Development of a Detection System for ESR1 Mutations in Circulating Tumour DNA Using PNA-LNA-Mediated PCR Clamping
Abstract
:1. Introduction
2. Materials and Methods
2.1. Design for the Detection of ESR1 Mutations
2.2. Plasmids
2.3. PNA-LNA PCR Clamp Assay
2.4. Clinical Samples
2.5. Clinical Sample Collection and Cell-Free DNA/TNA Extraction
2.6. Targeted NGS
3. Results
3.1. PNA-LNA PCR Clamp Reaction for the Detection of ESR1 Mutations
3.2. Developmental Cohort
3.3. Prospective Validation Cohort
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Clark, G.M.; Osborne, C.K.; McGuire, W.L. Correlations between estrogen receptor, progesterone receptor, and patient characteristics in human breast cancer. J. Clin. Oncol. 1984, 2, 1102–1109. [Google Scholar] [CrossRef] [PubMed]
- Rugo, H.S.; Rumble, R.B.; Macrae, E.; Barton, D.L.; Connolly, H.K.; Dickler, M.N.; Fallowfield, L.; Fowble, B.; Ingle, J.N.; Jahanzeb, M.; et al. Endocrine therapy for hormone receptor-positive metastatic breast cancer: American Society of Clinical Oncology Guideline. J. Clin. Oncol. 2016, 34, 3069–3103. [Google Scholar] [CrossRef] [Green Version]
- Najim, O.; Seghers, S.; Sergoynne, L.; Van Gaver, H.; Papadimitriou, K.; Wouters, K.; Trinh, X.B.; Huizing, M.T.; Tjalma, W. The association between type of endocrine therapy and development of estrogen receptor-1 mutation(s) in patients with hormone-sensitive advanced breast cancer: A systematic review and meta-analysis of randomized and non-randomized trials. Biochim. Biophys. Acta Rev. Cancer 2019, 1872, 188315. [Google Scholar] [CrossRef] [PubMed]
- Jeselsohn, R.; Yelensky, R.; Buchwalter, G.; Frampton, G.; Meric-Bernstam, F.; Gonzalez-Angulo, A.M.; Ferrer-Lozano, J.; Perez-Fidalgo, J.A.; Cristofanilli, M.; Gómez, H.; et al. Emergence of constitutively active estrogen receptor- α mutations in pretreated advanced estrogen receptor-positive breast cancer. Clin. Cancer Res. 2014, 20, 1757–1767. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toy, W.; Shen, Y.; Won, H.; Green, B.; Sakr, R.A.; Will, M.; Li, Z.; Gala, K.; Fanning, S.; King, T.A.; et al. ESR1 ligand-binding domain mutations in hormone-resistant breast cancer. Nat. Genet. 2013, 45, 1439–1445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haber, D.A.; Velculescu, V.E. Blood-based analyses of cancer: Circulating tumor cells and circulating tumor DNA. Cancer Discov. 2014, 4, 650–661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fribbens, C.; O’Leary, B.; Kilburn, L.; Hrebien, S.; Garcia-Murillas, I.; Beaney, M.; Cristofanilli, M.; Andre, F.; Loi, S.; Loibl, S.; et al. Plasma ESR1 mutations and the treatment of estrogen receptor-positive advanced breast cancer. J. Clin. Oncol. 2016, 34, 2961–2968. [Google Scholar] [CrossRef]
- Schiavon, G.; Hrebien, S.; Garcia-Murillas, I.; Cutts, R.J.; Pearson, A.; Tarazona, N.; Fenwick, K.; Kozarewa, I.; Lopez-Knowles, E.; Ribas, R.; et al. Analysis of ESR1 mutation in circulating tumor DNA demonstrates evolution during therapy for metastatic breast cancer. Sci. Transl. Med. 2015, 7, 313ra182. [Google Scholar] [CrossRef] [Green Version]
