Smart Nanoformulation Based on Polymeric Magnetic Nanoparticles and Vincristine Drug: A Novel Therapy for Apoptotic Gene Expression in Tumors
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Manufacture of DEX Coated SPION Nanoparticles
2.3. VNC-Loaded Nanoparticles
2.4. Characterization
2.5. Drug Release Measurements
2.6. Cell Culture Condition
2.7. Cellular Internalization
2.8. Cytotoxicity Assay
2.9. Apoptosis Estimation
2.10. RT-PCR
3. Results and Discussion
3.1. Nanoparticles Characterization
3.2. Drug Release Study
3.3. VNC Drug Internalization of Cells
3.4. The MTT Assay
3.5. Apoptosis Measurement by Flow Cytometry
3.6. Gene Expression
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Moudi, M.; Go, R.; Yien, C.Y.S.; Nazre, M. Vinca alkaloids. Int. J. Prev. Med. 2013, 4, 1231. [Google Scholar] [PubMed]
- Albukhaty, S.; Al-Bayati, L.; Al-Karagoly, H.; Al-Musawi, S. Preparation and characterization of titanium dioxide nanoparticles and in vitro investigation of their cytotoxicity and antibacterial activity against Staphylococcus aureus and Escherichia coli. Anim. Biotechnol. 2020, 28, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Raj, T.A.S.; Smith, A.M.; Moore, A.S. Vincristine sulfate liposomal injection for acute lymphoblastic leukemia. Int. J. Nanomed. 2013, 8, 4361. [Google Scholar]
- Ozdemir, N.; Dogan, M.; Sendur, M.A.N.; Yazici, O.; Abali, H.; Yazilitas, D.; Akinci, M.B.; Aksoy, S.; Zengi, N. Efficacy and Safety of First Line Vincristine with Doxorubicin, Bleomycin and Dacarbazine (ABOD) for Hodgkin’s Lymphoma: A Single Institute Experience. Asian Pac. J. Cancer Prev. 2014, 15, 8715–8718. [Google Scholar] [CrossRef] [Green Version]
- Boyle, F.M.; Eller, S.L.; Grossman, S.A. Penetration of intra-arterially administered vincristine in experimental brain tumor. Neuro-Oncology 2004, 6, 300–306. [Google Scholar] [CrossRef] [Green Version]
- Mofazzal, J.M.; Al-Musawi, S.; Pirestani, M.; Fasihi Ramandi, M.; Ahmadi, K.; Rajayi, H.; Mohammad Hassan, Z.; Kamali, M.; Mirnejad, R. Curcumin-loaded Chitosan Tripolyphosphate Nanoparticles as a safe, natural and effective antibiotic inhibits the infection of Staphylococcus aureus and Pseudomonas aeruginosa in vivo. Iran J. Biotechnol. 2014, 12, e1012. [Google Scholar]
- Al-Musawi, S.; Albukhaty, S.; Al-Karagoly, H.; Sulaiman, G.M.; Alwahibi, M.S.; Dewir, Y.H.; Soliman, D.A.; Rizwana, H. Antibacterial Activity of Honey/Chitosan Nanofibers Loaded with Capsaicin and Gold Nanoparticles for Wound Dressing. Molecules 2020, 25, 4770. [Google Scholar] [CrossRef]
- Tran, S.; DeGiovanni, P.-J.; Piel, B.; Rai, P. Cancer nanomedicine: A review of recent success in drug delivery. Clin. Transl. Med. 2017, 6, 44. [Google Scholar] [CrossRef] [Green Version]
- Al-Kinani, M.A.; Haider, A.J.; Al-Musawi, S. High Uniformity Distribution of Fe@ Au Preparation by a Micro-Emulsion Method. IOP Conf. Ser. Mater. Sci. Eng. 2020, 012013. [Google Scholar] [CrossRef]
- Laurent, S.; Saei, A.A.; Behzadi, S.; Panahifar, A.; Mahmoudi, M. Superparamagnetic iron oxide nanoparticles for delivery of therapeutic agents: Opportunities and challenges. Expert Opin. Drug Deliv. 2014, 11, 1449–1470. [Google Scholar] [CrossRef]
- Al-Musawi, S.; Kadhim, M.J.; Hindi, N.K.K. Folated-nanocarrier for paclitaxel drug delivery in leukemia cancer therapy. J. Pharm. Sci. Res. 2018, 10, 749–754. [Google Scholar]
- Albukhaty, S.; Naderi-Manesh, H.; Tiraihi, T.; Sakhi Jabir, M. Poly-l-lysine-coated superparamagnetic nanoparticles: A novel method for the transfection of pro-BDNF into neural stem cells. Artif. Cells Nanomed. Biotechnol. 2018, 46 (Suppl. S3), S125–S132. [Google Scholar] [CrossRef] [Green Version]
- Al-Musawi, S.; Albukhaty, S.; Al-Karagoly, H.; Sulaiman, G.M.; Jabir, M.S.; Naderi-Manesh, H. Dextran-coated superparamagnetic nanoparticles modified with folate for targeted drug delivery of camptothecin. Adv. Nat. Sci. Nanosci. Nanotechnol. 2020, 11, 045009. [Google Scholar] [CrossRef]
- Kumar, N.; Salar, R.K.; Prasad, M.; Ranjanc, K. Synthesis, characterization and anticancer activity of vincristine loaded folic acid-chitosan conjugated nanoparticles on NCI-H460 non-small cell lung cancer cell line. Egypt. J. Basic Appl. Sci. 2018, 5, 87–99. [Google Scholar] [CrossRef]
- Al-Musawi, S.; Hadi, A.J.; Hadi, S.J.; Hindi, N.K.K. Preparation and Characterization of Folated Chitosan/Magnetic Nanocarrier for 5-Fluorouracil Drug Delivery and Studying its Effect in Bladder Cancer Therapy. J. Glob. Pharm. Technol. 2019, 11, 628–637. [Google Scholar]
- Al-Kinani, M.A.; Haider, A.J.; Al-Musawi, S. Design, Construction and Characterization of Intelligence Polymer Coated Core–Shell Nanocarrier for Curcumin Drug Encapsulation and Delivery in Lung Cancer Therapy Purposes. J. Inorg. Organomet. Polym. Mater. 2020, 31, 1–10. [Google Scholar] [CrossRef]
- Ma’mani, L.; Nikzad, S.; Kheiri-Manjili, H.; Al-Musawi, S.; Saeedi, M.; Askarlou, S.; Foroumadi, A.; Shafiee, A. Curcumin-loaded guanidine functionalized PEGylated I3ad mesoporous silica nanoparticles KIT-6: Practical strategy for the breast cancer therapy. Eur. J. Med. Chem. 2014, 83, 646–654. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Zhao, H.; Yao, J.; Zhu, Z.; Sun, D.; Zhang, M. A doxorubicin and vincristine drug release system based on magnetic PLGA microspheres prepared by coaxial electrospray. J. Mater. Sci. 2019, 54, 9689–9706. [Google Scholar] [CrossRef]
- Zhu, Y.; Yang, L.; Huang, D.; Zhu, Q. Molecularly imprinted nanoparticles and their releasing properties, bio-distribution as drug carriers. Asian J. Pharm. Sci. 2017, 12, 172–178. [Google Scholar] [CrossRef]
- Pinelli, F.; Perale, G.; Rossi, F. Coating and functionalization strategies for nanogels and nanoparticles for selective drug delivery. GELS 2020, 6, 6. [Google Scholar] [CrossRef] [Green Version]
- Al-Awady, M.J.; Balakit, A.A.; Al-Musawi, S.; Alsultani, M.J.; Kamil, A.; Alabbasi, M. Investigation of Anti-MRSA and Anticancer Activity of Eco-Friendly Synthesized Silver Nanoparticles from Palm Dates Extract. Nano Biomed. Eng. 2019, 11, 157–169. [Google Scholar] [CrossRef]
- Albukhaty, S.; Al-Musawi, S.; Abdul Mahdi, S.; Sulaiman, G.M.; Alwahibi, M.S.; Dewir, Y.H.; Soliman, D.A.; Rizwana, H. Investigation of Dextran-Coated Superparamagnetic Nanoparticles for Targeted Vinblastine Controlled Release, Delivery, Apoptosis Induction, and Gene Expression in Pancreatic Cancer Cells. Molecules 2020, 25, 4721. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, H.; Okamoto-Katsuyama, M.; Suwa, T.; Maeda, R.; Tamura, T.-A.; Yamaguchi, Y. TLP-mediated global transcriptional repression after double-strand DNA breaks slows down DNA repair and induces apoptosis. Sci. Rep. 2019, 9, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Seo, Y.-H.; Joo, Y.-E.; Choi, S.-K.; Rew, J.-S.; Park, C.-S.; Kim, S.-J. Prognostic significance of p21 and p53 expression in gastric cancer. Korean J. Intern. Med. 2003, 18, 98. [Google Scholar] [CrossRef]
- Wang, X.; Gao, P.; Long, M.; Lin, F.; Wei, J.-X.; Ren, J.-H.; Yan, L.; He, T.; Han, Y.; Zhang, H.-Z. Essential role of cell cycle regulatory genes p21 and p27 expression in inhibition of breast cancer cells by arsenic trioxide. Med. Oncol. 2011, 28, 1225–1254. [Google Scholar] [CrossRef]
- Banerji, U.; Dean, E.J.; Pérez-Fidalgo, J.A.; Batist, G.; Bedard, P.L.; You, B.; Westin, S.N.; Kabos, P.; Garrett, M.D.; Tall, M. A phase I open-label study to identify a dosing regimen of the Pan-AKT inhibitor AZD5363 for evaluation in solid tumors and in PIK3CA-mutated breast and gynecologic cancers. Clin. Cancer Res. 2018, 24, 2050–2059. [Google Scholar] [CrossRef] [Green Version]
- Tian, X.; Li, Y.; Shen, Y.; Li, Q.; Wang, Q.; Feng, L. Apoptosis and inhibition of proliferation of cancer cells induced by cordycepin. Oncol. Lett. 2015, 10, 595–599. [Google Scholar] [CrossRef] [Green Version]
- Al-Musawi, S.; Albukhaty, S.; Al-Karagoly, H.; Almalki, F. Design, and Synthesis of Multi-Functional Superparamagnetic Core-Gold Shell Coated with Chitosan and Folate Nanoparticles for Targeted Antitumor Therapy. Nanomaterials 2020, 11, 1. [Google Scholar] [CrossRef]
Primer Name | Forward Primer (5′ 3′) | Reverse Primer (5′ 3′) | References |
---|---|---|---|
β-actin | CTGGCACCCAGCACAATG | GCCGATCCACACGGAGTACT | [17] |
P53 | AGGTGACACTATAGAATA | GGGATATCACTCAGCATG | [18] |
P-21 | AGGTGACACTATAGAATA | GGGATATCACTCAGCATG | [19] |
Caspase-9 | ACTTTCCCAGGTTTTGTTTCCT | GAAATTAAAGCAACCAGGCATC | [20] |
Akt-1 | AGGTGACACTATAGAATA | GTACGACTCACTATAGGG | [21] |
Step | Temperature | Time | Cycles |
---|---|---|---|
Initial denaturation | 95 °C | 10 min | 1 |
Denaturation | 95 °C | 15 s | 48 |
Annealing | 60 °C | 1 min | |
Melting curve analysis | 95 °C | 5 s/step | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Musawi, S.; Ibraheem, S.; Abdul Mahdi, S.; Albukhaty, S.; Haider, A.J.; Kadhim, A.A.; Kadhim, K.A.; Kadhim, H.A.; Al-Karagoly, H. Smart Nanoformulation Based on Polymeric Magnetic Nanoparticles and Vincristine Drug: A Novel Therapy for Apoptotic Gene Expression in Tumors. Life 2021, 11, 71. https://doi.org/10.3390/life11010071
Al-Musawi S, Ibraheem S, Abdul Mahdi S, Albukhaty S, Haider AJ, Kadhim AA, Kadhim KA, Kadhim HA, Al-Karagoly H. Smart Nanoformulation Based on Polymeric Magnetic Nanoparticles and Vincristine Drug: A Novel Therapy for Apoptotic Gene Expression in Tumors. Life. 2021; 11(1):71. https://doi.org/10.3390/life11010071
Chicago/Turabian StyleAl-Musawi, Sharafaldin, Sumayah Ibraheem, Salih Abdul Mahdi, Salim Albukhaty, Adawiya J. Haider, Afraa Ali Kadhim, Kadhim Ali Kadhim, Haitham Ali Kadhim, and Hassan Al-Karagoly. 2021. "Smart Nanoformulation Based on Polymeric Magnetic Nanoparticles and Vincristine Drug: A Novel Therapy for Apoptotic Gene Expression in Tumors" Life 11, no. 1: 71. https://doi.org/10.3390/life11010071
APA StyleAl-Musawi, S., Ibraheem, S., Abdul Mahdi, S., Albukhaty, S., Haider, A. J., Kadhim, A. A., Kadhim, K. A., Kadhim, H. A., & Al-Karagoly, H. (2021). Smart Nanoformulation Based on Polymeric Magnetic Nanoparticles and Vincristine Drug: A Novel Therapy for Apoptotic Gene Expression in Tumors. Life, 11(1), 71. https://doi.org/10.3390/life11010071