Glutathione Peroxidase gpx1 to gpx8 Genes Expression in Experimental Brain Tumors Reveals Gender-Dependent Patterns
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Treatments
2.2. Magnetic Resonance Imaging (MRI)
2.3. Tissue Collection
2.4. RT-PCR
3. Results
4. Discussion
5. Limitations and Future Directions
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Louis, D.N.; Perry, A.; Wesseling, P.; Brat, D.J.; Cree, I.A.; Figarella-Branger, D.; Hawkins, C.; Ng, H.K.; Pfister, S.M.; Reifenberger, G.; et al. The 2021 WHO Classification of Tumors of the Central Nervous System: A summary. Neuro-oncology 2021, 23, 1231–1251. [Google Scholar] [CrossRef] [PubMed]
- Guo, B.; Liao, W.; Wang, S. The clinical significance of glutathione peroxidase 2 in glioblastoma multiforme. Transl. Neurosci. 2021, 12, 32–39. [Google Scholar] [CrossRef] [PubMed]
- Arevalo, A.S.T.; Erices, J.I.; Uribe, D.A.; Howden, J.; Niechi, I.; Munoz, S.; Martin, R.S.; Monras, C.A.Q. Current Therapeutic Alternatives and New Perspectives in Glioblastoma Multiforme. Curr. Med. Chem. 2017, 24, 2781–2795. [Google Scholar] [CrossRef] [PubMed]
- Stoyanov, G.S.; Dzhenkov, D.; Ghenev, P.; Iliev, B.; Enchev, Y.; Tonchev, A.B. Cell biology of glioblastoma multiforme: From basic science to diagnosis and treatment. Med. Oncol. 2018, 35, 27. [Google Scholar] [CrossRef]
- Xia, Y.; Yang, C.; Hu, N.; Yang, Z.; He, X.; Li, T.; Zhang, L. Exploring the key genes and signaling transduction pathways related to the survival time of glioblastoma multiforme patients by a novel survival analysis model. BMC Genom. 2017, 18, 950. [Google Scholar] [CrossRef]
- Yerukala Sathipati, S.; Huang, H.L.; Ho, S.Y. Estimating survival time of patients with glioblastoma multiforme and characterization of the identified microRNA signatures. BMC Genom. 2016, 17, 1022. [Google Scholar] [CrossRef]
- Kan, L.K.; Drummond, K.; Hunn, M.; Williams, D.; O’Brien, T.J.; Monif, M. Potential biomarkers and challenges in glioma diagnosis, therapy and prognosis. BMJ Neurol. Open 2020, 2, e000069. [Google Scholar] [CrossRef]
- Prasad, S.; Gupta, S.C.; Pandey, M.K.; Tyagi, A.K.; Deb, L. Oxidative Stress and Cancer: Advances and Challenges. Oxid. Med. Cell Longev. 2016, 2016, 5010423. [Google Scholar] [CrossRef]
- Ramirez-Exposito, M.J.; Martinez-Martos, J.M. The Delicate Equilibrium between Oxidants and Antioxidants in Brain Glioma. Curr. Neuropharmacol. 2019, 17, 342–351. [Google Scholar] [CrossRef]
- Bansal, A.; Simon, M.C. Glutathione metabolism in cancer progression and treatment resistance. J. Cell Biol. 2018, 217, 2291–2298. [Google Scholar] [CrossRef]
- Sajadimajd, S.; Khazaei, M. Oxidative Stress and Cancer: The Role of Nrf2. Curr. Cancer Drug Targets 2018, 18, 538–557. [Google Scholar] [CrossRef]
- Kaplowitz, N.; Aw, T.Y.; Ookhtens, M. The regulation of hepatic glutathione. Annu. Rev. Pharmacol. Toxicol. 1985, 25, 715–744. [Google Scholar] [CrossRef] [PubMed]
- Pei, J.; Pan, X.; Wei, G.; Hua, Y. Research progress of glutathione peroxidase family (GPX) in redoxidation. Front. Pharmacol. 2023, 14, 1147414. [Google Scholar] [CrossRef] [PubMed]
