Prevalence of Antibiotic Resistance Genes and Their Association with Antibiotics in a Wastewater Treatment Plant: Process Distribution and Analysis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Instruments and Reagents
2.2. Description of Sampling Points and Sample Collection
2.3. Extraction and Determination of Target Antibiotics
2.4. DNA Extraction and PCR
2.5. Quantification of ARGs by Real-Time qPCR
2.6. Data Analysis
3. Results and Discussion
3.1. Antibiotic Contamination Level
3.1.1. Distribution and Concentration Variation of Antibiotics in the Aqueous Phase
3.1.2. Distribution and Concentration Variation of Antibiotics in the Sludge Phase
3.2. Pollution Level of Antibiotic Resistance Genes
3.2.1. Occurrence of Antibiotic Resistance Genes in Influent and Effluent
3.2.2. Relative Abundance and Distribution Characteristics of ARGs
3.3. Correlation Analysis between Antibiotics and ARGs
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Luo, Y.; Mao, D.; Rysz, M.; Zhou, Q.; Zhang, H.; Xu, L.; Alvarez, P.J.J. Trends in antibiotic resistance genes occurrence in the Haihe River. Environ. Sci. Technol. 2010, 44, 7220–7225. [Google Scholar] [CrossRef]
- Kümmerer, K. Antibiotics in the aquatic environment-a review-part II. Chemosphere 2009, 75, 435–441. [Google Scholar] [CrossRef]
- De Souza Santos, L.V.; Teixeira, D.C.; Jacob, R.S.; Amaral, M.C.; Lange, L.C. Evaluation of the aerobic and anaerobic biodegradability of the antibiotic norfloxacin. Water Sci. Technol. 2014, 70, 265–271. [Google Scholar] [CrossRef]
- Corno, G.; Yang, Y.; Eckert, E.M.; Fontaneto, D.; Fiorentino, A.; Galafassi, S.; Zhang, T.; Di Cesare, A. Effluents of wastewater treatment plants promote the rapid stabilization of the antibiotic resistome in receiving freshwater bodies. Water Res. 2019, 158, 72–81. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.T.; Shuai, D.M. Research highlights: Antibiotic resistance genes: From wastewater into the environment. Environ. Sci. Water Res. Technol. 2015, 1, 264–267. [Google Scholar] [CrossRef]
- Peng, X.Z.; Zhang, K.; Tang, C.M.; Huang, Q.X.; Yu, Y.Y.; Cui, J.L. Distribution pattern, behavior, and fate of antibacterials in urban aquatic environments in South China. J. Environ. Monit. 2011, 13, 446–454. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.J.; Ying, G.G.; Liu, S.; Zhao, J.L.; Yang, B.; Chen, Z.F.; Lai, H.J. Occurrence and fate of eleven classes of antibiotics in two typical wastewater treatment plants in South China. Sci. Total Environ. 2013, 452–453, 365–376. [Google Scholar] [CrossRef] [PubMed]
- McConnell, M.M.; Hansen, L.T.; Jamieson, R.C.; Neudorf, K.D.; Yost, C.K.; Tong, A. Removal of antibiotic resistance genes in two tertiary level municipal wastewater treatment plants. Sci. Total Environ. 2018, 643, 292–300. [Google Scholar] [CrossRef]
- Zhang, H.; Du, M.; Jiang, H.; Zhang, D.; Lin, L.; Ye, H.; Zhang, X. Occurrence, seasonal variation and removal efficiency of antibiotics and their metabolites in wastewater treatment plants, Jiulongjiang River Basin, South China. Environ. Sci. Process. Impacts 2015, 17, 225–234. [Google Scholar] [CrossRef]
- Gao, J.H.; Wang, Z.W.; Zhang, H.Y. Occurrence and the fate of typical antibiotics in sewage treatment plants in Lanzhou. Acta Sci. Circumst. 2016, 36, 3765–3773. [Google Scholar]
- Mao, D.Q.; Yu, S.; Ryszc, M.; Luo, Y.; Yang, F.X.; Li, F.X.; Hou, J.; Mu, Q.H.; Alvarez, P.J.J. Concurrence of aqueous and gas phase contamination of groundwater in the Wattenberg oil and gas field of northern Colorado. Water Res. 2015, 88, 458–466. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Zhang, G.P.; Liu, C.Q.; Li, L.; Xiang, M. The occurrence of chloramphenicol and tetracyclines in municipal sewage and the Nanming River, Guiyang City, China. J. Environ. Monit. 2009, 11, 1199–1205. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Q.B.; Guo, M.T.; Yang, J. Monitoring and assessing the impact of wastewater treatment on release of both antibiotic-resistant bacteria and their typical genes in a Chinese municipal wastewater treatment plant. Environ. Sci. Process. Impacts 2014, 16, 1930–1937. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Shi, Y.; Gao, L.; Liu, J.; Cai, Y. Occurrence and removal of antibiotics in a municipal wastewater reclamation plant in Beijing, China. Chemosphere 2013, 92, 435–444. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Li, J.; Chen, H.; Bond, P.L.; Yuan, Z. Metagenomic analysis reveals wastewater treatment plants as hotspots of antibiotic resistance genes and mobile genetic elements. Water Res. 2017, 123, 468–478. [Google Scholar] [CrossRef]
- Czekalski, N.; Gascón Díez, E.; Bürgmann, H. Wastewater as a point source of antibiotic-resistance genes in the sediment of a freshwater lake. ISME J. 2014, 8, 1381–1390. [Google Scholar] [CrossRef]
- Rizzo, L.; Manaia, C.; Merlin, C.; Schwartz, T.; Dagot, C.; Ploy, M.C.; Michael, I.; Fatta-Kassinos, D. Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: A review. Sci. Total Environ. 2013, 447, 345–360. [Google Scholar] [CrossRef]
- Zhang, J.; Zong, D.; Chang, A.; Meng, F.; Wang, L.; Deng, W.; Guan, Y. Determination of common antibiotics in aquatic environment by solid-phase extraction and ultra pressure liquid chromatographytandem mass spectrometry (UPLC-MS/MS). Environ. Chem. 2015, 34, 1446–1452. [Google Scholar]
- Pan, M.; Chu, L.M. Occurrence of antibiotics and antibiotic resistance genes in soils from wastewater irrigation areas in the Pearl River Delta region, southern China. Sci. Total Environ. 2017, 624, 145–152. [Google Scholar] [CrossRef]
- Zou, S.; Zhu, C.; He, Z.; Luan, T.; Xu, W.; Zhang, G. Preliminary Studies on the Pollution Levels of Antibiotic Resistance Genes in the Water of Beijiang River, South China. Asian J. Ecotoxicol. 2009, 5, 655–660. [Google Scholar]
- Christine, M.; John, M.F.; Sadjia, B.; François, S.a.; Roger, C.L.; Roland, B.; Luke, M.; Serge, L.; Josée, H. Antimicrobial Resistance Genes in Enterotoxigenic Escherichia coli O149:K91 Isolates Obtained over a 23-Year Period from Pigs. Antimicrob. Agents Chemother. 2003, 47, 3214–3221. [Google Scholar]
- Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [PubMed]
- Szczepanowski, R.; Linke, B.; Krahn, I.; Gartemann, K.H.; Gützkow, T.; Eichler, W.; Pühler, A.; Schlüter, A. Detection of 140 clinically relevant antibiotic-resistance genes in the plasmid metagenome of wastewater treatment plant bacteria showing reduced susceptibility to selected antibiotics. Microbiology 2009, 155, 2306–2319. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Liang, X.; Nie, X.; Huang, X.; Zou, S.; Li, X. The role of class I integrons in the dissemination of sulfonamide resistance genes in the Pearl River and Pearl River Estuary, South China. J. Hazard. Mater. 2015, 282, 61–67. [Google Scholar] [CrossRef]
- Munir, M.; Wong, K.; Xagoraraki, I. Release of antibiotic resistant bacteria and genes in the effluent and biosolids of five wastewater utilities in Michigan. Water Res. 2011, 45, 681–693. [Google Scholar] [CrossRef]
- Ji, X.; Shen, Q.; Liu, F.; Ma, J.; Xu, G.; Wang, Y.; Wu, M. Antibiotic resistance gene abundances associated with antibiotics and heavy metals in animal manures and agricultural soils adjacent to feedlots in Shanghai, China. J. Hazard. Mater. 2012, 235–236, 178–185. [Google Scholar]
- Strommenger, B.; Kettlitz, C.; Werner, G.; Witte, W. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J. Clin. Microbiol. 2003, 41, 4089–4094. [Google Scholar] [CrossRef]
- Just, N.A.; Létourneau, V.; Kirychuk, S.P.; Singh, B.; Duchaine, C. Potentially pathogenic bacteria and antimicrobial resistance in bioaerosols from cage-housed and floor-housed poultry operations. Ann. Occup. Hyg. 2012, 56, 440–449. [Google Scholar]
- Luo, Y.; Xu, L.; Rysz, M.; Wang, Y.; Zhang, H.; Alvarez, P.J. Occurrence and transport of tetracycline, sulfonamide, quinolone, and macrolide antibiotics in the Haihe River Basin, China. Environ. Sci. Technol. 2011, 45, 1827–1833. [Google Scholar] [CrossRef]
- Chen, S.; Zhao, S.; White, D.G.; Schroeder, C.M.; Lu, R.; Yang, H.; McDermott, P.F.; Ayers, S.; Meng, J. Characterization of multiple-antimicrobial-resistant salmonella serovars isolated from retail meats. Appl. Environ. Microbiol. 2004, 70, 1–7. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, D.; Zhang, H.; Luo, Z.; Yan, C. Occurrence, distribution, and seasonal variation of estrogenic compounds and antibiotic residues in Jiulongjiang River, South China. Environ. Sci. Pollut. Res. Int. 2012, 19, 1392–1404. [Google Scholar] [CrossRef] [PubMed]
- García-Galán, M.J.; Díaz-Cruz, M.S.; Barceló, D. Occurrence of sulfonamide residues along the Ebro River basin: Removal in wastewater treatment plants and environmental impact assessment. Environ. Int. 2011, 37, 462–473. [Google Scholar] [CrossRef] [PubMed]
- Watkinson, A.J.; Murby, E.J.; Costanzo, S.D. Removal of antibiotics in conventional and advanced wastewater treatment: Implications for environmental discharge and wastewater recycling. Water Res. 2007, 41, 4164–4176. [Google Scholar] [CrossRef] [PubMed]
- Leung, H.W.; Minh, T.B.; Murphy, M.B.; Lam, J.C.; So, M.K.; Martin, M.; Lam, P.K.; Richardson, B.J. Distribution, fate and risk assessment of antibiotics in sewage treatment plants in Hong Kong, South China. Environ. Int. 2012, 42, 1–9. [Google Scholar] [CrossRef]
- Hu, J.; Juan, Z.; Shaoqi, Z.; Pan, W.; Tsang, Y.F. Occurrence and fate of antibiotics in a wastewater treatment plant and their biological effects on receiving waters in Guizhou. Process Saf. Environ. Prot. 2018, 113, 483–490. [Google Scholar] [CrossRef]
- McArdell, C.S.; Molnar, E.; Suter, M.J.; Giger, W. Occurrence and fate of macrolide antibiotics in wastewater treatment plants and in the Glatt Valley watershed, Switzerland. Environ. Sci. Technol. 2003, 37, 5479–5486. [Google Scholar] [CrossRef]
- Jia, A.; Wan, Y.; Xiao, Y.; Hu, J. Occurrence and fate of quinolone and fluoroquinolone antibiotics in a municipal sewage treatment plant. Water Res. 2012, 46, 387–394. [Google Scholar] [CrossRef]
- Lorenzo, F.; Navaratnam, S.; Edge, R.; Allen, N.S. Primary photophysical properties of moxifloxacin—A fluoroquinolone antibiotic. Photochem. Photobiol. 2008, 84, 1118–1125. [Google Scholar] [CrossRef]
- Samira, B.; Amin, T.Y.; Trong-On, D. Photocatalytic pathway toward degradation of environmental pharmaceutical pollutants: Structure, kinetics and mechanism approach. Catal. Sci. Technol. 2017, 7, 4548–4569. [Google Scholar]
- Werner, J.J.; Chintapalli, M.; Lundeen, R.A.; Wammer, K.H.; Arnold, W.A.; McNeill, K. Environmental photochemistry of tylosin: Efficient, reversible photoisomerization to a less-active isomer, followed by photolysis. J. Agric. Food Chem. 2007, 55, 7062–7068. [Google Scholar] [CrossRef]
- Stevens-Garmon, J.; Drewes, J.E.; Khan, S.J.; McDonald, J.A.; Dickenson, E.R. Sorption of emerging trace organic compounds onto wastewater sludge solids. Water Res. 2011, 45, 3417–3426. [Google Scholar] [CrossRef]
- Golet, E.M.; Alder, A.C.; Giger, W. Environmental exposure and risk assessment of fluoroquinolone antibacterial agents in wastewater and river water of the Glatt Valley Watershed, Switzerland. Environ. Sci. Technol. 2002, 36, 3645–3651. [Google Scholar] [CrossRef]
- Zhou, H.; Huang, X.; Wen, X. Progress of the studies on occurrence and fate of new emerging micro-pollutants-PPCPs in municipal wastewaters. Chin. J. Environ. Eng. 2007, 1, 1–9. [Google Scholar]
