Recombinant TBEV Protein E of the Siberian Subtype Is a Candidate Antigen in the ELISA Test System for Differential Diagnosis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Animals
2.3. Production of Recombinant Proteins sE and dIII
2.4. Collection of Mouse and Rabbit Sera and Ascitic Fluid
2.5. Human Sera
2.6. ELISA
2.7. The 50% Plaque Reduction Neutralization Test (PRNT50)
3. Results
3.1. Efficacy of the ELISA Based on Recombinant TBEV Proteins
3.2. Detection Limit of the ELISA based on Recombinant TBEV Proteins
3.3. Specificity of the ELISA Based on Recombinant TBEV Proteins
3.4. Effect of the Vaccination against YFV on TBEV Antibody Detection
3.5. Cross-Reactivity of the Studied Protein Used in ELISA with WNV-Positive Sera
3.6. Specificity of the ELISA of the Hyperimmune Ascitic Fluids against Different Orthoflaviviruses and a Wide Range of TBEV Strains
3.7. Detection of Antibodies against a Wide Range of TBEV Strains from Mice with Natural Infection
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
References
- Zerbini, F.M.; Siddell, S.G.; Lefkowitz, E.J.; Mushegian, A.R.; Adriaenssens, E.M.; Alfenas-Zerbini, P.; Dempsey, D.M.; Dutilh, B.E.; García, M.L.; Hendrickson, R.C.; et al. Changes to Virus Taxonomy and the ICTV Statutes Ratified by the International Committee on Taxonomy of Viruses. Arch. Virol. 2023, 168, 175. [Google Scholar] [CrossRef] [PubMed]
- Deviatkin, A.A.; Karganova, G.G.; Vakulenko, Y.A.; Lukashev, A.N. Tbev Subtyping in Terms of Genetic Distance. Viruses 2020, 12, 1240. [Google Scholar] [CrossRef] [PubMed]
- Ruzek, D.; Avšič Županc, T.; Borde, J.; Chrdle, A.; Eyer, L.; Karganova, G.; Kholodilov, I.; Knap, N.; Kozlovskaya, L.; Matveev, A.; et al. Tick-Borne Encephalitis in Europe and Russia: Review of Pathogenesis, Clinical Features, Therapy, and Vaccines. Antiviral Res. 2019, 164, 23–51. [Google Scholar] [CrossRef] [PubMed]
- Vorovitch, M.F.; Maikova, G.B.; Chernokhaeva, L.L.; Romanenko, V.V.; Karganova, G.G.; Ishmukhametov, A.A. Comparison of the Immunogenicity and Safety of Two Pediatric TBE Vaccines Based on the Far Eastern and European Virus Subtypes. Adv. Virol. 2019, 2019, 5323428. [Google Scholar] [CrossRef]
- Maikova, G.B.; Chernokhaeva, L.L.; Rogova, Y.V.; Kozlovskaya, L.I.; Kholodilov, I.S.; Romanenko, V.V.; Esyunina, M.S.; Ankudinova, A.A.; Kilyachina, A.S.; Vorovitch, M.F.; et al. Ability of Inactivated Vaccines Based on Far-Eastern Tick-Borne Encephalitis Virus Strains to Induce Humoral Immune Response in Originally Seropositive and Seronegative Recipients. J. Med. Virol. 2019, 91, 190–200. [Google Scholar] [CrossRef]
- Chan, K.R.; Ismail, A.A.; Thergarajan, G.; Raju, C.S.; Yam, H.C.; Rishya, M.; Sekaran, S.D. Serological Cross-Reactivity among Common Flaviviruses. Front. Cell. Infect. Microbiol. 2022, 12, 1344. [Google Scholar] [CrossRef]