- Ramirez-Exposito, M.J.; Mayas, M.D.; Carrera-Gonzalez, M.P.; Martinez-Martos, J.M. Gender Differences in the Antioxidant Response to Oxidative Stress in Experimental Brain Tumors. Curr. Cancer Drug Targets 2019, 19, 641–654. [Google Scholar] [CrossRef] [PubMed]
- Ramirez-Exposito, M.J.; Carrera-Gonzalez, M.P.; Martinez-Martos, J.M. Sex differences exist in brain renin-angiotensin system-regulating aminopeptidase activities in transplacental ethyl-nitrosourea-induced gliomas. Brain Res. Bull. 2021, 168, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Paxinos, G.; Watson, C. Paxino’s and Watson’s The Rat Brain in Stereotaxic Coordinates, 7th ed.; Elsevier, Academic Press: Amsterdam, The Netherlands; Boston, MA, USA, 2014; p. 1. [Google Scholar]
- Liu, C.; Yan, Q.; Gao, C.; Lin, L.; Wei, J. Study on antioxidant effect of recombinant glutathione peroxidase 1. Int. J. Biol. Macromol. 2021, 170, 503–513. [Google Scholar] [CrossRef]
- Kim, J.E.; Lee, D.S.; Kim, T.H.; Kang, T.C. Glutathione Regulates GPx1 Expression during CA1 Neuronal Death and Clasmatodendrosis in the Rat Hippocampus following Status Epilepticus. Antioxidants 2022, 11, 756. [Google Scholar] [CrossRef]
- Wang, X.; Han, Y.; Chen, F.; Wang, M.; Xiao, Y.; Wang, H.; Xu, L.; Liu, W. Glutathione Peroxidase 1 Protects Against Peroxynitrite-Induced Spiral Ganglion Neuron Damage Through Attenuating NF-kappaB Pathway Activation. Front. Cell Neurosci. 2022, 16, 841731. [Google Scholar] [CrossRef]
- Tsuru-Aoyagi, K.; Potts, M.B.; Trivedi, A.; Pfankuch, T.; Raber, J.; Wendland, M.; Claus, C.P.; Koh, S.E.; Ferriero, D.; Noble-Haeusslein, L.J. Glutathione peroxidase activity modulates recovery in the injured immature brain. Ann. Neurol. 2009, 65, 540–549. [Google Scholar] [CrossRef]
- Chen, X.; Fu, G.; Li, L.; Zhao, Q.; Ke, Z.; Zhang, R. Selenoprotein GPX1 is a prognostic and chemotherapy-related biomarker for brain lower grade glioma. J. Trace Elem. Med. Biol. 2022, 74, 127082. [Google Scholar] [CrossRef]
- Dokic, I.; Hartmann, C.; Herold-Mende, C.; Regnier-Vigouroux, A. Glutathione peroxidase 1 activity dictates the sensitivity of glioblastoma cells to oxidative stress. Glia 2012, 60, 1785–1800. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Shen, Y.; Wei, J.; Liu, F. MicroRNA-153/Nrf-2/GPx1 pathway regulates radiosensitivity and stemness of glioma stem cells via reactive oxygen species. Oncotarget 2015, 6, 22006–22027. [Google Scholar] [CrossRef]
- Crack, P.J.; Cimdins, K.; Ali, U.; Hertzog, P.J.; Iannello, R.C. Lack of glutathione peroxidase-1 exacerbates Abeta-mediated neurotoxicity in cortical neurons. J. Neural. Transm. 2006, 113, 645–657. [Google Scholar] [CrossRef] [PubMed]
- Crack, P.J.; Taylor, J.M.; Flentjar, N.J.; de Haan, J.; Hertzog, P.; Iannello, R.C.; Kola, I. Increased infarct size and exacerbated apoptosis in the glutathione peroxidase-1 (Gpx-1) knockout mouse brain in response to ischemia/reperfusion injury. J. Neurochem. 2001, 78, 1389–1399. [Google Scholar] [CrossRef]
- Li, F.; Dai, L.; Niu, J. GPX2 silencing relieves epithelial-mesenchymal transition, invasion, and metastasis in pancreatic cancer by downregulating Wnt pathway. J. Cell Physiol. 2020, 235, 7780–7790. [Google Scholar] [CrossRef]
- Yu, F.; Yu, C.; Li, F.; Zuo, Y.; Wang, Y.; Yao, L.; Wu, C.; Wang, C.; Ye, L. Wnt/β-catenin signaling in cancers and targeted therapies. Signal Transduct. Target. Ther. 2021, 6, 307. [Google Scholar] [CrossRef]
- Kipp, A.P.; Muller, M.F.; Goken, E.M.; Deubel, S.; Brigelius-Flohe, R. The selenoproteins GPx2, TrxR2 and TrxR3 are regulated by Wnt signalling in the intestinal epithelium. Biochim. Biophys. Acta 2012, 1820, 1588–1596. [Google Scholar] [CrossRef] [PubMed]
- Nirgude, S.; Choudhary, B. Insights into the role of GPX3, a highly efficient plasma antioxidant, in cancer. Biochem. Pharmacol. 2021, 184, 114365. [Google Scholar] [CrossRef]
- Yi, Z.; Jiang, L.; Zhao, L.; Zhou, M.; Ni, Y.; Yang, Y.; Yang, H.; Yang, L.; Zhang, Q.; Kuang, Y.; et al. Glutathione peroxidase 3 (GPX3) suppresses the growth of melanoma cells through reactive oxygen species (ROS)-dependent stabilization of hypoxia-inducible factor 1-α and 2-α. J. Cell Biochem. 2019, 120, 19124–19136. [Google Scholar] [CrossRef]
- Barrett, C.W.; Ning, W.; Chen, X.; Smith, J.J.; Washington, M.K.; Hill, K.E.; Coburn, L.A.; Peek, R.M.; Chaturvedi, R.; Wilson, K.T.; et al. Tumor suppressor function of the plasma glutathione peroxidase gpx3 in colitis-associated carcinoma. Cancer Res. 2013, 73, 1245–1255. [Google Scholar] [CrossRef]
- Lundholm, L.; Putnik, M.; Otsuki, M.; Andersson, S.; Ohlsson, C.; Gustafsson, J.A.; Dahlman-Wright, K. Effects of estrogen on gene expression profiles in mouse hypothalamus and white adipose tissue: Target genes include glutathione peroxidase 3 and cell death-inducing DNA fragmentation factor, α-subunit-like effector A. J. Endocrinol. 2008, 196, 547–557. [Google Scholar] [CrossRef]
- Seiler, A.; Schneider, M.; Forster, H.; Roth, S.; Wirth, E.K.; Culmsee, C.; Plesnila, N.; Kremmer, E.; Radmark, O.; Wurst, W.; et al. Glutathione peroxidase 4 senses and translates oxidative stress into 12/15-lipoxygenase dependent- and AIF-mediated cell death. Cell Metab. 2008, 8, 237–248. [Google Scholar] [CrossRef] [PubMed]
- Zhan, S.; Lu, L.; Pan, S.S.; Wei, X.Q.; Miao, R.R.; Liu, X.H.; Xue, M.; Lin, X.K.; Xu, H.L. Targeting NQO1/GPX4-mediated ferroptosis by plumbagin suppresses in vitro and in vivo glioma growth. Br. J. Cancer 2022, 127, 364–376. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Wu, Y.; Yuan, S.; Zhang, P.; Zhang, J.; Li, H.; Li, X.; Shen, H.; Wang, Z.; Chen, G. Glutathione peroxidase 4 participates in secondary brain injury through mediating ferroptosis in a rat model of intracerebral hemorrhage. Brain Res. 2018, 1701, 112–125. [Google Scholar] [CrossRef] [PubMed]
- Sakai, O.; Uchida, T.; Roggia, M.F.; Imai, H.; Ueta, T.; Amano, S. Role of Glutathione Peroxidase 4 in Glutamate-Induced Oxytosis in the Retina. PLoS ONE 2015, 10, e0130467. [Google Scholar] [CrossRef]
- Cole-Ezea, P.; Swan, D.; Shanley, D.; Hesketh, J. Glutathione peroxidase 4 has a major role in protecting mitochondria from oxidative damage and maintaining oxidative phosphorylation complexes in gut epithelial cells. Free Radic. Biol. Med. 2012, 53, 488–497. [Google Scholar] [CrossRef]
- Bellinger, F.P.; Bellinger, M.T.; Seale, L.A.; Takemoto, A.S.; Raman, A.V.; Miki, T.; Manning-Bog, A.B.; Berry, M.J.; White, L.R.; Ross, G.W. Glutathione Peroxidase 4 is associated with Neuromelanin in Substantia Nigra and Dystrophic Axons in Putamen of Parkinson’s brain. Mol. Neurodegener. 2011, 6, 8. [Google Scholar] [CrossRef]