- De Jesus Gaffney, V.; Cardoso, V.V.; Cardoso, E.; Teixeira, A.P.; Martins, J.; Benoliel, M.J.; Almeida, C.M.M. Occurrence and behaviour of pharmaceutical compounds in a Portuguese wastewater treatment plant: Removal efficiency through conventional treatment processes. Environ. Sci. Pollut. Res. Int. 2017, 24, 14717–14734. [Google Scholar] [CrossRef]
- Xia, Z.; Xiao, W.; Zhong, C.; Hao, X.; Qing, Z. Microbial community structure and pharmaceuticals and personal care products removal in a membrane bioreactor seeded with aerobic granular sludge. Appl. Microbiol. Biotechnol. 2015, 99, 425–433. [Google Scholar] [CrossRef]
- Peng, X.; Tan, J.; Tang, C.; Yu, Y.; Wang, Z. Multiresidue determination of fluoroquinolone, sulfonamide, trimethoprim, and chloramphenicol antibiotics in urban waters in China. Environ. Toxicol. Chem. 2008, 27, 73–79. [Google Scholar] [CrossRef]
- Chao, S.; Xue, S.; Peng, X.; Yun, W.a.n.g.; Shu, W. Investigation of fate and behavior of tetracycline in nitrifying sludge system. RSC Adv. 2015, 5, 87333–87340. [Google Scholar]
- Wen, Q.; Yang, L.; Duan, R.; Chen, Z. Monitoring and evaluation of antibiotic resistance genes in four municipal wastewater treatment plants in Harbin, Northeast China. Environ. Pollut. 2016, 212, 34–40. [Google Scholar] [CrossRef]
- 49Chen, H.; Zhang, M. Occurrence and removal of antibiotic resistance genes in municipal wastewater and rural domestic sewage treatment systems in eastern China. Environ. Int. 2013, 55, 9–14. [Google Scholar]
- Goyal, N.; Jain, S.C.; Banerjee, U.C. Comparative studies on the microbial adsorption of heavy metals. Adv. Environ. Res. 2003, 7, 311–319. [Google Scholar] [CrossRef]
- Luo, Y.; Guo, W.; Ngo, H.H.; Nghiem, L.D.; Hai, F.I.; Zhang, J.; Liang, S.; Wang, X.C. A review on the occurrence of micropollutants in the aquatic environment and their fate and removal during wastewater treatment. Sci. Total Environ. 2014, 473–474, 619–641. [Google Scholar] [CrossRef] [PubMed]
- Binh, C.T.; Heuer, H.; Gomes, N.C.; Kotzerke, A.; Fulle, M.; Wilke, B.M.; Schloter, M.; Smalla, K. Short-term effects of amoxicillin on bacterial communities in manured soil. FEMS Microbiol. Ecol. 2007, 62, 290–302. [Google Scholar] [CrossRef] [PubMed]
- Engemann, C.A.; Keen, P.L.; Knapp, C.W.; Hall, K.J.; Graham, D.W. Fate of tetracycline resistance genes in aquatic systems: Migration from the water column to peripheral biofilms. Environ. Sci. Technol. 2008, 42, 5131–5136. [Google Scholar] [CrossRef] [PubMed]
- Pei, R.; Cha, J.; Carlson, K.H.; Pruden, A. Response of antibiotic resistance genes (ARG) to biological treatment in dairy lagoon water. Environ. Sci. Technol. 2007, 41, 5108–5113. [Google Scholar] [CrossRef] [PubMed]
- Mondragón, V.A.; Llamas-Pérez, D.F.; González-Guzmán, G.E.; Márquez-González, A.R.; Padilla-Noriega, R.; Durán-Avelar Mde, J.; Franco, B. Identification of Enterococcus faecalis bacteria resistant to heavy metals and antibiotics in surface waters of the Mololoa River in Tepic, Nayarit, Mexico. Environ. Monit. Assess. 2011, 183, 329–340. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Xu, Y.; Wang, H.; Guo, C.; Qiu, H.; He, Y.; Zhang, Y.; Li, X.; Meng, W. Occurrence of antibiotics and antibiotic resistance genes in a sewage treatment plant and its effluent-receiving river. Chemosphere 2015, 119, 1379–1385. [Google Scholar] [CrossRef]
- Che, Y.; Xia, Y.; Liu, L.; Li, A.D.; Yang, Y.; Zhang, T. Mobile antibiotic resistome in wastewater treatment plants revealed by Nanopore metagenomic sequencing. Microbiome 2019, 7, 44. [Google Scholar] [CrossRef] [Green Version]
- McKinney, C.W.; Loftin, K.A.; Meyer, M.T.; Davis, J.G.; Pruden, A. tet and sul antibiotic resistance genes in livestock lagoons of various operation type, configuration, and antibiotic occurrence. Environ. Sci. Technol. 2010, 44, 6102–6109. [Google Scholar] [CrossRef]
Parameter | Inflow | Effluent | ||
---|---|---|---|---|
Range | Median | Range | Median | |
SS | 79–182 | 177 | nd–12 | 6.0 |
COD | 94–617 | 243 | 15.8–45 | 20.1 |
BOD5 | 64–332 | 141 | 2.0–4.6 | 2.2 |
-N | 6.10–37.29 | 24.57 | 0.15–6.12 | 0.78 |
-N | nd–2.16 | 0.66 | 1.78–11.49 | 6.30 |
-N | nd–5.2 | 0.10 | 0.002–0.347 | 0.054 |
TP | nd–0.035 | 33.4 | 0.004–0.94 | 0.21 |
TN | 9.44–44.22 | 30.86 | 2.79–16.52 | 7.06 |
Compound | Retention Time (min) | Precursor Ion (m/z) | Quantitative Ion (m/z) | Qualitative Ion (m/z) | Fragment (V) | Collision Energy (eV) | Cone Voltage (V) |
---|---|---|---|---|---|---|---|
TC | 4.30 | 445.4 | 427.7 | 410.8 | 22 | 14 | 18 |
OTC | 3.29 | 445.4 | 428.7 | 410.7 | 24 | 20 | 25 |
ROX | 6.95 | 279.1 | 124.1 | 92.1 | 26 | 30 | 22 |
CLA | 2.86 | 348.2 | 158 | 106.0 | 32 | 26 | 29 |
NOR | 3.62 | 320.4 | 302.3 | 282.3 | 26 | 22 | 30 |
OFX | 7.14 | 362.1 | 261.2 | 443.2 | 28 | 26 | 28 |
SMZ | 7.00 | 254.3 | 156.3 | 108.2 | 28 | 20 | 17 |
SMX | 1.81 | 281.3 | 156.3 | 126.3 | 34 | 13 | 21 |
OFL-d3 | 6.14 | 279.1 | 225.2 | 172.7 | 25 | 18 | 22 |
SMZ-d4 | 5.12 | 348.2 | 179.4 | 136.9 | 30 | 26 | 28 |
NOR-d5 | 2.71 | 320.4 | 312.7 | 272.7 | 26 | 24 | 28 |
Compound | Sewage Samples | Sludge Samples | ||||||
---|---|---|---|---|---|---|---|---|
MDL (ng L−1) | MQL (ng L−1) | Recovery (%) | R2 | MDL (μg·kg−1) | MQL (μg·kg−1) | R2 | Recovery (%) | |
TC | 0.4 | 1.0 | 93 | 0.9992 | 0.4 | 1.5 | 0.9993 | 95 |
OTC | 0.2 | 1.0 | 96 | 0.9995 | 0.1 | 1.0 | 0.9996 | 97 |
ROX | 0.3 | 1.1 | 95 | 0.9994 | 0.6 | 1.0 | 0.9994 | 93 |
CLA | 0.5 | 1.2 | 91 | 0.9993 | 0.5 | 1.1 | 0.9992 | 92 |
NOR | 0.2 | 1.0 | 98 | 0.9994 | 0.2 | 1.1 | 0.9991 | 94 |
OFX | 0.2 | 1.1 | 95 | 0.9996 | 0.2 | 1.3 | 0.9995 | 96 |
SMZ | 1.5 | 2.2 | 74 | 0.9998 | 1.2 | 2.1 | 0.9997 | 82 |
SMX | 0.6 | 1.2 | 85 | 0.9993 | 0.3 | 1.0 | 0.9993 | 90 |
Target Gens | Primers | Sequences (5′→3′) | Amplicon Size (bp) | Annealing Temp (°C) | Ref. |
---|---|---|---|---|---|
tetA | tetA-F | GTGAAACCCAACATACCCC | 880 | 58 | [21] |
tetA-R | GAAGGCAAGCAGGATGTAG | ||||
tetB | tetB-F | CCTTATCATGCCAGTCTTGC | 774 | 58 | [21] |