- Holzmann, H. Diagnosis of Tick-Borne Encephalitis. Vaccine 2003, 21, S36–S40. [Google Scholar] [CrossRef]
- Allwinn, R.; Doerr, H.; Emmerich, P.; Schmitz, H.; Preiser, W. Cross-Reactivity in Flavivirus Serology: New Implications of an Old Finding? Med. Microbiol. Immunol. 2002, 190, 199–202. [Google Scholar] [CrossRef]
- Maeki, T.; Tajima, S.; Ikeda, M.; Kato, F.; Taniguchi, S.; Nakayama, E.; Takasaki, T.; Lim, C.K.; Saijo, M. Analysis of Cross-Reactivity between Flaviviruses with Sera of Patients with Japanese Encephalitis Showed the Importance of Neutralization Tests for the Diagnosis of Japanese Encephalitis. J. Infect. Chemother. 2019, 25, 786–790. [Google Scholar] [CrossRef]
- Endale, A.; Medhin, G.; Darfiro, K.; Kebede, N.; Legesse, M. Magnitude of Antibody Cross-Reactivity in Medically Important Mosquito-Borne Flaviviruses: A Systematic Review. Infect. Drug Resist. 2021, 14, 4291. [Google Scholar] [CrossRef]
- Taba, P.; Schmutzhard, E.; Forsberg, P.; Lutsar, I.; Ljøstad, U.; Mygland; Levchenko, I.; Strle, F.; Steiner, I. EAN Consensus Review on Prevention, Diagnosis and Management of Tick-Borne Encephalitis. Eur. J. Neurol. 2017, 24, e61–e1214. [Google Scholar] [CrossRef] [PubMed]
- Weissbach, F.H.; Hirsch, H.H. Comparison of Two Commercial Tick-Borne Encephalitis Virus IgG Enzyme-Linked Immunosorbent Assays. Clin. Vaccine Immunol. 2015, 22, 754–760. [Google Scholar] [CrossRef] [PubMed]
- Knipe, D.M.; Howley, M.P. Fields Virology, 5th ed.; Lippincott Williams & Wilkins: Philadelphia, PA, USA, 2007; ISBN 0781760607. [Google Scholar]
- Rey, F.A.; Heinz, F.X.; Mandl, C.; Kunz, C.; Harrison, S.C. The Envelope Glycoprotein from Tick-Borne Encephalitis Virus at 2 Å Resolution. Nature 1995, 375, 291–298. [Google Scholar] [CrossRef] [PubMed]
- Fry, E.; Pulkkinen, L.I.A.; Barrass, S.V.; Domanska, A.; Överby, A.K.; Anastasina, M.; Butcher, S.J. Molecular Organisation of Tick-Borne Encephalitis Virus. Viruses 2022, 14, 792. [Google Scholar] [CrossRef]
- Zhang, X.; Jia, R.; Shen, H.; Wang, M.; Yin, Z.; Cheng, A. Structures and Functions of the Envelope Glycoprotein in Flavivirus Infections. Viruses 2017, 9, 338. [Google Scholar] [CrossRef]
- Jarmer, J.; Zlatkovic, J.; Tsouchnikas, G.; Vratskikh, O.; Strauß, J.; Aberle, J.H.; Chmelik, V.; Kundi, M.; Stiasny, K.; Heinz, F.X. Variation of the Specificity of the Human Antibody Responses after Tick-Borne Encephalitis Virus Infection and Vaccination. J. Virol. 2014, 88, 13845–13857. [Google Scholar] [CrossRef]
- Wang, D.; Zheng, Y.; Kang, X.; Zhang, X.; Hao, H.; Chen, W.; Liu, L.; Li, X.; Li, L.; Yuan, Q.; et al. A Multiplex ELISA-Based Protein Array for Screening Diagnostic Antigens and Diagnosis of Flaviviridae Infection. Eur. J. Clin. Microbiol. Infect. Dis. 2015, 34, 1327–1336. [Google Scholar] [CrossRef]
