Effect of Exogenous Hormone on R-Spondin 2 (Rspo2) and R-Spondin 3 (Rspo3) Gene Expression and Embryo Development in Chinese Soft-Shelled Turtle (Pelodiscus sinensis)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.2. Estradiol Treatment
2.3. RNA Isolation and PCR
2.4. Sequence Analysis and Homology Analyses
2.5. Gene Expression Analysis by Quantitative Real-Time Reverse Transcription–PCR (RT-qPCR)
2.6. Statistical Analysis
3. Results
3.1. Analysis of Chinese Soft-Shelled Turtle RSPO2 and RSPO3 cDNA and Protein Sequences
3.2. Expression Patterns of Rspo2 and Rspo3 in Different Tissues of Chinese Soft-Shelled Turtles
3.3. Effects of E2 on the Expression of Rspo2 and Rspo3 during Embryonic Development of Chinese Soft-Shelled Turtles
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gong, S.P.; Melita, V.; Markus, A.; Peter, P.; Uwe, F. Millennium-old farm breeding of Chinese softshell turtles (Pelodiscus spp.) results in massive erosion of biodiversity. Die Naturwissenschaften 2018, 105, 34. [Google Scholar] [CrossRef]
- Liang, H.W.; Wang, L.H.; Sha, H.; Zou, G.W. Development and Validation of Sex-Specific Markers in Pelodiscus Sinensis Using Restriction Site-Associated DNA Sequencing. Genes 2019, 10, 302. [Google Scholar] [CrossRef] [Green Version]
- Zhou, L.Y.; Tapas, C.; Yu, X.G.; Wu, L.M.; Liu, G.; Sipra, M.; Wang, D.S.; Yoshitaka, N. R-spondins are involved in the ovarian differentiation in a teleost, medaka (Oryzias latipes). BMC Dev. Biol. 2012, 12, 36. [Google Scholar] [CrossRef] [Green Version]
- Kazanskaya, O.; Glinka, A.; Barrantes, I.d.B.; Stannek, P.; Niehrs, C.; Wu, W. R-Spondin2 Is a Secreted Activator of Wnt/β-Catenin Signaling and Is Required for Xenopus Myogenesis. Dev. Cell 2004, 7, 525–534. [Google Scholar] [CrossRef] [Green Version]
- Nam, J.S.; Park, E.; Turcotte, T.J.; Palencia, S.; Zhan, X.M.; Lee, J.; Yun, K.; Funk, W.D.; Yoon, J.K. Mouse R-spondin2 is required for apical ectodermal ridge maintenance in the hindlimb. Dev. Biol. 2007, 311, 124–135. [Google Scholar] [CrossRef] [Green Version]
- Choi, Y.; Qin, Y.Y.; Berger, M.F.; Ballow, D.J.; Bulyk, M.L.; Rajkovic, A. Microarray analyses of newborn mouse ovaries lacking Nobox. Biol. Reprod. 2007, 77, 312–319. [Google Scholar] [CrossRef] [Green Version]
- Kocer, A.; Pinheiro, I.; Pannetier, M.; Renault, L.; Parma, P.; Radi, O.; Kim, K.A.; Camerino, G.; Pailhoux, E.; Aleksandar, R. R-spondin1 and FOXL2 act into two distinct cellular types during goat ovarian differentiation. BMC Dev. Biol. 2008, 8, 36. [Google Scholar] [CrossRef] [Green Version]
- Motoko, A.; Michihiro, M.; Toshio, I.; Yoshio, H.; Harukazu, N.; Hitoshi, O. R-spondin3 is required for mouse placental development. Dev. Biol. 2007, 301, 218–226. [Google Scholar]
- Hu, Q.M.; Meng, Y.; Tian, H.F.; Zhang, Y.U.; Xiao, H.B. Sexually Dimorphic Expression of Foxl2 and Ftz-F1 in Chinese Giant Salamander Andrias Davidianus. J. Exp. Zool. Part B Mol. Dev. Evol. 2016, 326, 363–374. [Google Scholar] [CrossRef]
