2011, 29, 3747–3752. [Google Scholar] [CrossRef]
  55. Łukomska, A.; Menkiszak, J.; Gronwald, J.; Tomiczek-Szwiec, J.; Szwiec, M.; Jasiówka, M.; Blecharz, P.; Kluz, T.; Stawicka-Niełacna, M.; Mądry, R.; et al. Recurrent Mutations in BRCA1, BRCA2, RAD51C, PALB2 and CHEK2 in Polish Patients with Ovarian Cancer. Cancers 2021, 13, 849. [Google Scholar] [CrossRef]
  56. Cybulski, C.; Kluźniak, W.; Huzarski, T.; Wokołorczyk, D.; Kashyap, A.; Jakubowska, A.; Szwiec, M.; Byrski, T.; Dębniak, T.; Górski, B.; et al. Clinical Outcomes in Women with Breast Cancer and a PALB2 Mutation: A Prospective Cohort Analysis. Lancet Oncol. 2015, 16, 638–644. [Google Scholar] [CrossRef]
  57. Hanson, H.; Kulkarni, A.; Loong, L.; Kavanaugh, G.; Torr, B.; Allen, S.; Ahmed, M.; Antoniou, A.C.; Cleaver, R.; Dabir, T.; et al. UK Consensus Recommendations for Clinical Management of Cancer Risk for Women with Germline Pathogenic Variants in Cancer Predisposition Genes: RAD51C, RAD51D, BRIP1 and PALB2. J. Med. Genet. 2023, 60, 417–429. [Google Scholar] [CrossRef] [PubMed]
  58. Lowry, K.P.; Geuzinge, H.A.; Stout, N.K.; Alagoz, O.; Hampton, J.; Kerlikowske, K.; de Koning, H.J.; Miglioretti, D.L.; van Ravesteyn, N.T.; Schechter, C.; et al. Breast Cancer Screening Strategies for Women With ATM, CHEK2, and PALB2 Pathogenic Variants: A Comparative Modeling Analysis. JAMA Oncol. 2022, 8, 587–596. [Google Scholar] [CrossRef] [PubMed]
  59. Rogoża-Janiszewska, E.; Malińska, K.; Górski, B.; Scott, R.J.; Cybulski, C.; Kluźniak, W.; Lener, M.; Jakubowska, A.; Gronwald, J.; Huzarski, T.; et al. Prevalence of Germline TP53 Variants among Early-Onset Breast Cancer Patients from Polish Population. Breast Cancer 2021, 28, 226–235. [Google Scholar] [CrossRef] [PubMed]
  60. Zhang, B.; Beeghly-Fadiel, A.; Long, J.; Zheng, W. Genetic Variants Associated with Breast-Cancer Risk: Comprehensive Research Synopsis, Meta-Analysis, and Epidemiological Evidence. Lancet Oncol. 2011, 12, 477–488. [Google Scholar] [CrossRef] [Green Version]
  61. Pauklin, S.; Sernández, I.V.; Bachmann, G.; Ramiro, A.R.; Petersen-Mahrt, S.K. Estrogen Directly Activates AID Transcription and Function. J. Exp. Med. 2009, 206, 99–111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Radmanesh, H.; Spethmann, T.; Enßen, J.; Schürmann, P.; Bhuju, S.; Geffers, R.; Antonenkova, N.; Khusnutdinova, E.; Sadr-Nabavi, A.; Shandiz, F.H.; et al. Assessment of an APOBEC3B Truncating Mutation, c.783delG, in Patients with Breast Cancer. Breast Cancer Res. Treat. 2017, 162, 31–37. [Google Scholar] [CrossRef] [PubMed]
Table
Table 1. Prevalence of the APOBEC3B c.783delG (p.Val262Phefs) mutation in 12,484 women with breast cancer, by age and family history of breast cancer in 3740 cancer-free women.
Table 1. Prevalence of the APOBEC3B c.783delG (p.Val262Phefs) mutation in 12,484 women with breast cancer, by age and family history of breast cancer in 3740 cancer-free women.
Total (n)APOBEC3B
Mutation Positive		Prevalence (%)OR (CI 95%)p-Value
Patients with Breast Cancer
All cases 12,484600.48%0.95 (0.56–1.59)0.9
Age (years)
≤40131070.53%1.06 (0.44–2.51)0.9
41–504468 210.47%0.93 (0.50–1.72)0.9
51–603220 140.43%0.86 (0.43–1.71)0.8
61–702206 130.59%1.16 (0.57–2.36)0.8
≥711280 50.39%0.77 (0.29 –2.06)0.8
Number of Relatives with Breast Cancer *
09583460.48%0.95 (0.55–1.61)0.9
1151050.33%0.65 (0.24–1.75)0.5
≥245830.66%1.29 (0.38–4.39)0.9
Reference
Cancer-free controls3740190.51%--
Footnote: Odds ratios and p values calculated using cancer-free controls as a reference group. The distribution of genotypes was within the Hardy–Weinberg Equilibrium both among cases (p = 0.8) and controls (p = 0.9). * in first-degree or second-degree relatives.
Table
Table 2. Clinical characteristics of breast cancers in carriers of the APOBEC3B c.783delG (p.Val262Phefs) mutation and in non-carriers.
