Identification of the Caprine Keratin-Associated Protein 20-2 (KAP20-2) Gene and Its Effect on Cashmere Traits
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals, Animal Tissues and Data Collected
2.2. Search for Caprine Sequences Homologous to the Human KAP20-2 Gene
2.3. PCR-SSCP Analysis of Caprine KRTAP20-2
2.4. Sequencing of Alleles and Sequence Analyses
2.5. Expression of Caprine KRTAP20-2 in Selected Tissues
2.6. Statistical Analyses
3. Results
3.1. Identification of Caprine KRTAP20-2
3.2. Detection of Allelic Variation in Caprine KRTAP20-2
3.3. Amino Acid Sequence Analyses
3.4. Expression of KRTAP20-2 in Different Tissues
3.5. Phenotypic Correlations between the Various Cashmere Traits
3.6. Allele and Genotype Frequencies of KRTAP20-2 in the Longdong Cashmere Goats
3.7. Associations between KRTAP20-2 Variation and Cashmere Traits
4. Discussion
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Franck, R.R. (Ed.) Appendix 10: Quality assessment of goat hair for textile use. In Silk, Mohair, Cashmere and Other Luxury Fibres; Woodhead Publishing Limited and CRC Press LLC in Association with the Textile Institute: Cambridge, UK, 2001; pp. 227–233. [Google Scholar]
- Yu, Z.; Gordon, S.W.; Nixon, A.J.; Bawden, C.S.; Rogers, M.A.; Wildermoth, J.E.; Maqbool, N.J.; Pearson, A.J. Expression patterns of keratin intermediate filament and keratin associated protein genes in wool follicles. Differentiation 2009, 77, 307–316. [Google Scholar] [CrossRef] [PubMed]
- Gong, H.; Zhou, H.; Forrest, R.H.; Li, S.; Wang, J.; Dyer, J.M.; Luo, Y.; Hickford, J.G. Wool keratin-associated protein genes in sheep-a review. Genes 2016, 7, 24. [Google Scholar] [CrossRef] [PubMed]
- Khan, I.; Emanuel Maldonado, E.; Vasconcelos, V.; O’Brien, S.J.; Johnson, W.E.; Antunes, A. Mammalian keratin associated proteins (KRTAPs) subgenomes: Disentangling hair diversity and adaptation to terrestrial and aquatic environments. BMC Genom. 2014, 15, 779. [Google Scholar] [CrossRef] [PubMed]
- Rogers, M.A.; Winter, H.; Langbein, L.; Wollschläger, A.; Praetzel-Wunder, S.; Jave-Suarez, L.F.; Schweizer, J. Characterization of human KAP24.1, a cuticular hair keratin-associated protein with unusual amino-acid composition and repeat structure. J. Investig. Dermatol. 2007, 127, 1197–1204. [Google Scholar] [CrossRef] [PubMed]
- Rogers, M.A.; Langbein, L.; Praetzel-Wunder, S.; Giehl, K. Characterization and expression analysis of the hair keratin associated protein KAP26.1. Br. J. Dermatol. 2008, 159, 725–729. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Zhou, H.; Gong, H.; Zhao, F.; Wang, J.; Liu, X.; Luo, Y.; Hickford, J.G. Identification of the ovine keratin-associated protein 22-1 (KAP22-1) gene and its effect on wool traits. Genes 2017, 8, 27. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhou, H.; Zhu, J.; Hu, J.; Liu, X.; Li, S.; Luo, Y.; Hickford, J.G. Identification of the ovine keratin-associated protein 15-1 gene (KRTAP15-1) and genetic variation in its coding sequence. Small Rumin. Res. 2017, 153, 131–136. [Google Scholar] [CrossRef]
- Andrews, M.; Visser, C.; Marle-Köster, E.V. Identification of novel variants for KAP1.1, KAP8.1 and KAP13.3 in South African goats. Small Rumin. Res. 2017, 149, 176–180. [Google Scholar] [CrossRef]
- Shah, R.M.; Ganai, T.A.; Sheikh, F.D.; Shanaz, S.; Shabir, M.; Khan, H.M. Characterization and polymorphism of keratin associated protein 1.4 gene in goats. Gene 2013, 518, 431–442. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.; Wang, X.; Chen, H.; Lan, X.Y.; Guo, Y.K.; Li, J.Y.; Wei, T.B.; Jing, Y.J.; Liu, S.Q.; Zhang, M.H.; et al. The PCR-SSCP and DNA sequencing methods detecting a large deletion mutation at KAP6.2 locus in the cashmere goat. Small Rumin. Res. 2008, 75, 243–246. [Google Scholar] [CrossRef]
- Jin, M.; Wang, L.; Li, S.; Xing, M.X.; Zhang, X. Characterization and expression analysis of KAP7.1, KAP8.2 gene in Liaoning new-breeding Cashmere goat hair follicle. Mol. Biol. Rep. 2011, 38, 3023–3028. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.; Chen, H.; Wang, X.; Yu, H.; Wang, M.; Wang, J.; Lan, X.Y.; Zhang, C.F.; Zhang, L.Z.; Guo, Y.K.; et al. aPCR-SSCP and DNA sequencing detecting two silent SNPs at KAP8.1 gene in the cashmere goat. Mol. Biol. Rep. 2009, 36, 1387–1391. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhao, Z.D.; Xu, H.R.; Qu, L.; Zhao, H.B.; Li, T.; Zhang, Z.Y. Variation and expression of KAP9.2 gene affecting cashmere trait in goats. Mol. Biol. Rep. 2012, 39, 10525–10529. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.; Cao, Q.; Wang, R.; Piao, J.; Zhao, F.; Piao, J. Molecular characterization and expression pattern of novel Keratin-associated protein 11.1 gene in the Liaoning Cashmere goat (Capra hircus). Asian Australas. J. Anim. Sci. 2017, 30, 328–337. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; Liu, W.J.; Zhang, F.Q.; Shao, Y.G.; Yu, S.G. The polymorphism of a novel mutation of KAP13.1 gene and its associations with cashmere traits on Xinjiang local goat breed in China. Asian. J. Anim. Vet. Adv. 2010, 5, 34–42. [Google Scholar]
- Liu, H.; Li, N.; Jia, C.; Zhu, X.; Jia, Z. Effect of the polymorphisms of keratin associated protein 8.2 gene on fibre traits in Inner Mongolia cashmere goats. Asian Australas. J. Anim. Sci. 2007, 20, 821–826. [Google Scholar] [CrossRef]
- Zhou, H.; Gong, H.; Wang, J.; Dyer, J.M.; Luo, Y.; Hickford, J.G.H. Identification of four new gene members of the KAP6 gene family in sheep. Sci. Rep. 2016, 6, 24074. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gong, H.; Zhou, H.; Hodge, S.; Dyer, J.M.; Hickford, J.G.H. Association of wool traits with variation in the ovine KAP1-2 gene in Merino cross lambs. Small Rumin. Res. 2015, 124, 24–29. [Google Scholar] [CrossRef]
- Zhou, H.; Gong, H.; Li, S.; Luo, Y.; Hickford, J.G.H. A 57-bp deletion in the ovine KAP6-1 gene affects wool fibre diameter. J. Anim. Breed. Genet. 2015, 132, 301–307. [Google Scholar] [CrossRef] [PubMed]
- Tao, J.; Zhou, H.; Gong, H.; Yang, Z.; Ma, Q.; Cheng, L.; Ding, W.; Li, Y.; Hickford, J.G.H. Variation in the KAP6-1 gene in Chinese Tan sheep and its effect on wool traits. Small Rumin. Res. 2017, 154, 129–132. [Google Scholar] [CrossRef]
- Li, S.; Zhou, H.; Gong, H.; Zhao, F.; Wang, J.; Luo, Y.; Hickford, J.G.H. Variation in the ovine KAP6-3 gene (KRTAP6-3) is associated with variation in mean fibre diameter-associated wool traits. Genes 2017, 8, 204. [Google Scholar] [CrossRef] [PubMed]
- Tao, J.; Zhou, H.; Yang, Z.; Gong, H.; Ma, Q.; Ding, W.; Li, Y.; Hickford, J.G.H. Variation in the KAP8-2 gene affects crimping and grow rate of wool in Chinese Tan sheep. Small Rumin. Res. 2017, 149, 77–80. [Google Scholar] [CrossRef]
- Rogers, M.A.; Langbein, L.; Winter, H.; Ehmann, C.; Praetzel, S.; Schweizer, J. Characterization of a first domain of human high glycine-tyrosine and high sulfur keratin-associated protein (KAP) genes on chromosome 21q22.1. J. Biol. Chem. 2002, 277, 48993–49002. [Google Scholar] [CrossRef] [PubMed]
- Shimomura, Y.; Ito, M. Human hair keratin-associated proteins. J. Investig. Dermatol. Symp. Proc. 2005, 10, 230–233. [Google Scholar] [CrossRef] [PubMed]
- GCF_001704415.1. Available online: https://www.ncbi.nlm.nih.gov/assembly/GCF_001704415.1 (accessed on 26 June 2016).