- Barske, L.A.; Capel, B. Estrogen represses SOX9 during sex determination in the red-eared slider turtle Trachemys scripta. Dev. Biol. 2010, 341, 305–314. [Google Scholar] [CrossRef]
- Schulz, R.W.; Bogerd, J.; Male, R.; Ball, J.; Fenske, M.; Olsen, L.C.; Tyler, C.R. Estrogen-induced alterations in amh and dmrt1 expression signal for disruption in male sexual development in the zebrafish. Environ. Sci. Technol. 2007, 41, 6305–6310. [Google Scholar] [CrossRef] [PubMed]
- Zhou, T.; Chen, G.B.; Chen, M.; Wang, Y.B.; Zou, G.W.; Liang, H.W. Direct Full-Length RNA Sequencing Reveals an Important Role of Epigenetics During Sexual Reversal in Chinese Soft-Shelled Turtle. Front. Cell Dev. Biol. 2022, 10, 876045. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y. Study on the Gender Identity of Trionyx Sinensis and the Impact of Exogenous Hormones. Master’s Thesis, Southwest University, Chongqing, China, 2015. [Google Scholar]
- Liang, H.W.; Meng, Y.; Cao, L.H.; Li, X.; Zou, G.W. Effect of exogenous hormones on R-spondin 1 (RSPO1) gene expression and embryo development in Pelodiscus sinensis. Reprod. Fertil. Dev. 2019, 31, 1425–1433. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.H.; Zhang, Y.Y.; Ling, C.; Zou, G.W.; Liang, H.W. Chinese Softshelled Turtle Pelodiscus sinensis: Embryonic Development and Embryo Staging. Chin. Agric. Sci. Bull. 2020, 36, 152–158. [Google Scholar]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101. [Google Scholar] [CrossRef]
- Logan, C.Y.; Nusse, R. The Wnt signaling pathway in development and disease. Annu. Rev. Cell Dev. Biol. 2004, 20, 781–810. [Google Scholar] [CrossRef] [Green Version]
- Wu, L.M.; Yang, P.; Luo, F.; Wang, D.S.; Zhou, L.Y. R-spondin1 signaling pathway is required for both the ovarian and testicular development in a teleosts, Nile tilapia (Oreochromis niloticus). Gen. Comp. Endocrinol. 2016, 230–231, 177–185. [Google Scholar] [CrossRef]
- De Lau, W.B.; Snel, B.; Clevers, H.C. The R-spondin protein family. Genome Biol. 2012, 13, 242. [Google Scholar] [CrossRef] [Green Version]
- Nam, J.S.; Turcotte, T.J.; Smith, P.F.; Choi, S.; Yoon, J.K. Mouse Cristin/R-spondin Family Proteins Are Novel Ligands for the Frizzled 8 and LRP6 Receptors and Activate β-Catenin-dependent Gene Expression. J. Biol. Chem. 2006, 281, 13247–13257. [Google Scholar] [CrossRef] [Green Version]
- Ter Steege, E.J.; Bakker, E.R.M. The role of R-spondin proteins in cancer biology. Oncogene 2021, 40, 6469–6478. [Google Scholar] [CrossRef]
- Kazanskaya, O.; Ohkawara, B.; Heroult, M.; Wu, W.; Maltry, N.; Augustin, H.G.; Niehrs, C. The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development. Development 2008, 135, 3655–3664. [Google Scholar] [CrossRef] [Green Version]
- Cao, L.H. Study on the Effects of Temperature and Hormones on the Sex of the Chinese Soft-Shelled Trutle Pelodiscus sinensis. Master’s Thesis, Huazhong Agruicultural University, Wuhan, China, 2018. [Google Scholar]