tetB-R | ACTGCCGTTTTTTCGCC | ||||
tetC | tetC-F | ACTTGGAGCCACTATCGAC | 881 | 60 | [21] |
tetC-R | CATCAATCCATGCCAACCC | ||||
tetD | tetD-F | AAACCATTACGGCATTCTGC | 787 | 60 | [22] |
tetD-R | GACCGGATACACCATCCATC | ||||
tetM | tetM-F | GTGGACAAAGGTACAACGAG | 406 | 55 | [22] |
tetM-R | CGGTAAAGTTCGTCACACAC | ||||
tetO | tetO-F | AACTTAGGCATTCTGGCTCAC | 515 | 55 | [23] |
tetO-R | TCCCACTGTTCCATATCGTCA | ||||
tetQ | tetQ-F | AGAATCTGCTGTTTGCCAGTG | 169 | 55 | [1] |
tetQ-R | CGGAGTGTCAATGATATTGCA | ||||
tetW | tetW-F | GAGAGCCTGCTATATGCCAGC | 168 | 55 | [1] |
tetW-R | GGGCGTATCCACAATGTTAAC | ||||
tetX | tetX-F | CAATAATTGGTGGTGGACCC | 468 | 55 | [24] |
tetX-R | TTCTTACCTTGGACATCCCG | ||||
sul I | sul I-F | TTCGGCATTCTGAATCTCAC | 158 | 62 | [25] |
sul I-R | ATGATCTAACCCTCGGTCTC | ||||
sul II | sul II-F | CGGCATCGTCAACATAACC | 191 | 62 | [25] |
sul II-R | GTGTGCGGATGAAGTCAG | ||||
sul III | sul III-F | TCCGTTCAGCGAATTGGTGCAG | 143 | 62 | [26] |
sul III-R | TTCGTTCACGCCTTACACCAGC | ||||
sulA | sulA-F | TCTTGAGCAAGCACTCCAGCAG | 198 | 62 | [26] |
sulA-R | TCCAGCCTTAGCAACCACATGG | ||||
ermA | ermA-F | AAGCGGTAAACCCCTCTGA | 190 | 56 | [27] |
ermA-R | TTCGCAAATCCCTTCTCAAC | ||||
ermB | ermB-F | ACGAAATTGGAACAGGTAAAGGGCA | 263 | 56 | [28] |
ermB-R | ACGAAATTGGAACAGGTAAAGGGCA | ||||
qnrS | qnrS-F | ACGACATTCGTCAACTGCAA | 417 | 58 | [29] |
qnrS-R | TAAATTGGCACCCTGTAGGC | ||||
blaPSE-1 | blaPSE-1-F | TGCTTCGCAACTATGACTAC AGCCTGTGTTTGAGCTAGAT | 438 | 58 | [30] |
blaPSE-1-R | AGCCTGTGTTTGAGCTAGAT | ||||
intI 1 | intI1-F | CCTCCCGCACGATGATC | 280 | 55 | [25] |
intI1-R | TCCACGCATCGTCAGGC | ||||
16S rRNA | 16S-F | CCTACGGGAGGCAGCAG | 178 | 62 | [25] |
16S-R | CCTACGGGAGGCAGCAG |
Sample | tetA | tetB | tetC | tetD | tetX | tetM |
---|---|---|---|---|---|---|
Inf | + | + | + | + | + | - |
Ss-W | + | + | + | - | + | - |
Sample | tetO | tetQ | tetW | sul I | sul II | sul III |
Inf | - | + | + | + | + | + |
Ss-W | - | - | - | + | + | + |
Sample | sul A | blaPSE-1 | ermA | ermB | qnrS | int I 1 |
Inf | - | - | - | - | - | + |
Ss-W | - | - | - | - | - | + |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, H.; Zhou, X.; Huang, H.; Zhang, J. Prevalence of Antibiotic Resistance Genes and Their Association with Antibiotics in a Wastewater Treatment Plant: Process Distribution and Analysis. Water 2019, 11, 2495. https://doi.org/10.3390/w11122495
Liu H, Zhou X, Huang H, Zhang J. Prevalence of Antibiotic Resistance Genes and Their Association with Antibiotics in a Wastewater Treatment Plant: Process Distribution and Analysis. Water. 2019; 11(12):2495. https://doi.org/10.3390/w11122495
Chicago/Turabian StyleLiu, Huaguang, Xingyu Zhou, Hexun Huang, and Jinsong Zhang. 2019. "Prevalence of Antibiotic Resistance Genes and Their Association with Antibiotics in a Wastewater Treatment Plant: Process Distribution and Analysis" Water 11, no. 12: 2495. https://doi.org/10.3390/w11122495