Table 2. Clinical characteristics of breast cancers in carriers of the APOBEC3B c.783delG (p.Val262Phefs) mutation and in non-carriers.
APOBEC3B Mutation
Positive Cases
n = 60		APOBEC3B Mutation
Negative Cases
n = 12,424		p-Value
Age at diagnosis (years)53.5 (33–83)54.0 (18–93)0.7
Histological features
Ductal, grade 37/52 (13.5%)2023/10,093 (20%)0.3
Ductal, grade 1–222/52 (42.3%)4049/10,093 (40.1%)0.9
Ductal, grade unknown4/52 (7.7%)669/10,093 (6.6%)1.0
Medullary0/52 (0%)294/10,093 (2.9%)0.4
Lobular5/52 (9.6%)1241/10,093 (12.3%)0.7
Tubulolobular2/52 (3.8%)114/10,093 (1.1%)0.2
DCIS with microinvasion2/52 (3.8%)304/10,093 (3%)0.7
Other or undefined10/52 (19.2%)1399/10,093 (13.9%)0.4
Receptor status
Estrogen receptor-positive36/43 (83.7%)5963/8592 (69.4%)0.1
Progesterone receptor-positive35/44 (79.5%)5882/8290 (70.9%)0.3
HER2-positive4/34 (11.8%)1275/7243 (17.6%)0.5
Size (cm)
<17/46 (15.2%)905/7929 (11.4%)0.6
1–1.922/46 (47.8%)3212/7929 (40.5%)0.4
2–4.917/46 (37%)3482/7929 (43.9%)0.4
≥50/46 (0%)330/7929 (4.1%)0.3
Lymph node-positive14/47 (29.8%)3560/8179 (43.5%)0.1
Bilateral5/50 (10%)448/9786 (4.6%)0.1
Multifocal5/49 (10.2%)1068/8110 (13.2%)0.7
Chemotherapy (yes)24/50 (48%)4923/9166 (53.7%)0.5
Tamoxifen (yes)29/37 (78.4%)4116/6150 (66.9%)0.2
Vital status (deceased)10/59 (16.9%)2044/12,294 (16.6%)0.9
Footnote: data represent mean (range) or number/total (%), p-values compare mutation positive to mutation negative patients and were calculated using Fisher’s exact test; DCIS = ductal carcinoma in situ.
Table
Table 3. Cancers reported in the families of the 54 unselected breast cancer cases with the APOBEC3B c.783delG (p.Val262Phefs) mutation compared to those reported by the 11,497 non-carrier cases.
Table 3. Cancers reported in the families of the 54 unselected breast cancer cases with the APOBEC3B c.783delG (p.Val262Phefs) mutation compared to those reported by the 11,497 non-carrier cases.
Cancer SiteNumber (%) of Cancers
in Relatives of
APOBEC3B Mutation Positive Patients
(n = 54 Families)		Number (%) of Cancers in Relatives of
APOBEC3B Mutation Negative Patients
(n = 11,497 Families)		p-Value
N%N%
Breast916.7%190416.6%1.0
Colon 11.9%8917.8%0.2
Kidney 23.7%3102.7%1.0
Larynx 35.6%4543.9%0.8
Lung 611.1%168814.7%0.6
Leukemia or Lymphoma23.7%4624.0%0.9
Pancreas 23.7%3222.8%0.7
Prostate 47.4%7886.9%0.9
Stomach 11.9%9688.4%0.1
Cervix/Endometrium11.9%117910.3%0.1
Ovary 23.7%3893.4%0.9
Footnote: Cancer family history refers to tumors diagnosed in first- and second-degree relatives of breast cancer patients. Family history data were available for 54 of 60 APOBEC3B mutation carriers and 11,497 of 12,434 non-carriers.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gliniewicz, K.; Kluźniak, W.; Wokołorczyk, D.; Huzarski, T.; Stempa, K.; Rudnicka, H.; Jakubowska, A.; Szwiec, M.; Jarkiewicz-Tretyn, J.; Naczk, M.; et al. The APOBEC3B c.783delG Truncating Mutation Is Not Associated with an Increased Risk of Breast Cancer in the Polish Population. Genes 2023, 14, 1329. https://doi.org/10.3390/genes14071329

AMA Style

Gliniewicz K, Kluźniak W, Wokołorczyk D, Huzarski T, Stempa K, Rudnicka H, Jakubowska A, Szwiec M, Jarkiewicz-Tretyn J, Naczk M, et al. The APOBEC3B c.783delG Truncating Mutation Is Not Associated with an Increased Risk of Breast Cancer in the Polish Population. Genes. 2023; 14(7):1329. https://doi.org/10.3390/genes14071329

Chicago/Turabian Style

Gliniewicz, Katarzyna, Wojciech Kluźniak, Dominika Wokołorczyk, Tomasz Huzarski, Klaudia Stempa, Helena Rudnicka, Anna Jakubowska, Marek Szwiec, Joanna Jarkiewicz-Tretyn, Mariusz Naczk, and et al. 2023. "The APOBEC3B c.783delG Truncating Mutation Is Not Associated with an Increased Risk of Breast Cancer in the Polish Population" Genes 14, no. 7: 1329. https://doi.org/10.3390/genes14071329

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop