Muscle Fiber Characteristics and Transcriptome Analysis in Slow- and Fast-Growing Megalobrama amblycephala
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Experimental Animals
2.3. Date Measurement and Tissue Sampling
2.4. Muscle Histological Studies
2.5. RNA Extraction, Library Construction, and Sequencing
2.6. Quality Control and Comparative Analysis
2.7. Analysis of DEGs
2.8. Real-Time PCR Confirmation of Illumina Sequencing Data
2.9. Statistical Analysis
3. Results
3.1. Growth Performance of FG and SG M. amblycephala
3.2. Muscle Histological Analysis
3.3. Analysis of DEGs between FG and SG at Different Growth Stages
3.4. Enrichment Analysis of GO and KEGG Pathways Based on DEGs at 4 mo
3.5. Enrichment Analysis of GO and KEGG Pathways Based on DEGs at 10 mo
3.6. Synergistic Regulation of Gene Categories Related to Muscle Growth in M. amblycephala at Different Growth Stages
3.7. Comparative Analysis of DEGs in 4 mo and 10 mo M. amblycephala
3.8. Verification of RNA-Seq Data by qPCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Prieto, D.; Markaide, P.; Urrutxurtu, I.; Navarro, E.; Artigaud, S.; Fleury, E.; Urrutia, M.B. Gill transcriptomic analysis in fast and slow-growing individuals of Mytilus galloprovincialis. Aquaculture 2019, 511, 734242. [Google Scholar] [CrossRef]
- Chu, W.Y.; Liu, L.S.; Li, Y.L.; Chen, L.; Wang, K.Z.; Li, H.H.; Du, S.J.; Zhang, J.S. Systematic identification and differential expression profiling of MicroRNAs from white and red muscles of Siniperca chuatsi. Curr. Mol. Med. 2013, 13, 1397–1407. [Google Scholar] [CrossRef]
- Cheng, J.H.; Sun, D.W.; Han, Z.; Zeng, X.A. Texture and structure measurements and analyses for evaluation of fish and fillet freshness quality: A Review. Compr. Rev. Food Sci. Food Saf. 2014, 13, 52–61. [Google Scholar] [CrossRef]
- Li, Z.; Du, X.; Wen, L.; Li, Y.; Qin, J.; Chen, Z.; Huang, Y.; Wu, X.; Luo, H.; Lin, Y.; et al. Transcriptome analysis reveals the involvement of ubiquitin-proteasome pathway in the regulation of muscle growth of rice flower carp. Comp. Biochem. Physiol. Part D Genom. Proteom. 2022, 41, 100948. [Google Scholar] [CrossRef]
- Dekkers, J.; Hospital, F. The use of molecular genetics in the improvement of agricultural populations. Nat. Rev. Genet. 2002, 3, 22–32. [Google Scholar] [CrossRef] [PubMed]
- Weatherley, A.H.; Gill, H.S. Dynamics of increase in muscle fibers in fishes in relation to size and growth. Experientia 1985, 41, 353–354. [Google Scholar] [CrossRef]
- Valente, L.M.P.; Moutou, K.A.; Conceição, L.E.C.; Engrola, S.; Fernandes, J.M.O.; Johnston, I.A. What determines growth potential and juvenile quality of farmed fish species? Rev. Aquac. 2013, 5, 168–193. [Google Scholar] [CrossRef]
- Rowlerson, A.; Veggetti, A. Cellular mechanisms of post-embryonic muscle growth in aquaculture species. Fish Physiol. 2001, 18, 103–140. [Google Scholar]
- Sun, Y.; Huang, Y.; Hu, G.; Zhang, X.; Ruan, Z.; Zhao, X.; Guo, C.; Tang, Z.; Li, X.; You, X.; et al. Comparative transcriptomic study of muscle provides new insights into the growth superiority of a novel grouper hybrid. PLoS ONE 2016, 11, e0168802. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Chen, H.M.; Qian, X.Q.; Gui, J.F. Transcriptome analysis of grass carp (Ctenopharyngodon idella) between fast- and slow-growing fish. Comp. Biochem. Physiol. Part D Genom. Proteom. 2020, 35, 100688. [Google Scholar] [CrossRef]
- Li, S.; Liu, H.; Bai, J.; Zhu, X. Transcriptome assembly and identification of genes and SNPs associated with growth traits in largemouth bass (Micropterus salmoides). Genetica 2017, 145, 175–187. [Google Scholar] [CrossRef]
- Robledo, D.; Rubiolo, J.A.; Cabaleiro, S.; Martínez, P.; Bouza, C. Differential gene expression and SNP association between fast- and slow-growing turbot (Scophthalmus maximus). Sci. Rep. 2017, 7, 12105. [Google Scholar] [CrossRef] [PubMed]
- Xie, X.; Liao, X.; Xu, Z.; Liang, W.; Su, Y.; Lin, L.; Xie, J.; Lin, W. Transcriptome analysis of the muscle of fast- and slow-growing phoenix barb (Spinibarbus denticulatus denticulatus). J. Fish Biol. 2023, 102, 504–515. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Shen, Y.; Xu, X.; Dai, Y.; Li, J. Transcriptome analysis of the liver and muscle tissues of black carp (Mylopharyngodon piceus) of different growth rates. Mar. Biol. 2020, 22, 706–716. [Google Scholar] [CrossRef] [PubMed]
- Kocmarek, A.L.; Ferguson, M.M.; Danzmann, R.G. Differential gene expression in small and large rainbow trout derived from two seasonal spawning groups. BMC Genom. 2014, 15, 57. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zheng, F.; Ouyang, A.; Yuan, G.; Su, J.; Liu, X. Blunt snout bream (Megalobrama amblycephala) MaCSF-1 contributes to proliferation, phagocytosis and immunoregulation of macrophages via MaCSF-1R. Fish Shellfish Immunol. 2022, 127, 1113–1126. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.F.; Chen, Y.L.; Diao, J.H.; Luo, L.F.; Gao, Z.X. Identification and characterization of novel circRNAs involved in muscle growth of blunt snout bream. Int. J. Mol. Sci. 2021, 22, 10056. [Google Scholar] [CrossRef] [PubMed]
- Trapnell, C.; Hendrickson, D.G.; Sauvageau, M.; Goff, L.; Rinn, J.L.; Pachter, L. Differential analysis of gene regulation at transcript resolution with RNA-seq. Nat. Biotechnol. 2013, 31, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Grunow, B.; Stange, K.; Bochert, R.; Tönißen, K. Histological and biochemical evaluation of skeletal muscle in the two salmonid species Coregonus maraena and Oncorhynchus mykiss. PLoS ONE 2021, 16, e0255062. [Google Scholar] [CrossRef]
- Cheng, Z.; Tseng, Y.; White, M.F. Insulin signaling meets mitochondria in metabolism. Trends Endocrinol. Metab. 2010, 21, 589–598. [Google Scholar] [CrossRef]
- Wu, P.; Dai, G.; Chen, F.; Chen, L.; Zhang, T.; Xie, K.; Wang, J.; Zhang, G. Transcriptome profile analysis of leg muscle tissues between slow- and fast-growing chickens. PLoS ONE 2018, 13, e0206131. [Google Scholar] [CrossRef]
- Meriane, M.; Charrasse, S.; Comunale, F.; Gauthier-Rouvière, C. Transforming growth factor beta activates Rac1 and Cdc42Hs GTPases and the JNK pathway in skeletal muscle cells. Biol. Cell. 2002, 94, 535–543. [Google Scholar] [CrossRef]
- Hu, Z.; Cao, J.; Ge, L.; Zhang, J.; Zhang, H.; Liu, X. Characterization and comparative transcriptomic analysis of skeletal muscle in pekin duck at different growth stages using RNA-Seq. Animals 2021, 11, 834. [Google Scholar] [CrossRef]
- Zhang, Z.; Du, H.; Yang, C.; Li, Q.; Qiu, M.; Song, X.; Yu, C.; Jiang, X.; Liu, L.; Hu, C.; et al. Comparative transcriptome analysis reveals regulators mediating breast muscle growth and development in three chicken breeds. Anim. Biotechnol. 2019, 30, 233–241. [Google Scholar] [CrossRef]
- Li, Y.; Chen, Y.; Jin, W.; Fu, S.; Li, D.; Zhang, Y.; Sun, G.; Jiang, R.; Han, R.; Li, Z.; et al. Analyses of microRNA and mRNA expression profiles reveal the crucial interaction networks and pathways for regulation of chicken breast muscle development. Front. Genet. 2019, 10, 197. [Google Scholar] [CrossRef]
- Tajbakhsh, S.; Borello, U.; Vivarelli, E.; Kelly, R.; Papkoff, J.; Duprez, D.; Buckingham, M.; Cossu, G. Differential activation of Myf5 and MyoD by different Wnts in explants of mouse paraxial mesoderm and the later activation of myogenesis in the absence of Myf5. Development 1998, 125, 4155–4162. [Google Scholar] [CrossRef]
- Otto, A.; Schmidt, C.; Patel, K. Pax3 and Pax7 expression and regulation in the avian embryo. Anat. Embryol. 2006, 211, 293–310. [Google Scholar] [CrossRef]
- Teixeira, J.D.; de Andrade Rosa, I.; Brito, J.; Maia de Souza, Y.R.; Paulo de Abreu Manso, P.; Machado, M.P.; Costa, M.L.; Mermelstein, C. Sonic Hedgehog signaling and Gli-1 during embryonic chick myogenesis. Biochem. Biophys. Res. Commun. 2018, 507, 496–502. [Google Scholar] [CrossRef]
- Zhu, K.C.; Yu, D.H.; Zhao, J.K.; Wang, W.M.; Wang, H.L. Morphological analysis and muscle-associated gene expression during different muscle growth phases of Megalobrama amblycephala. Genet. Mol. Res. 2015, 14, 11639–11651. [Google Scholar] [CrossRef]
- Adiguzel, E.; Hou, G.; Mulholland, D.; Hopfer, U.; Fukai, N.; Olsen, B.; Bendeck, M. Migration and growth are attenuated in vascular smooth muscle cells with type VIII collagen-null alleles. Arterioscler. Thromb. Vasc. Biol. 2006, 26, 56–61. [Google Scholar] [CrossRef]
- Lopes, J.; Adiguzel, E.; Gu, S.; Liu, S.L.; Hou, G.; Heximer, S.; Assoian, R.K.; Bendeck, M.P. Type VIII collagen mediates vessel wall remodeling after arterial injury and fibrous cap formation in atherosclerosis. Am. J. Pathol. 2013, 182, 2241–2253. [Google Scholar] [CrossRef]
- Song, K.Y.; Guo, X.M.; Wang, H.Q.; Zhang, L.; Huang, S.Y.; Huo, Y.C.; Zhang, G.; Feng, J.Z.; Zhang, R.R.; Ma, Y.; et al. MBNL1 reverses the proliferation defect of skeletal muscle satellite cells in myotonic dystrophy type 1 by inhibiting autophagy via the mTOR pathway. Cell Death Dis. 2020, 11, 545. [Google Scholar] [CrossRef]
- Chen, H.; Zhang, Z.W.; Guo, Y.; Wang, Y.; Liu, Y.; Luo, N.; Zhu, Y. The proliferative role of insulin and the mechanism underlying this action in human breast cancer cell line MCF-7. J. Buon. 2012, 17, 658–662. [Google Scholar]
- Ascenzi, F.; Barberi, L.; Dobrowolny, G.; Villa Nova Bacurau, A.; Nicoletti, C. Effects of IGF-1 isoforms on muscle growth and sarcopenia. Aging Cell 2019, 18, e12954. [Google Scholar] [CrossRef]
- Duran, B.O.S.; Zanella, B.T.T.; Perez, E.S.; Mareco, E.A.; Blasco, J.; Dal-Pai-Silva, M.; Garcia de la Serrana, D. Amino Acids and IGF1 Regulation of Fish Muscle Growth Revealed by Transcriptome and microRNAome Integrative Analyses of Pacu (Piaractus mesopotamicus) Myotubes. Int. J. Mol. Sci. 2022, 23, 1180. [Google Scholar] [CrossRef]
- Bersin, T.V.; Cordova, K.L.; Saenger, E.K.; Journey, M.L.; Beckman, B.R.; Lema, S.C. Nutritional status affects Igf1 regulation of skeletal muscle myogenesis, myostatin, and myofibrillar protein degradation pathways in gopher rockfish (Sebastes carnatus). Mol. Cell. Endocrinol. 2023, 573, 111951. [Google Scholar] [CrossRef]
- Triantaphyllopoulos, K.A.; Cartas, D.; Miliou, H. Factors influencing GH and IGF-I gene expression on growth in teleost fish: How can aquaculture industry benefit? Rev. Aquac. 2020, 12, 1637–1662. [Google Scholar] [CrossRef]
- Duan, C.; Ren, H.; Gao, S. Insulin-like growth factors (IGFs), IGF receptor, and IGF-binding proteins: Roles in skeletal muscle growth and differentiation. Gen. Comp. Endocrinol. 2010, 167, 344–351. [Google Scholar] [CrossRef]
- Hwa, V.; Oh, Y.; Rosenfeld, R. The insulin-like growth factor binding protein (IGFBP) superfamily. Endocr. Rev. 1999, 20, 761–787. [Google Scholar]
- Wang, X.; Lu, L.; Li, Y.; Li, M.; Chen, C.; Feng, Q.; Zhang, C.; Duan, C. Molecular and functional characterization of two distinct IGF binding protein-6 genes in zebrafish. Am. J. Physiol. Regul. 2009, 296, R1348–R1357. [Google Scholar] [CrossRef]
- Rescan, P.Y. Identification of a fibroblast growth factor 6 (FGF6) gene in a non-mammalian vertebrate: Continuous expression of FGF6 accompanies muscle fiber hyperplasia. Biochim. Biophys. Acta 1998, 1443, 305–314. [Google Scholar] [CrossRef]
- Xu, Y.; Tan, Q.; Hu, P.; Yao, J. Characterization and expression analysis of FGF6 (fibroblast growth factor 6) genes of grass carp (Ctenopharyngodon idellus) reveal their regulation on muscle growth. Fish Physiol. Biochem. 2019, 45, 1649–1662. [Google Scholar] [CrossRef]
- Cai, Q.C.; Wu, G.B.; Zhu, M.; Ge, H.A.; Xue, C.; Zhang, Q.; Cheng, B.; Xu, S.; Wu, P. FGF6 enhances muscle regeneration after nerve injury by relying on ERK1/2 mechanism. Life Sci. 2020, 248, 117465. [Google Scholar] [CrossRef]
- Pawlikowski, B.; Vogler, T.O.; Gadek, K.; Olwin, B.B. Regulation of skeletal muscle stem cells by fibroblast growth factors. Dev. Dyn. 2017, 246, 359–367. [Google Scholar] [CrossRef]