- Zhou, H.; Hickford, J.G.; Fang, Q. A two-step procedure for extracting genomic DNA from dried blood spots on filter paper for polymerase chain reaction amplification. Anal. Biochem. 2006, 354, 159–161. [Google Scholar] [CrossRef] [PubMed]
- Byun, S.O.; Fang, Q.; Zhou, H.; Hickford, J.G.H. An effective method for silver-staining DNA in large numbers of polyacrylamide gels. Anal. Biochem. 2009, 385, 174–175. [Google Scholar] [CrossRef] [PubMed]
- Gong, H.; Zhou, H.; Hickford, J.G. Diversity of the glycine/tyrosine-rich keratin-associated protein 6 gene (KAP6) family in sheep. Mol. Biol. Rep. 2011, 38, 31–35. [Google Scholar] [CrossRef] [PubMed]
- Blom, N.; Gammeltoft, S.; Brunak, S. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J. Mol. Biol. 1999, 294, 1351–1362. [Google Scholar] [CrossRef] [PubMed]
- Gong, H.; Zhou, H.; McKenzie, G.W.; Yu, Z.; Clerens, S.; Dyer, J.M.; Plowman, J.E.; Wright, M.W.; Arora, R.; Bawden, C.S.; et al. An updated nomenclature for keratin-associated proteins (KAPs). Int. J. Biol. Sci. 2012, 8, 258–264. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gong, H.; Zhou, H.; Dyer, J.M.; Hickford, J.G. The sheep KAP8-2 gene, a new KAP8 family member that is absent in humans. Springerplus 2014, 3, 528. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, H.; Gong, H.; Yan, W.; Luo, Y.; Hickford, J.G. Identification and sequence analysis of the keratin-associated protein 24-1 (KAP24-1) gene homologue in sheep. Gene 2012, 511, 62–65. [Google Scholar] [CrossRef] [PubMed]
- Rogers, M.A.; Langbein, L.; Praetzel-Wunder, S.; Winter, H.; Schweizer, J. Human hair keratin-associated proteins (KAPs). Int. Rev. Cytol. 2006, 251, 209–263. [Google Scholar] [PubMed]
- Ku, N.O.; Liao, J.; Chou, C.F.; Omary, M.B. Implications of intermediate filament protein phosphorylation. Cancer Metastasis. Rev. 1996, 15, 429–444. [Google Scholar] [CrossRef] [PubMed]
- Bishop, S.C.; Russel, A.J.F. The inheritance of fibre traits in a crossbred population of Cashmere goats. Anim. Sci. 1996, 63, 429–436. [Google Scholar] [CrossRef]
- Zhou, H.M.; Allain, D.; Li, J.Q.; Zhang, W.G.; Yu, X.C. Genetic parameters of production traits of Inner Mongolia cashmere goats in China. J. Anim. Breed. Genet. 2002, 119, 385–390. [Google Scholar] [CrossRef]
- Ma, N.; Li, Y.; Song, Y.; Lou, Y.; Son, X. Estimates of genetic parameters of main economic traits in Liaoning cashmere goat. J. Jilin Agric. Univ. 2005, 27, 446–448. [Google Scholar]
- McGregor, B.; Butler, K. Cashmere production and fleece attributes associated with farm of origin, age and sex of goat in Australia. Anim. Prod. Sci. 2008, 48, 1090–1098. [Google Scholar] [CrossRef]
Gene | Sequence (5′-3′) | Amplicon Size (bp) | Purpose of Primers |
---|---|---|---|
KRTAP20-2 | CAGACTATAGAGACAGATTCC CCAATTAGTTGAGTTTCTCTG | 273 | Gene identification and SSCP analysis |
KRTAP20-2 | TGGAAACTACTATGGCGGCC TATCTTCTGCAACAGGATGG | 156 | Reverse transcription (RT)-PCR |
β-actin | AGCCTTCCTTCCTGGGCATGGA GGACAGCACCGTGTTGGCGTAGA | 113 | RT-PCR |
Substitution 1 | Allele | Amino Acid Change 1 | ||
---|---|---|---|---|
A | B | C | ||
c.27C>T | C | T | C | Silent |
c.37C>T | C | T | T | p.His13Tyr |
c.125T>C | T | C | C | p.Met42Thr |
c.126G>A | G | A | A | p.Met42Thr |
Trait | Cashmere fibre weight | Mean fibre diameter |
Mean fibre diameter | 0.280, p < 0.001 | |
Curly fibre length | 0.490, p < 0.001 | 0.216, p < 0.001 |
Cashmere Trait (Unit) | Allele | Absent | Present | p Value 1 | ||
---|---|---|---|---|---|---|
Mean ± SE | n | Mean ± SE | n | |||
Cashmere fibre weight (g) | A | 378 ± 5.4 | 64 | 416 ± 2.8 | 309 | <0.001 |
B | 422 ± 3.1 | 218 | 392 ± 3.8 | 155 | <0.001 | |
Mean fibre diameter (μm) | A | 13.6 ± 0.06 | 64 | 13.6 ± 0.03 | 309 | 0.581 |
B | 13.6 ± 0.03 | 218 | 13.6 ± 0.04 | 155 | 0.748 | |
Curly fibre length (cm) | A | 4.1 ± 0.06 | 64 | 4.2 ± 0.03 | 309 | 0.328 |
B | 4.2 ± 0.04 | 218 | 4.1 ± 0.04 | 155 | 0.021 |
Cashmere Trait (Unit) | Mean ± SE | p Value | ||
---|---|---|---|---|
AA (n = 201) | AB (n = 91) | BB (n = 61) | ||
Cashmere fibre weight (g) | 422 ± 3.2 a | 402 ± 4.6 b | 375 ± 5.5 c | <0.001 |
Mean fibre diameter (μm) | 13.6 ± 0.03 | 13.6 ± 0.05 | 13.6 ± 0.06 | 0.793 |
Curly fibre length (cm) | 4.2 ± 0.04 a | 4.1 ± 0.05 b | 4.1 ± 0.06 b | 0.032 |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Che, L.; Hickford, J.G.H.; Zhou, H.; Hao, Z.; Luo, Y.; Hu, J.; Liu, X.; Li, S. Identification of the Caprine Keratin-Associated Protein 20-2 (KAP20-2) Gene and Its Effect on Cashmere Traits. Genes 2017, 8, 328. https://doi.org/10.3390/genes8110328
Wang J, Che L, Hickford JGH, Zhou H, Hao Z, Luo Y, Hu J, Liu X, Li S. Identification of the Caprine Keratin-Associated Protein 20-2 (KAP20-2) Gene and Its Effect on Cashmere Traits. Genes. 2017; 8(11):328. https://doi.org/10.3390/genes8110328
Chicago/Turabian StyleWang, Jiqing, Longjie Che, Jon G. H. Hickford, Huitong Zhou, Zhiyun Hao, Yuzhu Luo, Jiang Hu, Xiu Liu, and Shaobin Li. 2017. "Identification of the Caprine Keratin-Associated Protein 20-2 (KAP20-2) Gene and Its Effect on Cashmere Traits" Genes 8, no. 11: 328. https://doi.org/10.3390/genes8110328