- Conrad, M.; Angeli, J.P.; Vandenabeele, P.; Stockwell, B.R. Regulated necrosis: Disease relevance and therapeutic opportunities. Nat. Rev. Drug Discov. 2016, 15, 348–366. [Google Scholar] [CrossRef]
- Forcina, G.C.; Dixon, S.J. GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis. Proteomics 2019, 19, e1800311. [Google Scholar] [CrossRef]
- Ursini, F.; Maiorino, M. Lipid peroxidation and ferroptosis: The role of GSH and GPx4. Free Radic. Biol. Med. 2020, 152, 175–185. [Google Scholar] [CrossRef]
- Cardoso, B.R.; Hare, D.J.; Bush, A.I.; Roberts, B.R. Glutathione peroxidase 4: A new player in neurodegeneration? Mol. Psychiatry 2017, 22, 328–335. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Li, T.; Zhou, N.; He, Y.; Zhong, J.; Ma, C.; Zeng, M.; Ji, J.; Huang, J.D.; Ke, Y.; et al. Engineered Salmonella inhibits GPX4 expression and induces ferroptosis to suppress glioma growth in vitro and in vivo. J. Neurooncol. 2023, 163, 607–622. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.S.; SriRamaratnam, R.; Welsch, M.E.; Shimada, K.; Skouta, R.; Viswanathan, V.S.; Cheah, J.H.; Clemons, P.A.; Shamji, A.F.; Clish, C.B.; et al. Regulation of ferroptotic cancer cell death by GPX4. Cell 2014, 156, 317–331. [Google Scholar] [CrossRef] [PubMed]
- Dolma, S.; Lessnick, S.L.; Hahn, W.C.; Stockwell, B.R. Identification of genotype-selective antitumor agents using synthetic lethal chemical screening in engineered human tumor cells. Cancer Cell 2003, 3, 285–296. [Google Scholar] [CrossRef]
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef]
- Taylor, A.; Robson, A.; Houghton, B.C.; Jepson, C.A.; Ford, W.C.; Frayne, J. Epididymal specific, selenium-independent GPX5 protects cells from oxidative stress-induced lipid peroxidation and DNA mutation. Hum. Reprod. 2013, 28, 2332–2342. [Google Scholar] [CrossRef]
- Tan, S.; Liu, Q.; Yang, J.; Cai, J.; Yu, M.; Ji, Y. Macranthoidin B (MB) Promotes Oxidative Stress-Induced Inhibiting of Hepa1-6 Cell Proliferation via Selenoprotein. Biol. Trace Elem. Res. 2023, 201, 368–376. [Google Scholar] [CrossRef]
- Usategui-Martin, R.; Puertas-Neyra, K.; Galindo-Cabello, N.; Hernandez-Rodriguez, L.A.; Gonzalez-Perez, F.; Rodriguez-Cabello, J.C.; Gonzalez-Sarmiento, R.; Pastor, J.C.; Fernandez-Bueno, I. Retinal Neuroprotective Effect of Mesenchymal Stem Cells Secretome Through Modulation of Oxidative Stress, Autophagy, and Programmed Cell Death. Investig. Ophthalmol. Vis. Sci. 2022, 63, 27. [Google Scholar] [CrossRef]
- Wi, S.; Lee, J.W.; Kim, M.; Park, C.H.; Cho, S.R. An Enriched Environment Ameliorates Oxidative Stress and Olfactory Dysfunction in Parkinson’s Disease with α-Synucleinopathy. Cell Transplant. 2018, 27, 831–839. [Google Scholar] [CrossRef]
- Shema, R.; Kulicke, R.; Cowley, G.S.; Stein, R.; Root, D.E.; Heiman, M. Synthetic lethal screening in the mammalian central nervous system identifies Gpx6 as a modulator of Huntington’s disease. Proc. Natl. Acad. Sci. USA 2015, 112, 268–272. [Google Scholar] [CrossRef]