- Tixier, V.; Bataille, L.; Etard, C.; Jagla, T.; Weger, M.; Daponte, J.P.; Strähle, U.; Dickmeis, T.; Jagla, K. Glycolysis supports embryonic muscle growth by promoting myoblast fusion. Proc. Natl. Acad. Sci. USA 2013, 110, 18982–18987. [Google Scholar] [CrossRef]
- Garcia, M.; Pujol, A.; Ruzo, A.; Riu, E.; Ruberte, J.; Arbos, A.; Serafín, A.; Albella, B.; Felíu, J.E.; Bosch, F. Phosphofructo-1-kinase deficiency leads to a severe cardiac and hematological disorder in addition to skeletal muscle glycogenosis. PLoS Genet. 2009, 5, e1000615. [Google Scholar] [CrossRef]
Gene | Full Gene Name | Forward Primer | Reverse Primer |
---|---|---|---|
col8a1b | collagen, type VIII, alpha 1b | ACCCATTGTAGGAAAAGGTGAA | CCAGGTTTACCTCCAGGTCC |
ldha | lactate dehydrogenase A4 | GAGACTCCAGCGTTCCTGTG | CACCATCTTGTGGACGCTCT |
gstp1.2 | glutathione S-transferase pi 1.2 | CCCGATCCTACTACACGATGGC | GATCACCCTTCATCCACTCATCA |
Aldoaa | aldolase a, fructose-bisphosphate, a | GGAATGTCAAAGGTCATGCCG | GTGAGGCATCTTGACTCGTGTA |
ca2 | carbonic anhydrase II | ACGACAGCTCAACACTGACA | GAGCTCGGCTGGGTAACATT |
morc3b | MORC family CW-type zinc finger 3b | TGTAGCCAGTCTGAGAGCGA | CCATTTGTGGTCGTGCGAAG |
Igf1 | insulin-like growth factor 1 | ACATTGCCCGCATCTCATCC | CAGCGCATGGTACACTTAAAGA |
map2k2a | mitogen-activated protein kinase kinase 2a | GGTCATGGCCAGGAAGCTTAT | CACTGTAGAAGGCGCCGTAA |
gapdh | glyceraldehyde-3-phosphate dehydrogenase | GCCTTGAGAAACCTGCCAAG | CCCGTTGAAGTCAGTGGACA |
tpi1b | triosephosphate isomerase 1b | AAAAACTGCATCGCCCCAAC | CCGGTGACAGACCCTCCATA |
pgam2 | phosphoglycerate mutase 2 (muscle) | GACACCATTGCTCGTGCTCT | GCTGCATCTGACATGCTCTCTA |
pfkma | phosphofructokinase, muscle a | CCCGGCGACAAAGAGTAACA | CAAAGCCATCATGAACCGCC |
β-Actin | actin, beta 2 | CGTGCTGTTTTCCCTTCCATT | CAATACCGTGCTCAAAGGATACTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zou, X.; Liu, Q.; Guan, Q.; Zhao, M.; Zhu, X.; Pan, Y.; Liu, L.; Gao, Z. Muscle Fiber Characteristics and Transcriptome Analysis in Slow- and Fast-Growing Megalobrama amblycephala. Genes 2024, 15, 179. https://doi.org/10.3390/genes15020179
Zou X, Liu Q, Guan Q, Zhao M, Zhu X, Pan Y, Liu L, Gao Z. Muscle Fiber Characteristics and Transcriptome Analysis in Slow- and Fast-Growing Megalobrama amblycephala. Genes. 2024; 15(2):179. https://doi.org/10.3390/genes15020179
Chicago/Turabian StyleZou, Xue, Qi Liu, Qianqian Guan, Ming Zhao, Xin Zhu, Yaxiong Pan, Lusha Liu, and Zexia Gao. 2024. "Muscle Fiber Characteristics and Transcriptome Analysis in Slow- and Fast-Growing Megalobrama amblycephala" Genes 15, no. 2: 179. https://doi.org/10.3390/genes15020179
APA StyleZou, X., Liu, Q., Guan, Q., Zhao, M., Zhu, X., Pan, Y., Liu, L., & Gao, Z. (2024). Muscle Fiber Characteristics and Transcriptome Analysis in Slow- and Fast-Growing Megalobrama amblycephala. Genes, 15(2), 179. https://doi.org/10.3390/genes15020179