- Beck, C.; Desprès, P.; Paulous, S.; Vanhomwegen, J.; Lowenski, S.; Nowotny, N.; Durand, B.; Garnier, A.; Blaise-Boisseau, S.; Guitton, E.; et al. A High-Performance Multiplex Immunoassay for Serodiagnosis of Flavivirus-Associated Neurological Diseases in Horses. BioMed Res. Int. 2015, 2015, 678084. [Google Scholar] [CrossRef]
- Ndiaye, O.; Diagne, C.T.; Abd, A.; Wahed, E.; Dia, F.; Dia, M.; Faye, A.; Da, S.; Leal, V.; Dos Santos, M.; et al. Use of Envelope Domain III Protein for the Detection of IgG Type Antibodies Specific to Zika Virus by Indirect ELISA. Diagnostics 2023, 13, 462. [Google Scholar] [CrossRef]
- Ludolfs, D.; Reinholz, M.; Schmitz, H. Highly Specific Detection of Antibodies to Tick-Borne Encephalitis (TBE) Virus in Humans Using a Domain III Antigen and a Sensitive Immune Complex (IC) ELISA. J. Clin. Virol. 2009, 45, 125–128. [Google Scholar] [CrossRef]
- Ikawa-Yoshida, A.; Yoshii, K.; Kuwahara, K.; Obara, M.; Kariwa, H.; Takashima, I. Development of an ELISA System for Tick-Borne Encephalitis Virus Infection in Rodents. Microbiol. Immunol. 2011, 55, 100–107. [Google Scholar] [CrossRef] [PubMed]
- Beasley, D.W.C.; Holbrook, M.R.; Travassos Da Rosa, A.P.A.; Coffey, L.; Carrara, A.S.; Phillippi-Falkenstein, K.; Bohm, R.P.; Ratterree, M.S.; Lillibridge, K.M.; Ludwig, G.V.; et al. Use of a Recombinant Envelope Protein Subunit Antigen for Specific Serological Diagnosis of West Nile Virus Infection. J. Clin. Microbiol. 2004, 42, 2759–2765. [Google Scholar] [CrossRef] [PubMed]
- Shukla, R.; Ramasamy, V.; Shanmugam, R.K.; Ahuja, R.; Khanna, N. Antibody-Dependent Enhancement: A Challenge for Developing a Safe Dengue Vaccine. Front. Cell. Infect. Microbiol. 2020, 10, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Inagaki, E.; Sakai, M.; Hirano, M.; Muto, M.; Kobayashi, S.; Kariwa, H.; Yoshii, K. Development of a Serodiagnostic Multi-Species ELISA against Tick-Borne Encephalitis Virus Using Subviral Particles. Ticks Tick. Borne. Dis. 2016, 7, 723–729. [Google Scholar] [CrossRef]
- Jääskelämen, A.; Han, X.; Niedrig, M.; Vaheri, A.; Vapalahti, O. Diagnosis of Tick-Borne Encephalitis by a μ-Capture Immunoglobulin M-Enzyme Immunoassay Based on Secreted Recombinant Antigen Produced in Insect Cells. J. Clin. Microbiol. 2003, 41, 4336–4342. [Google Scholar] [CrossRef]
- Levanov, L.; Vera, C.P.; Vapalahti, O. Prevalence Estimation of Tick-Borne Encephalitis Virus (TBEV) Antibodies in Dogs from Finland Using Novel Dog Anti-TBEV IgG MAb-Capture and IgG Immunofluorescence Assays Based on Recombinant TBEV Subviral Particles. Ticks Tick. Borne. Dis. 2016, 7, 979–982. [Google Scholar] [CrossRef]
- Salat, J.; Mikulasek, K.; Larralde, O.; Formanova, P.P.; Chrdle, A.; Haviernik, J.; Elsterova, J.; Teislerova, D.; Palus, M.; Eyer, L.; et al. Tick-Borne Encephalitis Virus Vaccines Contain Non-Structural Protein 1 Antigen and May Elicit NS1-Specific Antibody Responses in Vaccinated Individuals. Vaccines 2020, 8, 81. [Google Scholar] [CrossRef]
- Girl, P.; Bestehorn-Willmann, M.; Zange, S.; Borde, J.P.; Dobler, G.; von Buttlar, H. Tick-Borne Encephalitis Virus Nonstructural Protein 1 IgG Enzyme-Linked Immunosorbent Assay for Differentiating Infection versus Vaccination Antibody Responses. J. Clin. Microbiol. 2020, 58, e01783-19. [Google Scholar] [CrossRef]
- Tamura, K.; Nei, M. Estimation of the Number of Nucleotide Substitutions in the Control Region of Mitochondrial DNA in Humans and Chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Mandl, C.W.; Iacono-Connors, L.; Wallner, G.; Holzmann, H.; Kunz, C.; Heinz, F.X. Sequence of the Genes Encoding the Structural Proteins of the Low-Virulence Tick-Borne Flaviviruses Langat TP21 and Yelantsev. Virology 1991, 185, 891–895. [Google Scholar] [CrossRef] [PubMed]
- Baryshnikova, V.S.; Turchenko, Y.V.; Shishova, A.A.; Klimentov, A.S.; Tuchynskaya, K.K.; Karganova, G.G. Recombinant Glycoprotein E of Tick-Borne Encephalitis Virus for a Developing Differentiated Test System. Biotekhnologiya 2022, 38, 73–83. [Google Scholar] [CrossRef]
- Atrasheuskaya, A.V.; Kazakova, E.V.; Zhirenkina, E.N.; Trukhin, V.P.; Ignatyev, G.M. The Study of Flaviviruses and Chikungunya Virus Seroprevalence in Nicaragua—Virus-Specific Antibody Avidity Assay as a Tool for Differential Diagnosis. Zhurnal Mikrobiol. Epidemiol. Immunobiol. 2022, 99, 215–224. [Google Scholar] [CrossRef]
- Tuchynskaya, K.; Volok, V.; Illarionova, V.; Okhezin, E.; Polienko, A.; Belova, O.; Rogova, A.; Chernokhaeva, L.; Karganova, G. Experimental Assessment of Possible Factors Associated with Tick-Borne Encephalitis Vaccine Failure. Microorganisms 2021, 9, 1172. [Google Scholar] [CrossRef] [PubMed]
- Reed, L.J.; Muench, H. A Simple Method of Estimating Fifty per Cent Endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Musso, D.; Desprès, P. Serological Diagnosis of Flavivirus-Associated Human Infections. Diagnostics 2020, 10, 302. [Google Scholar] [CrossRef]
- Denis, J.; Attoumani, S.; Gravier, P.; Tenebray, B.; Garnier, A.; Briolant, S.; De Laval, F.; Chastres, V.; Grard, G.; Leparc-Goffart, I.; et al. High Specificity and Sensitivity of Zika EDIII-Based ELISA Diagnosis Highlighted by a Large Human Reference Panel. PLoS Negl. Trop. Dis. 2019, 13, e0007747. [Google Scholar] [CrossRef]