- Shoemaker, C.M.; Crews, D. Analyzing the coordinated gene network underlying temperature-dependent sex determination in reptiles. Semin. Cell Dev. Biol. 2008, 20, 293–303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsumoto, Y.; Crews, D. Molecular mechanisms of temperature-dependent sex determination in the context of ecological developmental biology. Mol. Cell. Endocrinol. 2012, 354, 103–110. [Google Scholar] [CrossRef]
- Zhou, T.; Chen, G.B.; Chen, M.; Wang, Y.B.; Zou, G.W.; Liang, H.W. Tandem Mass Tag-Based Quantitative Proteomics Analysis of Gonads Reveals New Insight into Sexual Reversal Mechanism in Chinese Soft-Shelled Turtles. Biology 2022, 11, 1081. [Google Scholar] [CrossRef] [PubMed]
- Zhou, T.; Sha, H.; Chen, M.; Chen, G.B.; Zou, G.W.; Liang, H.W. MicroRNAs May Play an Important Role in Sexual Reversal Process of Chinese Soft-Shelled Turtle, Pelodiscus sinensis. Genes 2021, 12, 1696. [Google Scholar] [CrossRef] [PubMed]
- Nagahama, Y. Molecular mechanisms of sex determination and gonadal sex differentiation in fish. Fish Physiol. Biochem. 2005, 31, 105–109. [Google Scholar] [CrossRef]
- Ann, O.C.; Thea, H.B.; Suzanne, C.; Steve, M.; Marius, B.; John, A.M. Developmental Exposure to Anthracenen and Estradiol Alters Reproductive Success in Medaka (Oryzias latipes). Environ. Sci. 2001, 8, 31–45. [Google Scholar]
- Wang, Y.B.; Luo, X.Z.; Qu, C.J.; Xu, T.; Zou, G.W.; Liang, H.W. The Important Role of Sex-Related Sox Family Genes in the Sex Reversal of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Biology 2022, 11, 83. [Google Scholar] [CrossRef]
- Flament, S.; Chardard, D.; Chesnel, A.; Dumond, H. Sex Determination and Sexual Differentiation in Amphibians. In Hormones and Reproduction of Vertebrates; Academic Press: Cambridge, MA, USA, 2011; pp. 1–19. [Google Scholar]
- Phuge, S.K.; Gramapurohit, N.P. Sex hormones alter sex ratios in the Indian skipper frog, Euphlyctis cyanophlyctis: Determining sensitive stages for gonadal sex reversal. Gen. Comp. Endocrinol. 2015, 220, 70–77. [Google Scholar] [CrossRef]
- Li, H.J. Study on the Differentiation of Gonad and the Effects of Temperatures on It in Trionyx sinensis. Master’s Thesis, Hebei University, Baoding, China, 2012. [Google Scholar]
- Chen, G.B.; Zhou, T.; Chen, M.; Zou, G.W.; Liang, H.W. Effect of Estradiol on Estrogen Nuclear Receptors Genes Expression on Embryonic Development Stages in Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Fishes 2022, 7, 223. [Google Scholar] [CrossRef]
- Chikae, M.; Ikeda, R.; Hasan, Q.; Morita, Y.; Tamiya, E. Effects of tamoxifen, 17α-ethynylestradiol, flutamide, and methyltestosterone on plasma vitellogenin levels of male and female Japanese medaka (Oryzias latipes). Environ. Toxicol. Pharmacol. 2004, 17, 29–33. [Google Scholar] [CrossRef] [PubMed]
- Pinto, P.I.; Teodósio, H.R.; Galay-Burgos, M.; Power, D.M.; Sweeney, G.E.; Canário, A.V. Identification of estrogen-responsive genes in the testis of sea bream (Sparus auratus) using suppression subtractive hybridization. Mol. Reprod. Dev. 2006, 73, 318–329. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.Q.; Zhang, S.Y.; Duan, Y.Q.; Zhang, W.P. 17β-estradiol induced channel catfish females. Acta Hydrobiol. Sin. 2022, 46, 1668–1674. [Google Scholar]