- Guttery, D.S.; Page, K.; Hills, A.; Woodley, L.; Marchese, S.D.; Rghebi, B.; Hastings, R.K.; Luo, J.; Pringle, J.H.; Stebbing, J.; et al. Noninvasive detection of activating estrogen receptor 1 (ESR1) mutations in estrogen receptor-positive metastatic breast cancer. Clin. Chem. 2015, 61, 974–982. [Google Scholar] [CrossRef] [Green Version]
- Chu, D.; Paoletti, C.; Gersch, C.; VanDenBerg, D.A.; Zabransky, D.J.; Cochran, R.L.; Wong, H.Y.; Toro, P.V.; Cidado, J.; Croessmann, S.; et al. ESR1 mutations in circulating plasma tumor dna from metastatic breast cancer patients. Clin. Cancer Res. 2016, 22, 993–999. [Google Scholar] [CrossRef] [Green Version]
- Wang, P.; Bahreini, A.; Gyanchandani, R.; Lucas, P.C.; Hartmaier, R.J.; Watters, R.J.; Jonnalagadda, A.R.; Bittar, H.E.T.; Berg, A.; Hamilton, R.L.; et al. Sensitive detection of mono- and polyclonal ESR1 mutations in primary tumors, metastatic lesions, and cell-free DNA of breast cancer patients. Clin. Cancer Res. 2016, 22, 1130–1137. [Google Scholar] [CrossRef] [Green Version]
- Weis, K.E.; Ekena, K.; Thomas, J.A.; Lazennec, G.; Katzenellenbogen, B.S. Constitutively active human estrogen receptors containing amino acid substitutions for tyrosine 537 in the receptor protein. Mol. Endocrinol. 1996, 10, 1388–1398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Q.X.; Borg, A.; Wolf, D.M.; Oesterreich, S.; Fuqua, S.A. An estrogen receptor mutant with strong hormone-independent activity from a metastatic breast cancer. Cancer Res. 1997, 57, 1244–1249. [Google Scholar]
- Merenbakh-Lamin, K.; Ben-Baruch, N.; Yeheskel, A.; Dvir, A.; Soussan-Gutman, L.; Jeselsohn, R.; Yelensky, R.; Brown, M.; Miller, V.A.; Sarid, D.; et al. D538G mutation in estrogen receptor-α: A novel mechanism for acquired endocrine resistance in breast cancer. Cancer Res. 2013, 73, 6856–6864. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Robinson, D.R.; Wu, Y.M.; Vats, P.; Su, F.; Lonigro, R.J.; Cao, X.; Kalyana-Sundaram, S.; Wang, R.; Ning, Y.; Hodges, L.; et al. Activating ESR1 mutations in hormone-resistant metastatic breast cancer. Nat. Genet. 2013, 45, 1446–1451. [Google Scholar] [CrossRef] [Green Version]
- Takeshita, T.; Yamamoto, Y.; Yamamoto-Ibusuki, M.; Inao, T.; Sueta, A.; Fujiwara, S.; Omoto, Y.; Iwase, H. Droplet digital polymerase chain reaction assay for screening of ESR1 mutations in 325 breast cancer specimens. Transl. Res. 2015, 166, 540–553. [Google Scholar] [CrossRef]
- Chandarlapaty, S.; Chen, D.; He, W.; Sung, P.; Samoila, A.; You, D.; Bhatt, T.; Patel, P.; Voi, M.; Gnant, M.; et al. Prevalence of ESR1 mutations in cell-free DNA and outcomes in metastatic breast cancer: A secondary analysis of the BOLERO-2 clinical trial. JAMA Oncol. 2016, 2, 1310–1315. [Google Scholar] [CrossRef] [Green Version]
- Jeannot, E.; Darrigues, L.; Michel, M.; Stern, M.H.; Pierga, J.Y.; Rampanou, A.; Melaabi, S.; Benoist, C.; Bièche, I.; Vincent-Salomon, A.; et al. A single droplet digital PCR for ESR1 activating mutations detection in plasma. Oncogene 2020, 39, 2987–2995. [Google Scholar] [CrossRef]
- Giesen, U.; Kleider, W.; Berding, C.; Geiger, A.; Orum, H.; Nielsen, P.E. A formula for thermal stability (Tm) prediction of PNA/DNA duplexes. Nucleic Acids Res. 1998, 26, 5004–5006. [Google Scholar] [CrossRef] [PubMed]
- Miyazawa, H.; Tanaka, T.; Nagai, Y.; Matsuoka, M.; Huqun; Sutani, A.; Udagawa, K.; Zhang, J.; Hirama, T.; Murayama, Y.; et al. Peptide nucleic acid-locked nucleic acid polymerase chain reaction clamp-based detection test for gefitinib-refractory T790M epidermal growth factor receptor mutation. Cancer Sci. 2008, 99, 595–600. [Google Scholar] [CrossRef]
- Nagai, Y.; Miyazawa, H.; Huqun; Tanaka, T.; Udagawa, K.; Kato, M.; Fukuyama, S.; Yokote, A.; Kobayashi, K.; Kanazawa, M.; et al. Genetic heterogeneity of the epidermal growth factor receptor in non-small cell lung cancer cell lines revealed by a rapid and sensitive detection system, the peptide nucleic acid-locked nucleic acid PCR clamp. Cancer Res. 2005, 65, 7276–7282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, H.R.; Lee, S.Y.; Hyun, D.S.; Lee, M.K.; Lee, H.K.; Choi, C.M.; Yang, S.H.; Kim, Y.C.; Lee, Y.C.; Kim, S.Y.; et al. Detection of EGFR mutations in circulating free DNA by PNA-mediated PCR clamping. J. Exp. Clin. Cancer Res. 2013, 32, 50–58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Itonaga, M.; Matsuzaki, I.; Warigaya, K.; Tamura, T.; Shimizu, Y.; Fujimoto, M.; Kojima, F.; Ichinose, M.; Murata, S. Novel methodology for rapid detection of KRAS mutation using PNA-LNA mediated loop-mediated isothermal amplification. PLoS ONE 2016, 11, e0151654. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Spoerke, J.M.; Gendreau, S.; Walter, K.; Qiu, J.; Wilson, T.R.; Savage, H.; Aimi, J.; Derynck, M.K.; Chen, M.; Chan, I.T.; et al. Heterogeneity and clinical significance of ESR1 mutations in ER-positive metastatic breast cancer patients receiving fulvestrant. Nat. Commun. 2016, 7, 11579. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shaw, J.A.; Guttery, D.S.; Hills, A.; Fernandez-Garcia, D.; Page, K.; Rosales, B.M.; Goddard, K.S.; Hastings, R.K.; Luo, J.; Ogle, O.; et al. Mutation analysis of cell-free DNA and single circulating tumor cells in metastatic breast cancer patients with high circulating tumor cell counts. Clin. Cancer Res. 2017, 23, 88–96. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- World Medical Association. World Medical Association Declaration of Helsinki: Ethical principles for medical research involving human subjects. JAMA 2013, 310, 2191–2194. [Google Scholar] [CrossRef] [Green Version]
- Dustin, D.; Gu, G.; Fuqua, S.A.W. ESR1 mutations in breast cancer. Cancer 2019, 125, 3714–3728. [Google Scholar] [CrossRef]
- Gelsomino, L.; Gu, G.; Rechoum, Y.; Beyer, A.R.; Pejerrey, S.M.; Tsimelzon, A.; Wang, T.; Huffman, K.; Ludlow, A.; Andò, S.; et al. ESR1 mutations affect anti-proliferative responses to tamoxifen through enhanced cross-talk with IGF signaling. Breast Cancer Res. Treat. 2016, 157, 253–265. [Google Scholar] [CrossRef] [Green Version]
- Toy, W.; Weir, H.; Razavi, P.; Lawson, M.; Goeppert, A.U.; Mazzola, A.M.; Smith, A.; Wilson, J.; Morrow, C.; Wong, W.L.; et al. Activating ESR1 mutations differentially affect the efficacy of ER antagonists. Cancer Discov. 2017, 7, 277–287. [Google Scholar] [CrossRef] [Green Version]
- Klouch, K.Z.; Stern, M.H.; Trabelsi-Grati, O.; Kiavue, N.; Cabel, L.; Silveira, A.B.; Hego, C.; Rampanou, A.; Popova, T.; Bataillon, G.; et al. Microsatellite instability detection in breast cancer using drop-off droplet digital PCR. Oncogene 2022, 41, 5289–5297. [Google Scholar] [CrossRef]
- Schluckebier, L.; Caetano, R.; Garay, O.U.; Montenegro, G.T.; Custodio, M.; Aran, V.; Gil Ferreira, C. Cost-effectiveness analysis comparing companion diagnostic tests for EGFR, ALK, and ROS1 versus next-generation sequencing (NGS) in advanced adenocarcinoma lung cancer patients. BMC Cancer 2020, 20, 875. [Google Scholar] [CrossRef] [PubMed]
- Bidard, F.C.; Kaklamani, V.G.; Neven, P.; Streich, G.; Montero, A.J.; Forget, F.; Mouret-Reynier, M.A.; Sohn, J.H.; Taylor, D.; Harnden, K.K. Elacestrant (oral selective estrogen receptor degrader) versus standard endocrine therapy for estrogen receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer: Results from the randomized phase III EMERALD trial. J. Clin. Oncol. 2022, 40, 3246–3256. [Google Scholar] [CrossRef] [PubMed]
- O’Leary, B.; Hrebien, S.; Morden, J.P.; Beaney, M.; Fribbens, C.; Huang, X.; Liu, Y.; Bartlett, C.H.; Koehler, M.; Cristofanilli, M.; et al. Early circulating tumor DNA dynamics and clonal selection with palbociclib and fulvestrant for breast cancer. Nat. Commun. 2018, 9, 896. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primer | Oligo Sequence, 5′ to >3′ |
---|---|
Evaluation of number of ESR1 gene copies | |
ESR1-S-F | 5′-CAGTAACAAAGGCATGGAGCA-3′ |
ESR1-S-R | 5′-CTAGTGGGCGCATGTAGGC-3′ |
ESR1-S-Total | 5′-Cy5/ACGTTCTTGCACTTCATGCTG/BHQ-3′ |
Reaction_E380Q | |
ESR1 E380Q-AS-F | 5′-AGTAGCTTCCCTGGGTGCTC-3′ |
ESR1 E380Q-AS-R | 5′-TGACCCTCCATGATCAGGTCC-3′ |
ESR1 E380Q-AS-Total | 5′-Cy5/CTGATGATTGGTCTCGTCTGGC/BHQ-3′ |
ESR1 E380Q-AS-LNA | 5′-FAM/AGGCACAT + T + G + TAGAAG/BHQ-3′ |
ESR1 E380Q-AS-PNA | 5′-GGCACATTCTAGAAGG-3′ |
Reaction_Y357S and D538G | |
ESR1-S-F | 5′-CAGTAACAAAGGCATGGAGCA-3′ |
ESR1-S-R | 5′-CTAGTGGGCGCATGTAGGC-3′ |
ESR1-S-Total | 5′-Cy5/ACGTTCTTGCACTTCATGCTG/BHQ-3′ |
ESR1 Y357S-S-LNA | 5′-FAM/CCCCTC + T+C + TGACCT/BHQ-3′ |
ESR1 D538G-S-LNA | 5′-HEX/CTCTAT + GG + CCTG + CTG/BHQ-3′ |
ESR1 S-PNA | 5′-GCCCCTCTATGACCTGC-3′ |
Sample | Cp Value | Cp Value | E380Q | ||
---|---|---|---|---|---|
PNA+ | PNA− | ⊿Cp | |||
#1 | N.D. | 35.12 | 26.44 | 8.68 | WT |
#2 | 34.57 | 33.66 | 28.46 | 5.20 | Detection |
#3 | N.D. | 33.97 | 24.37 | 9.60 | WT |
#4 | N.D. | 40.73 | 29.98 | 10.75 | WT |
#5 | 34.91 | 33.83 | 26.93 | 6.90 | Detection |
#6 | N.D. | 39.88 | 29.78 | 10.10 | WT |
Neg_#1 | N.D. | 37.18 | 28.44 | 8.74 | WT |
Neg_#2 | N.D. | 39.18 | 30.24 | 8.94 | WT |
Neg_#3 | N.D. | 39.16 | 29.98 | 9.18 | WT |
Neg_#4 | N.D. | 36.49 | 27.67 | 8.82 | WT |
Sample | Cp Value | Cp Value | Y537S | ||
---|---|---|---|---|---|
PNA+ | PNA− | ⊿Cp | |||
#1 | 31.92 | 31.91 | 25.83 | 6.08 | Detection |
#2 | N.D. | 31.33 | 27.85 | 3.48 | WT |
#3 | 29.47 | 29.01 | 23.76 | 5.25 | Detection |
#4 | 36.66 | 36.34 | 29.37 | 6.97 | Detection |
#5 | N.D. | 30.66 | 26.32 | 4.34 | WT |
#6 | N.D. | 38.28 | 29.17 | 9.11 | WT |
Neg_#1 | N.D. | 37.71 | 27.83 | 9.88 | WT |
Neg_#2 | N.D. | 41.64 | 29.63 | 12.01 | WT |
Neg_#3 | N.D. | 41.93 | 29.37 | 12.56 | WT |
Neg_#4 | N.D. | 38.32 | 27.06 | 11.26 | WT |
Sample | Cp Value | Cp Value | D538G | ||
---|---|---|---|---|---|
PNA+ | PNA− | ⊿Cp | |||
#1 | 32.87 | 31.91 | 25.83 | 6.08 | Detection |
#2 | 31.56 | 31.33 | 27.85 | 3.48 | Detection |
#3 | 29.84 | 29.01 | 23.76 | 5.25 | Detection |
#4 | 36.68 | 36.34 | 29.37 | 6.97 | Detection |
#5 | 30.85 | 30.66 | 26.32 | 4.34 | Detection |
#6 | N.D. | 38.28 | 29.17 | 9.11 | WT |
Neg_#1 | 37.92 | 37.71 | 27.83 | 9.88 | Detection |
Neg_#2 | N.D. | 41.64 | 29.63 | 12.01 | WT |
Neg_#3 | 43.26 | 41.93 | 29.37 | 12.56 | WT |
Neg_#4 | 39.19 | 38.32 | 27.06 | 11.26 | WT |
Sample | PNA-LNA PCR Clamp | NGS |
---|---|---|
#1 | E380Q and D538G | E380Q, L536Q and D538G |
#2 | WT | WT |
#3 | WT | WT |
#4 | WT | WT |
#5 | WT | WT |
#6 | WT | WT |
#7 | E380Q and L536H | E380Q and L536H |
#8 | WT | WT |
#9 | WT | WT |
#10 | WT | NE |
#11 | Y537S | WT |
#12 | WT | NE |
#13 | WT | NE |
#14 | WT | WT |
#15 | D538G | WT |
#16 | WT | WT |
#17 | Y537S | Y537S |
#18 | WT | WT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kojima, Y.; Noguchi, E.; Yoshino, T.; Yagishita, S.; Yazaki, S.; Okuma, H.S.; Nishikawa, T.; Tanioka, M.; Sudo, K.; Shimoi, T.; et al. Development of a Detection System for ESR1 Mutations in Circulating Tumour DNA Using PNA-LNA-Mediated PCR Clamping. Diagnostics 2023, 13, 2040. https://doi.org/10.3390/diagnostics13122040
Kojima Y, Noguchi E, Yoshino T, Yagishita S, Yazaki S, Okuma HS, Nishikawa T, Tanioka M, Sudo K, Shimoi T, et al. Development of a Detection System for ESR1 Mutations in Circulating Tumour DNA Using PNA-LNA-Mediated PCR Clamping. Diagnostics. 2023; 13(12):2040. https://doi.org/10.3390/diagnostics13122040
Chicago/Turabian StyleKojima, Yuki, Emi Noguchi, Tomomi Yoshino, Shigehiro Yagishita, Shu Yazaki, Hitomi S. Okuma, Tadaaki Nishikawa, Maki Tanioka, Kazuki Sudo, Tatsunori Shimoi, and et al. 2023. "Development of a Detection System for ESR1 Mutations in Circulating Tumour DNA Using PNA-LNA-Mediated PCR Clamping" Diagnostics 13, no. 12: 2040. https://doi.org/10.3390/diagnostics13122040
APA StyleKojima, Y., Noguchi, E., Yoshino, T., Yagishita, S., Yazaki, S., Okuma, H. S., Nishikawa, T., Tanioka, M., Sudo, K., Shimoi, T., Kazama, A., Terasaki, H., Asano, S., Fujiwara, Y., Hamada, A., Tamura, K., & Yonemori, K. (2023). Development of a Detection System for ESR1 Mutations in Circulating Tumour DNA Using PNA-LNA-Mediated PCR Clamping. Diagnostics, 13(12), 2040. https://doi.org/10.3390/diagnostics13122040