- Čabanová, V.; Kerlik, J.; Kirschner, P.; Rosochová, J.; Klempa, B.; Sláviková, M.; Ličková, M. Co-Circulation of West Nile, Usutu, and Tick-Borne Encephalitis Viruses in the Same Area: A Great Challenge for Diagnostic and Blood and Organ Safety. Viruses 2023, 15, 366. [Google Scholar] [CrossRef]
- Rockstroh, A.; Moges, B.; Berneck, B.S.; Sattler, T.; Revilla-Fernández, S.; Schmoll, F.; Pacenti, M.; Sinigaglia, A.; Barzon, L.; Schmidt-Chanasit, J.; et al. Specific Detection and Differentiation of Tick-Borne Encephalitis and West Nile Virus Induced IgG Antibodies in Humans and Horses. Transbound. Emerg. Dis. 2019, 66, 1701–1708. [Google Scholar] [CrossRef]
- de Heus, P.; Kolodziejek, J.; Hubálek, Z.; Dimmel, K.; Racher, V.; Nowotny, N.; Cavalleri, J.M.V. West Nile Virus and Tick-Borne Encephalitis Virus Are Endemic in Equids in Eastern Austria. Viruses 2021, 13, 1873. [Google Scholar] [CrossRef]
- Zelikhina, S.V.; Shartova, N.V.; Mironova, V.A.; Varentsov, M.I. Ecological and Geographical Prerequisites for the Spread of West Nile Fever in Russia. Ecosyst. Ecol. Dyn. 2021, 5, 132–150. [Google Scholar] [CrossRef]
- Petrova, I.S.; Muravev, O.B.; Kuzmenko, T.N.; Sayfullin, M.A.; Boytsov, P.V.; Larichev, V.F.; Akinshina, Y.A.; Butenko, A.M. The Case of Imported Japanese Encephalitis (JE) in a Russian Traveler. Epidemiol. Infect. Dis. 2014, 19, 60–62. [Google Scholar] [CrossRef]
Strain | Region and Year of Isolation | Source of Isolation | GenBank No. |
---|---|---|---|
TBEV Far Eastern subtype | |||
SofjinKGG | Primorsky Krai, Russia, 1937 | Brain of deceased TBE patient | GU121963 |
205 | Khabarovsky Krai, Russia, 1973 | I. persulcatus | GU121964 |
DV-936k | Primorsky Krai, Russia, 1975 | I. persulcatus | GU125722 |
TBEV Siberian subtype | |||
Sukhar | Yaroslavl’ region, 2016 | Brain of deceased TBE patient | OP185392 |
EK-328 | Estonia, 1972 | I. persulcatus | DQ486861 |
Kurg-59 | Kurgan region, 1989 | I. persulcatus | |
ZauPVV | Before 2000 | unknown | OQ673266 |
VK476 | Vologodski Region, 1975 | I. ricinus | OQ673268 |
Karl14-T20468 | Republic of Karelia, 2014 | I. persulcatus | MT424738 |
Yuk 4/13 | Kemerovo Region, Russia, 1969 | I. persulcatus | GU125721 |
Ya-10/89 | Yaroslavl’ region, 1989 | I. persulcatus | GU125719 |
TBEV European subtype | |||
256 | Belarus, 1940 | I. ricinus | AF091014 |
Absettarov | Leningrad Region, Russia, 1951 | Blood of a TBE patient | KU885457 |
MOS-152-N-2017 | Moscow, 2017 | I. ricinus | OQ673267 MH663429.1 |
LK-138 | Lithuania, 1972 | I. ricinus | GU125720 |
TBEV Baikalian-1 subtype | |||
178–79 | Irkutsk Region, Russia, 1979 | I. persulcatus | EF469661 |
TBEV Baikalian-2 subtype | |||
886–84 | Irkutsk Region, Russia, 1984 | Brain of gray-sided vole | EF469662 |
Powassan virus | |||
Pow-24 | Primorsky Krai, Russia, 1976 | I. persulcatus ticks | MG652438 |
OHFV, subtype 1 | |||
Nikitina | Omsk Region, Russia, 1948 | Blood of a patient with OHF | GU290187 |
Langat virus | |||
TP-21 (Elantsev) * | Malaya, 1956 | Ixodes granulatus | M73835 |
WNV, Lineage 1 | |||
Hp-94 | Astrakhan Region, 1963 | Hyalomma marginatum | JX041633.1 |
WNV, Lineage 2 | |||
B958 | Unknown, before 1980 | Unknown | OQ673269 |
JE | |||
Gagar | Unknown, before 1975 | Unknown |
Protein | Primers |
---|---|
sE | For.: GAGCTACCATGGTCACACATCTGGAGAACAGG Rev.: TAGCTCAGATCTCTTTTGGAACCACTGATGGC |
dIII | For.: GAGCTAGAGCTCACAATGTGTGACAAAACGAAG Rev.: TAGCTCAAGCTTCTTTTGGAACCACTGATGGC |
Serum Name | Diagnosis | Sex | Age | Probable Site of Infection | Day of Disease |
---|---|---|---|---|---|
TBE (set#1) | |||||
TBE1 | TBE | F | 12 | Krasnoyarsk | 21 |
TBE2 | M | 36 | Ufa | 180 | |
TBE3 | F | 44 | Chita | >365 | |
TBE4 | M | 47 | Crimea | >180 | |
TBE5 | M | 38 | Chelyabinsk | 28 | |
TBE6 | M | ? | Vologda | 6 | |
TBEvac * | F | 26 | Moscow | ||
TBE (set#3) | |||||
TBE7 | TBE | M | 2.5 | unknown | unknown |
TBE8 | M | unknown | unknown | unknown | |
TBE9 | M | unknown | unknown | unknown | |
TBE10 | F | 29 | Altai region, Russia | 7 | |
TBE11 | M | unknown | unknown | unknown | |
TBE12 | M | 50 | Chelyabinsk Region, Russia | 47 | |
TBE13 | M | 42 | Tver Region, Russia | 5 | |
TBE14 | M | 19 | Novosibirsk Region, Russia | 9 | |
TBE15 | M | 36 | Perm Region, Russia | 26 | |
TBE16 | M | unknown | unknown | unknown | |
TBE17 | M | 45 | Perm Region, Russia | 13 | |
TBE18 | M | 42 | unknown | 11 | |
TBE19 | M | 42 | unknown | 14 | |
TBE20 | M | 42 | unknown | 15 | |
TBE21 | M | unknown | Republic of Karelia, Russia | 14 | |
TBE22 | F | 50 | Kostroma Region, Russia | 22 | |
TBE23 | F | 5 | Republic of Khakassia, Russia | unknown | |
TBE24 | M | 52 | unknown | 27 | |
TBE25 | M | 42 | Tver Region, Russia | 14 | |
TBE26 | M | 19 | Novosibirsk Region, Russia | 16 | |
JE(set#1) | |||||
JE ** | JE | M | 53 | Thailand | 18 |
Zika(set#1) | |||||
Zika1 | Zika | F | 35 | Thailand | 37 |
Zika2 | M | ? | Dominican | 14 | |
WN(set#1) | |||||
WN1 | WN | F | 32 | Moscow | 14 |
WN2 | F | 63 | Volgograd | 7 | |
WN3 | M | 43 | India | 15 | |
WN4 | M | 32 | India | 21 | |
WN5 | F | 24 | Volgograd | >180 | |
WN6 | M | ? | Astrakhan | unknown | |
Dengue(set#1) | |||||
D1 | dengue | F | 56 | Maldives | 7 |
D2 | M | 45 | Shri Lanka | 6 | |
D3 | F | 29 | Maldives | 7 | |
D4 | M | 28 | Vietnam | 14 | |
D5 | F | 40 | Thailand | 9 | |
D6 | M | ? | Vietnam | 8 |
Set # | Number of Sera, n | ELISA (sE) | ELISA (dIII) |
---|---|---|---|
1 | 7 | 6/7 | 6/7 |
2 | 26 | 26/26 | 11/26 |
3 | 20 | 20/20 | 18/20 |
Set # | Diagnosis | Number of Sera, n | ELISA (sE) | ELISA (dIII) |
---|---|---|---|---|
1 | JE | 1 | 1/1 | 1/1 |