- Ferreira, W.A.S.; Vitiello, G.A.F.; da Silva Medina, T.; de Oliveira, E.H.C. Comprehensive analysis of epigenetics regulation, prognostic and the correlation with immune infiltrates of GPX7 in adult gliomas. Sci. Rep. 2022, 12, 6442. [Google Scholar] [CrossRef] [PubMed]
- Yao, J.; Chen, X.; Liu, Z.; Zhang, R.; Zhang, C.; Yang, Q.; Yao, P.; Jiang, Q.; Wu, J.; Zhao, S. The increasing expression of GPX7 related to the malignant clinical features leading to poor prognosis of glioma patients. Chin. Neurosurg. J. 2021, 7, 21. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Zhang, L.; Wang, Y.; Sun, Y.; Wang, T.; Cao, J.; Qi, M.; Du, X.; Xia, Z.; Zhang, R.; et al. A Bioinformatic Analysis: The Overexpression and Prognostic Potential of GPX7 in Lower-Grade Glioma. Int. J. Gen. Med. 2022, 15, 4321–4337. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Wu, H.; Wang, F.; Xu, L.; Yan, Y.; Tong, X.; Yan, H. GPX7 Is Targeted by miR-29b and GPX7 Knockdown Enhances Ferroptosis Induced by Erastin in Glioma. Front. Oncol. 2021, 11, 802124. [Google Scholar] [CrossRef]
- Kanemura, S.; Matsusaki, M.; Inaba, K.; Okumura, M. PDI Family Members as Guides for Client Folding and Assembly. Int. J. Mol. Sci. 2020, 21, 9351. [Google Scholar] [CrossRef]
- Buday, K.; Conrad, M. Emerging roles for non-selenium containing ER-resident glutathione peroxidases in cell signaling and disease. Biol. Chem. 2021, 402, 271–287. [Google Scholar] [CrossRef]
- Wang, L.; Zhang, L.; Niu, Y.; Sitia, R.; Wang, C.C. Glutathione peroxidase 7 utilizes hydrogen peroxide generated by Ero1alpha to promote oxidative protein folding. Antioxid. Redox Signal 2014, 20, 545–556. [Google Scholar] [CrossRef]
- Wei, P.C.; Hsieh, Y.H.; Su, M.I.; Jiang, X.; Hsu, P.H.; Lo, W.T.; Weng, J.Y.; Jeng, Y.M.; Wang, J.M.; Chen, P.L.; et al. Loss of the oxidative stress sensor NPGPx compromises GRP78 chaperone activity and induces systemic disease. Mol. Cell 2012, 48, 747–759. [Google Scholar] [CrossRef]
- Wei, P.C.; Lo, W.T.; Su, M.I.; Shew, J.Y.; Lee, W.H. Non-targeting siRNA induces NPGPx expression to cooperate with exoribonuclease XRN2 for releasing the stress. Nucleic Acids Res. 2012, 40, 323–332. [Google Scholar] [CrossRef]
- Chen, Y.I.; Wei, P.C.; Hsu, J.L.; Su, F.Y.; Lee, W.H. NPGPx (GPx7): A novel oxidative stress sensor/transmitter with multiple roles in redox homeostasis. Am. J. Transl. Res. 2016, 8, 1626–1640. [Google Scholar]
- Chang, Y.C.; Yu, Y.H.; Shew, J.Y.; Lee, W.J.; Hwang, J.J.; Chen, Y.H.; Chen, Y.R.; Wei, P.C.; Chuang, L.M.; Lee, W.H. Deficiency of NPGPx, an oxidative stress sensor, leads to obesity in mice and human. EMBO Mol. Med. 2013, 5, 1165–1179. [Google Scholar] [CrossRef] [PubMed]
- Muthukumar, K.; Nachiappan, V. Cadmium-induced oxidative stress in Saccharomyces cerevisiae. Indian. J. Biochem. Biophys. 2010, 47, 383–387. [Google Scholar] [PubMed]
- Nguyen, V.D.; Saaranen, M.J.; Karala, A.R.; Lappi, A.K.; Wang, L.; Raykhel, I.B.; Alanen, H.I.; Salo, K.E.; Wang, C.C.; Ruddock, L.W. Two endoplasmic reticulum PDI peroxidases increase the efficiency of the use of peroxide during disulfide bond formation. J. Mol. Biol. 2011, 406, 503–515. [Google Scholar] [CrossRef]
