Assessment of Thermal Stability of Mutant p53 Proteins via Differential Scanning Fluorimetry
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Site-Directed Mutagenesis
2.3. Recombinant Production and Purification of p53
2.4. Differential Scanning Fluorimetry (DSF)
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
DBD | DNA-binding domain |
DSF | Differential scanning fluorimetry |
MDM2 | Mouse double minute 2 homolog |
MDM4 | Mouse double minute 4 homolog |
NGC | Next-generation chromatography |
PCR | Polymerase chain reaction |
SDS | Sodium dodecyl sulfate |
TB | Terrific broth |
Tm | Melting temperature |
WT | Wild type |
References
- Hassin, O.; Oren, M. Drugging P53 in Cancer: One Protein, Many Targets. Nat. Rev. Drug Discov. 2022, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Soussi, T.; Wiman, K.G. TP53: An Oncogene in Disguise. Cell Death Differ. 2015, 22, 1239–1249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bykov, V.J.N.; Eriksson, S.E.; Bianchi, J.; Wiman, K.G. Targeting Mutant P53 for Efficient Cancer Therapy. Nat. Rev. Cancer 2018, 18, 89–102. [Google Scholar] [CrossRef]
- Cho, Y.; Gorina, S.; Jeffrey, P.D.; Pavletich, N.P. Crystal structure of a p53 tumor suppressor-DNA complex: Understanding tumorigenic mutations. Science 1994, 265, 346–355. [Google Scholar] [CrossRef] [PubMed]
- Joerger, A.C.; Fersht, A.R. The P53 Pathway: Origins, Inactivation in Cancer, and Emerging Therapeutic Approaches. Annu. Rev. Biochem. 2016, 85, 375–404. [Google Scholar] [CrossRef] [PubMed]
- Bouaoun, L.; Sonkin, D.; Ardin, M.; Hollstein, M.; Byrnes, G.; Zavadil, J.; Olivier, M. TP53 Variations in Human Cancers: New Lessons from the IARC TP53 Database and Genomics Data. Hum. Mutat. 2016, 37, 865–876. [Google Scholar] [CrossRef] [PubMed]
- Chasov, V.; Mirgayazova, R.; Zmievskaya, E.; Khadiullina, R.; Valiullina, A.; Clarke, J.S.; Rizvanov, A.; Baud, M.G.J.; Bulatov, E. Key Players in the Mutant P53 Team: Small Molecules, Gene Editing, Immunotherapy. Front. Oncol. 2020, 10, 1460. [Google Scholar] [CrossRef]
- Tang, Y.; Yao, Y.; Wei, G. Unraveling the Allosteric Mechanism of Four Cancer-Related Mutations in the Disruption of P53-DNA Interaction. J. Phys. Chem. B 2021, 125, 10138–10148. [Google Scholar] [CrossRef]
- Bullock, A.N.; Henckel, J.; Fersht, A.R. Quantitative Analysis of Residual Folding and DNA Binding in Mutant P53 Core Domain: Definition of Mutant States for Rescue in Cancer Therapy. Oncogene 2000, 19, 1245–1256. [Google Scholar] [CrossRef] [Green Version]
- Joerger, A.C.; Fersht, A.R. Structural Biology of the Tumor Suppressor P53 and Cancer-Associated Mutants. Adv. Cancer Res. 2007, 97, 1–23. [Google Scholar] [CrossRef]
- Joerger, A.C.; Fersht, A.R. Structural Biology of the Tumor Suppressor P53. Annu. Rev. Biochem. 2008, 77, 557–582. [Google Scholar] [CrossRef] [PubMed]
- Bauer, M.R.; Krämer, A.; Settanni, G.; Jones, R.N.; Ni, X.; Tareque, R.K.; Fersht, A.R.; Spencer, J.; Joerger, A.C. Targeting Cavity-Creating P53 Cancer Mutations with Small-Molecule Stabilizers: The Y220X Paradigm. ACS Chem. Biol. 2020, 15, 657–668. [Google Scholar] [CrossRef]
- Clarke, J.R.S.; Douglas, L.R.; Duriez, P.J.; Balourdas, D.-I.; Joerger, A.C.; Khadiullina, R.; Bulatov, E.; Baud, M.G.J. Discovery of Nanomolar-Affinity Pharmacological Chaperones Stabilizing the Oncogenic P53 Mutant Y220C. ACS Pharmacol. Transl. Sci. 2022, 5, 1169–1180. [Google Scholar] [CrossRef] [PubMed]
- Friedler, A.; Veprintsev, D.B.; Hansson, L.O.; Fersht, A.R. Kinetic Instability of P53 Core Domain Mutants: Implications for Rescue by Small Molecules. J. Biol. Chem. 2003, 278, 24108–24112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vivoli, M.; Novak, H.R.; Littlechild, J.A.; Harmer, N.J. Determination of Protein-Ligand Interactions Using Differential Scanning Fluorimetry. J. Vis. Exp. 2014, 91, 51809. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.; Wu, J.-L.; Liang, Y.; Tang, Y.-G.; Song, H.-X.; Wu, L.-L.; Xing, Y.-F.; Yan, N.; Li, Y.-T.; Wang, Z.-Y.; et al. Arsenic Trioxide Rescues Structural P53 Mutations through a Cryptic Allosteric Site. Cancer Cell 2021, 39, 225–239. [Google Scholar] [CrossRef]
- Hamiaux, C.; Janssen, B.J.; Snowden, K.C. The Use of Differential Scanning Fluorimetry to Assess Strigolactone Receptor Function. In Strigolactones; Humana: New York, NY, USA, 2021; pp. 233–243. [Google Scholar] [CrossRef]
- Niesen, F.H.; Berglund, H.; Vedadi, M. The Use of Differential Scanning Fluorimetry to Detect Ligand Interactions That Promote Protein Stability. Nat. Protoc. 2007, 2, 2212–2221. [Google Scholar] [CrossRef]
- Wu, J.; Song, H.; Wang, Z.; Lu, M. Three Optimized Assays for the Evaluation of Compounds That Can Rescue P53 Mutants. STAR Protoc. 2021, 2, 100688. [Google Scholar] [CrossRef]
- Ang, H.C.; Joerger, A.C.; Mayer, S.; Fersht, A.R. Effects of Common Cancer Mutations on Stability and DNA Binding of Full-Length P53 Compared with Isolated Core Domains. J. Biol. Chem. 2006, 281, 21934–21941. [Google Scholar] [CrossRef]
- Bullock, A.N.; Henckel, J.; DeDecker, B.S.; Johnson, C.M.; Nikolova, P.V.; Proctor, M.R.; Lane, D.P.; Fersht, A.R. Thermodynamic Stability of Wild-Type and Mutant P53 Core Domain. Proc. Natl. Acad. Sci. USA 1997, 94, 14338–14342. [Google Scholar] [CrossRef] [Green Version]
- Lemos, C.; Schulze, L.; Weiske, J.; Meyer, H.; Braeuer, N.; Barak, N.; Eberspächer, U.; Werbeck, N.; Stresemann, C.; Lange, M.; et al. Identification of Small Molecules That Modulate Mutant P53 Condensation. iScience 2020, 23, 101517. [Google Scholar] [CrossRef]
- Luwang, J.W.; Nair, A.R.; Natesh, R. Stability of P53 Oligomers: Tetramerization of P53 Impinges on Its Stability. Biochimie 2021, 189, 99–107. [Google Scholar] [CrossRef] [PubMed]
- Babikir, H.A.; Afjei, R.; Paulmurugan, R.; Massoud, T.F. Restoring Guardianship of the Genome: Anticancer Drug Strategies to Reverse Oncogenic Mutant P53 Misfolding. Cancer Treat. Rev. 2018, 71, 19–31. [Google Scholar] [CrossRef] [PubMed]
- Wilcken, R.; Wang, G.; Boeckler, F.M.; Fersht, A.R. Kinetic Mechanism of P53 Oncogenic Mutant Aggregation and Its Inhibition. Proc. Natl. Acad. Sci. USA 2012, 109, 13584–13589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Q.; Bykov, V.J.N.; Wiman, K.G.; Zawacka-Pankau, J. APR-246 Reactivates Mutant P53 by Targeting Cysteines 124 and 277. bioRxiv 2017, 214049. [Google Scholar] [CrossRef] [Green Version]
- Bauer, M.R.; Jones, R.N.; Tareque, R.K.; Springett, B.; Dingler, F.A.; Verduci, L.; Patel, K.J.; Fersht, A.R.; Joerger, A.C.; Spencer, J. A Structure-Guided Molecular Chaperone Approach for Restoring the Transcriptional Activity of the P53 Cancer Mutant Y220C. Future Med. Chem. 2019, 11, 2491–2504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garg, A.; Hazra, J.P.; Sannigrahi, M.K.; Rakshit, S.; Sinha, S. Variable Mutations at the P53-R273 Oncogenic Hotspot Position Leads to Altered Properties. Biophys. J. 2020, 118, 720–728. [Google Scholar] [CrossRef]
- Palanikumar, L.; Karpauskaite, L.; Al-Sayegh, M.; Chehade, I.; Alam, M.; Hassan, S.; Maity, D.; Ali, L.; Kalmouni, M.; Hunashal, Y.; et al. Protein Mimetic Amyloid Inhibitor Potently Abrogates Cancer-Associated Mutant P53 Aggregation and Restores Tumor Suppressor Function. Nat. Commun. 2021, 12, 3962. [Google Scholar] [CrossRef]
- Joerger, A.C.; Ang, H.C.; Veprintsev, D.B.; Blair, C.M.; Fersht, A.R. Structures of P53 Cancer Mutants and Mechanism of Rescue by Second-Site Suppressor Mutations. J. Biol. Chem. 2005, 280, 16030–16037. [Google Scholar] [CrossRef]
- Joerger, A.C.; Fersht, A.R. The Tumor Suppressor P53: From Structures to Drug Discovery. Cold Spring Harb. Perspect. Biol. 2010, 2, a000919. [Google Scholar] [CrossRef] [Green Version]
- Wiman, K.G. Pharmacological Reactivation of Mutant P53: From Protein Structure to the Cancer Patient. Oncogene 2010, 29, 4245–4252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, X.; Wilcken, R.; Joerger, A.; Chuckowree, I.; Spencer, J.; Fersht, A. Abstract 2472: Small-Molecule-Induced Reactivation of Mutant P53 in Cancer Cells. Nucleic Acids Res. 2013, 73, 2472. [Google Scholar] [CrossRef]
Mutant | Primer Sequences | Amino Acid Change: wt → Mutant |
---|---|---|
R248W | Rev: GTTCATGCCGCCCATGCAGGAACTGTAACACATGTAGTTGTAGTGGATGGT For: CCTGCATGGGCGGCATGAACtGGAGGCCCATCCTCACCATCATC | CGG (R) → TGG (W) |
R248Q | Rev: GTTCATGCCGCCCATGCAGGAACTGTAACACATGTAGTTGTAGTGGATGGT For: CTGCATGGGCGGCATGAACCaGAGGCCCATCCTCACCATCATC | CGG (R) → CAG (Q) |
R273H | Rev: GCACCTCAAAGCTGTCCCGTCCCAGTAGATTACCACTGGAGTCTTCC For: ACGGGACAGCTTTGAGGTGCaTGTTTGTGCCTGTCCTGGGAGA | CGT (R) → CAT (H) |
Protein | Structural Region | Tm, °C | ΔTm, °C * |
---|---|---|---|
p53 (wild-type) | - | 42.9 ± 0.0 | - |
p53(Y220C) | β-sandwich | 40.3 ± 0.2 | −2.6 |
p53(R248Q) | DNA contact | 38.5 ± 0.3 | −4.4 |
p53(R248W) | DNA contact | 39.3 ± 0.0 | −3.6 |
p53(R273H) | DNA contact | 38.8 ± 0.3 | −4.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khadiullina, R.; Mirgayazova, R.; Davletshin, D.; Khusainova, E.; Chasov, V.; Bulatov, E. Assessment of Thermal Stability of Mutant p53 Proteins via Differential Scanning Fluorimetry. Life 2023, 13, 31. https://doi.org/10.3390/life13010031
Khadiullina R, Mirgayazova R, Davletshin D, Khusainova E, Chasov V, Bulatov E. Assessment of Thermal Stability of Mutant p53 Proteins via Differential Scanning Fluorimetry. Life. 2023; 13(1):31. https://doi.org/10.3390/life13010031
Chicago/Turabian StyleKhadiullina, Raniya, Regina Mirgayazova, Damir Davletshin, Elvina Khusainova, Vitaly Chasov, and Emil Bulatov. 2023. "Assessment of Thermal Stability of Mutant p53 Proteins via Differential Scanning Fluorimetry" Life 13, no. 1: 31. https://doi.org/10.3390/life13010031