Zika | 2 | 0/2 | 0/2 | |
WNV | 6 | 0/6 | 0/1 | |
Dengue | 6 | 0/6 | 0/6 | |
4 | YF | 5 | 0/5 | 0/5 |
YF + Zika | 1 | 0/1 | 0/1 | |
Chick +YF | 5 | 0/5 | 0/5 | |
Chick + Zika | 3 | 0/3 | 0/3 | |
Chick | 3 | 0/3 | 0/3 |
Serum # | NAb Titer against TBEV, log(NAb) | NAb Titer against WNV, log(NAb) |
---|---|---|
1 | 1.5 * | 2.3 |
2 | <1 ** | 1.9 |
3 | <1 | >2.2 |
4 | <1 | 1.8 |
5 | <1 | 2.7 |
6 | <1 | >2.8 |
7 | <1 | 2 |
8 | 1.8 | 2.2 |
9 | <1 | 1.9 |
10 | >2.2 | 1.6 |
Hyperimmune Serum | Virus, Strain | NAb Titers to Corresponding Virus, log(NAb) | ELISA (sE) | ELISA (dIII) |
---|---|---|---|---|
Mouse | Powassan virus, Pow-24 | >3.4 * | − | − |
OHFV, Nikitina | 2.2 | − | − | |
Langat virus, TP-21 (Elantsev) | 2.5 1 | − | − | |
WNV, B958 | 2.3 | − | − | |
TBEV, Absettarov | 2.95 | + | + | |
TBEV, ZauPVV | 1.9 2 | + | + | |
TBEV, VK476 | 2.94 | + | + | |
TBEV, MOS-152-N-2017 | 1.9 | + | + | |
TBEV, Karl14-T20468 | 2 | + | + | |
Rabbit | TBEV, 256 | n/t | + | + |
TBEV, Yar-82 | n/t | + | + | |
TBEV, Kurg-59 | n/t | + | + |
Serum | Subtype | Strain | NAb Titer against TBEV | ELISA of IgG (sE) | ELISA of IgM (sE) | ELISA of IgM (dIII) |
---|---|---|---|---|---|---|
Mouse | European | Absettarov | n/t 1 | + | + | + |
European | LK-138 | 1.25 * 1 | − | − | + | |
Siberian | Yuk 4/13 | 1.07 2 | + | + | + | |
Far Eastern | SofjinKGG | 1.17 3 | + | − | − | |
Far Eastern | 205 | 1.24 3 | + | + | + | |
Far Eastern | DV 936k | n/t 3 | + | + | + | |
Baikalian-1 | 178–79 | 1.48 2 | − | − | + | |
Baikalian-2 | 886–84 | 1.45 2 | − | − | + |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Baryshnikova, V.; Turchenko, Y.; Tuchynskaya, K.; Belyaletdinova, I.; Butenko, A.; Dereventsova, A.; Ignatiev, G.; Kholodilov, I.; Larichev, V.; Lyapeykova, E.; et al. Recombinant TBEV Protein E of the Siberian Subtype Is a Candidate Antigen in the ELISA Test System for Differential Diagnosis. Diagnostics 2023, 13, 3277. https://doi.org/10.3390/diagnostics13203277
Baryshnikova V, Turchenko Y, Tuchynskaya K, Belyaletdinova I, Butenko A, Dereventsova A, Ignatiev G, Kholodilov I, Larichev V, Lyapeykova E, et al. Recombinant TBEV Protein E of the Siberian Subtype Is a Candidate Antigen in the ELISA Test System for Differential Diagnosis. Diagnostics. 2023; 13(20):3277. https://doi.org/10.3390/diagnostics13203277
Chicago/Turabian StyleBaryshnikova, Victoria, Yuriy Turchenko, Ksenia Tuchynskaya, Ilmira Belyaletdinova, Alexander Butenko, Alena Dereventsova, Georgy Ignatiev, Ivan Kholodilov, Victor Larichev, Ekaterina Lyapeykova, and et al. 2023. "Recombinant TBEV Protein E of the Siberian Subtype Is a Candidate Antigen in the ELISA Test System for Differential Diagnosis" Diagnostics 13, no. 20: 3277. https://doi.org/10.3390/diagnostics13203277