- Bannister, C.A.; Holden, S.E.; Jenkins-Jones, S.; Morgan, C.L.; Halcox, J.P.; Schernthaner, G.; Mukherjee, J.; Currie, C.J. Can people with type 2 diabetes live longer than those without? A comparison of mortality in people initiated with metformin or sulphonylurea monotherapy and matched, non-diabetic controls. Diabetes Obes. Metab. 2014, 16, 1165–1173. [Google Scholar] [CrossRef] [PubMed]
- Fang, J.; Yang, J.; Wu, X.; Zhang, G.; Li, T.; Wang, X.; Zhang, H.; Wang, C.C.; Liu, G.H.; Wang, L. Metformin alleviates human cellular aging by upregulating the endoplasmic reticulum glutathione peroxidase 7. Aging Cell 2018, 17, e12765. [Google Scholar] [CrossRef] [PubMed]
- Groves, J.A.; Lee, A.; Yildirir, G.; Zachara, N.E. Dynamic O-GlcNAcylation and its roles in the cellular stress response and homeostasis. Cell Stress. Chaperones 2013, 18, 535–558. [Google Scholar] [CrossRef]
- Hart, G.W.; Slawson, C.; Ramirez-Correa, G.; Lagerlof, O. Cross talk between O-GlcNAcylation and phosphorylation: Roles in signaling, transcription, and chronic disease. Annu. Rev. Biochem. 2011, 80, 825–858. [Google Scholar] [CrossRef]
- Hsieh, Y.L.; Su, F.Y.; Tsai, L.K.; Huang, C.C.; Ko, Y.L.; Su, L.W.; Chen, K.Y.; Shih, H.M.; Hu, C.M.; Lee, W.H. NPGPx-Mediated Adaptation to Oxidative Stress Protects Motor Neurons from Degeneration in Aging by Directly Modulating O-GlcNAcase. Cell Rep. 2019, 29, 2134–2143. [Google Scholar] [CrossRef]
- Shahid, M.; Idrees, M.; Butt, A.M.; Raza, S.M.; Amin, I.; Rasul, A.; Afzal, S. Blood-based gene expression profile of oxidative stress and antioxidant genes for identifying surrogate markers of liver tissue injury in chronic hepatitis C patients. Arch. Virol. 2020, 165, 809–822. [Google Scholar] [CrossRef]
- Peng, D.; Hu, T.; Soutto, M.; Belkhiri, A.; Zaika, A.; El-Rifai, W. Glutathione peroxidase 7 has potential tumour suppressor functions that are silenced by location-specific methylation in oesophageal adenocarcinoma. Gut 2014, 63, 540–551. [Google Scholar] [CrossRef]
- Chen, Z.; Hu, T.; Zhu, S.; Mukaisho, K.; El-Rifai, W.; Peng, D.F. Glutathione peroxidase 7 suppresses cancer cell growth and is hypermethylated in gastric cancer. Oncotarget 2017, 8, 54345–54356. [Google Scholar] [CrossRef] [PubMed]
- Guerriero, E.; Capone, F.; Accardo, M.; Sorice, A.; Costantini, M.; Colonna, G.; Castello, G.; Costantini, S. GPX4 and GPX7 over-expression in human hepatocellular carcinoma tissues. Eur. J. Histochem. 2015, 59, 2540. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Xie, Q.; Liu, X.; Wan, C.; Wu, W.; Fang, K.; Yao, Y.; Cheng, P.; Deng, D.; Liu, Z. Identification the prognostic value of glutathione peroxidases expression levels in acute myeloid leukemia. Ann. Transl. Med. 2020, 8, 678. [Google Scholar] [CrossRef] [PubMed]
- Rusolo, F.; Capone, F.; Pasquale, R.; Angiolillo, A.; Colonna, G.; Castello, G.; Costantini, M.; Costantini, S. Comparison of the seleno-transcriptome expression between human non-cancerous mammary epithelial cells and two human breast cancer cell lines. Oncol. Lett. 2017, 13, 2411–2417. [Google Scholar] [CrossRef]
- Raykhel, I.; Alanen, H.; Salo, K.; Jurvansuu, J.; Nguyen, V.D.; Latva-Ranta, M.; Ruddock, L. A molecular specificity code for the three mammalian KDEL receptors. J. Cell Biol. 2007, 179, 1193–1204. [Google Scholar] [CrossRef]