- Wang, C.L.; Guan, W.Z.; Li, Y.Q.; Liu, F. Study on 17β-estradiol induced feminization of Pelteobagrus fulvidrac. South China Fish. Sci. 2020, 16, 25–30. [Google Scholar]
- Teal, C.N.; Schill, D.J.; Fogelson, S.B.; Roberts, C.M.; Fitzsimmons, K.; Bauder, J.M.; Stewart, W.T.; Bonar, S.A. The effects of estradiol-17β on the sex reversal, survival, and growth of green sunfish Lepomis cyanellus. Aquaculture 2023, 562, 738853. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′-3′) | Insert Size | Application |
---|---|---|---|
Rspo2-F | ACGAGAAGGAATGAGGCAGTATG | 757 | CDS amplification |
Rspo2-R | AACTGCCACACCACTTCCACT | ||
Rspo3-F1 | TTATCCCCCTTCAACGCC | 372 | |
Rspo3-R1 | ATTCTTCCCTGTCGCCGT | ||
Rspo3-F2 | ATTGCGACTGGTTTCTTGGTT | 415 | |
Rspo3-R2 | CATCGTGTGATTGTTGGGTTC | ||
Rspo3-F3 | TTTTTGTTCTGGAGAGGATTGG | 408 | |
Rspo3-R3 | TTCTGTTTTCGCTGGTAGCTG | ||
Rspo3-F4 | CAAGAGTCAGAGAAATCCTACAGCA | 333 | |
Rspo3-R4 | GCAGTGTCCATTTGTGGTTTGA | ||
Rspo2-qF | ATGGAATGTGTGGAAGGCTG | 164 | qPCR |
Rspo2-qR | GACTCTGCAATGGTTGGGCA | ||
Rspo3-qF | CCTACAGCATCCTTCAGCACA | 213 | |
Rspo3-qR | GTCTTCGGGATTCTCGGTCT | ||
Gapdh-qF | AGAACATCATTCCAGCATCCA | 179 | Internal control |
Gapdh-qR | CTTCATCACCTTCTTAATGTCGTC |
RSPO2 | RSPO3 | |||
---|---|---|---|---|
Species | Accession Number | Identity (%) | Accession Number | Identity (%) |
M. reevesii | XP_039377720.1 | 97.70 | XP_039384546.1 | 97.09 |
C. picta bellii | XP_042699928.1 | 95.14 | XP_005280270.1 | 96.73 |
G. gallus | XP_046766683.1 | 90.23 | AGG55029.1 | 84.73 |
Equus caballus | ABV31707.1 | 86.21 | ABV31708.1 | 79.64 |
Mus musculus | NP_001344885.1 | 86.21 | NP_082627.3 | 73.48 |
Loxodonta africana | XP_003408481.1 | 85.63 | XP_023414693.1 | 78.79 |
Sus scrofa | NP_001280070.1 | 85.63 | NP_001302585.1 | 78.55 |
Homo sapiens | AAH36554.1 | 71.10 | NP_116173.2 | 76.84 |
Danio rerio | NP_001268919.1 | 67.82 | NP_001017358.1 | 51.09 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, J.; Zhou, T.; Chen, G.; Zou, G.; Liang, H. Effect of Exogenous Hormone on R-Spondin 2 (Rspo2) and R-Spondin 3 (Rspo3) Gene Expression and Embryo Development in Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Genes 2023, 14, 1466. https://doi.org/10.3390/genes14071466
Cao J, Zhou T, Chen G, Zou G, Liang H. Effect of Exogenous Hormone on R-Spondin 2 (Rspo2) and R-Spondin 3 (Rspo3) Gene Expression and Embryo Development in Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Genes. 2023; 14(7):1466. https://doi.org/10.3390/genes14071466
Chicago/Turabian StyleCao, Jizeng, Tong Zhou, Guobin Chen, Guiwei Zou, and Hongwei Liang. 2023. "Effect of Exogenous Hormone on R-Spondin 2 (Rspo2) and R-Spondin 3 (Rspo3) Gene Expression and Embryo Development in Chinese Soft-Shelled Turtle (Pelodiscus sinensis)" Genes 14, no. 7: 1466. https://doi.org/10.3390/genes14071466