- Yoboue, E.D.; Rimessi, A.; Anelli, T.; Pinton, P.; Sitia, R. Regulation of Calcium Fluxes by GPX8, a Type-II Transmembrane Peroxidase Enriched at the Mitochondria-Associated Endoplasmic Reticulum Membrane. Antioxid. Redox Signal 2017, 27, 583–595. [Google Scholar] [CrossRef]
- Yang, Z.S.; Yang, Q.; Sun, X.X.; Xiong, K.; Zhu, X.T.; Wang, Y.C.; Ren, Q.Y.; Wu, G.H.; Wang, S.M.; Cao, X.Q.; et al. GPX8 as a Novel Prognostic Factor and Potential Therapeutic Target in Primary Glioma. J. Immunol. Res. 2022, 2022, 8025055. [Google Scholar] [CrossRef]
- Chen, H.; Xu, L.; Shan, Z.L.; Chen, S.; Hu, H. GPX8 is transcriptionally regulated by FOXC1 and promotes the growth of gastric cancer cells through activating the Wnt signaling pathway. Cancer Cell Int. 2020, 20, 596. [Google Scholar] [CrossRef]
- Khatib, A.; Solaimuthu, B.; Ben Yosef, M.; Abu Rmaileh, A.; Tanna, M.; Oren, G.; Schlesinger Frisch, M.; Axelrod, J.H.; Lichtenstein, M.; Shaul, Y.D. The glutathione peroxidase 8 (GPX8)/IL-6/STAT3 axis is essential in maintaining an aggressive breast cancer phenotype. Proc. Natl. Acad. Sci. USA 2020, 117, 21420–21431. [Google Scholar] [CrossRef]
- Lu, C.H.; Wei, S.T.; Liu, J.J.; Chang, Y.J.; Lin, Y.F.; Yu, C.S.; Chang, S.L. Recognition of a Novel Gene Signature for Human Glioblastoma. Int. J. Mol. Sci. 2022, 23, 4157. [Google Scholar] [CrossRef]
- Ren, Z.; He, Y.; Yang, Q.; Guo, J.; Huang, H.; Li, B.; Wang, D.; Yang, Z.; Tian, X. A Comprehensive Analysis of the Glutathione Peroxidase 8 (GPX8) in Human Cancer. Front. Oncol. 2022, 12, 812811. [Google Scholar] [CrossRef] [PubMed]
Wistar Rat Gene | Forward Primer 5′→3′ | Reverse Primer 5′→3′ |
---|---|---|
gpx1 | AGTTCGGACATCAGGAGAATGGCA | TCACCATTCACCTCGCACTTCTCA |
gpx2 | GACACGAGGAAACCGAAGCA | GGCCCTTCACAACGTCT |
gpx3 | CAGAACTCCTGGGCTCACCT | TCCATCTTGACGTTGCTGAC |
gpx4 | CCGGCTACAATGTCAGGTTT | ACGCAGCCGTTCTTATCAAT |
gpx5 | CTTGGATCCGAATTCATGACCCCCAGGCT | CTGCAGGATCCTAAGCTTATATGGTTTTGA |
gpx6 | CAGAAGTTGTGGGGTTCCTGT | TGCCAGTCACCCCTTTGTTG |
gpx7 | CCTGCCTTCAAATACCTAACCC | TGTAATACGGGGCTTGATCTCC |
gpx8 | CTACGGAGTAACTTTCCCCATCTTCCACAAG | CTGCTATGTCAGGCCTGATGACTTCAATGG |
ß-Actin | CTCTCTTCCAGCCTTCCTTC | GGTCTTTACGGATGTCAACG |
GAPDH | GCACCGTCAAGGCTGAGAAC | ATGGTGGTGAAGACGCCAGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cueto-Ureña, C.; Ramírez-Expósito, M.J.; Mayas, M.D.; Carrera-González, M.P.; Godoy-Hurtado, A.; Martínez-Martos, J.M. Glutathione Peroxidase gpx1 to gpx8 Genes Expression in Experimental Brain Tumors Reveals Gender-Dependent Patterns. Genes 2023, 14, 1674. https://doi.org/10.3390/genes14091674
Cueto-Ureña C, Ramírez-Expósito MJ, Mayas MD, Carrera-González MP, Godoy-Hurtado A, Martínez-Martos JM. Glutathione Peroxidase gpx1 to gpx8 Genes Expression in Experimental Brain Tumors Reveals Gender-Dependent Patterns. Genes. 2023; 14(9):1674. https://doi.org/10.3390/genes14091674
Chicago/Turabian StyleCueto-Ureña, Cristina, María Jesús Ramírez-Expósito, María Dolores Mayas, María Pilar Carrera-González, Alicia Godoy-Hurtado, and José Manuel Martínez-Martos. 2023. "Glutathione Peroxidase gpx1 to gpx8 Genes Expression in Experimental Brain Tumors Reveals Gender-Dependent Patterns" Genes 14, no. 9: 1674. https://doi.org/10.3390/genes14091674