Next Article in Journal
Evaluation of Dynamic Contrast-Enhanced and Oxygen-Enhanced Functional Lung Magnetic Resonance Imaging in Chronic Obstructive Pulmonary Disease Patients
Next Article in Special Issue
Clinical Evaluation of Direct Reverse Transcription PCR for Detection of SARS-CoV-2 Compared to Conventional RT-PCR in Patients with Positive Rapid Antigen Test Results during Circulation of Emerging Viral Variants
Previous Article in Journal
Evolution of Fetal Cardiac Imaging over the Last 20 Years
Previous Article in Special Issue
Detection of SARS-CoV-2 Variants via Different Diagnostics Assays Based on Single-Nucleotide Polymorphism Analysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diagnostics
Volume 13
Issue 23
10.3390/diagnostics13233510
diagnostics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

No Association between SARS-CoV-2 Infection and the Polymorphism of the Toll-like Receptor 7 (TLR7) Gene in Female Population

by
Mohammed Zayed
1,2,3,†,
Yong-Chan Kim
4,†,
Chang-Seop Lee
5,6,* and
Byung-Hoon Jeong
1,2,*
1
Korea Zoonosis Research Institute, Jeonbuk National University, Iksan 54531, Republic of Korea
2
Department of Bioactive Material Sciences, Institute for Molecular Biology and Genetics, Jeonbuk National University, Jeonju 54896, Republic of Korea
3
Department of Surgery, College of Veterinary Medicine, South Valley University, Qena 83523, Egypt
4
Department of Biological Sciences, Andong National University, Andong 36729, Republic of Korea
5
Department of Internal Medicine, Research Institute of Clinical Medicine, Jeonbuk National University, Jeonju 54907, Republic of Korea
6
Biomedical Research Institute, Jeonbuk National University Hospital, Jeonju 54907, Republic of Korea
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Diagnostics 2023, 13(23), 3510; https://doi.org/10.3390/diagnostics13233510
Submission received: 5 September 2023 / Revised: 20 November 2023 / Accepted: 21 November 2023 / Published: 23 November 2023
(This article belongs to the Special Issue Detection and Assessment of SARS-CoV-2 Variants)
Browse Figure
Versions Notes

Abstract

:
Coronavirus disease 2019 (COVID-19) is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a single-stranded RNA virus. Toll-like receptor 7 (TLR7) recognizes single-stranded RNA viruses. The TLR7 gene plays a critical role in the human innate and adaptive immune response to SARS-CoV-2 infections. Genetic factors probably affect SARS-CoV-2 infection susceptibility. In the current study, our aim was to search for genetic variations associated with COVID-19 patients in the TLR7 gene of a Korean population. We designed five gene-specific primers to cover the coding region of the human TLR7 gene. Using amplicon sequencing, we screened the genetic polymorphisms in the coding region of the TLR7 gene in COVID-19 patients and healthy controls. The genotype frequencies, allele frequencies, and Hardy–Weinberg equilibrium (HWE) were examined. We identified a low-frequency synonymous single nucleotide polymorphism (SNP) (rs864058) in the coding region of the TLR7 gene. There were no significant differences in the genotype or allele frequencies of the TLR7 rs864058 polymorphism between COVID-19 female patients and healthy controls (p = 1.0). In conclusion, TLR7 (rs864058) polymorphism is low frequency in Korean populations and is not associated with SARS-CoV-2 infection.

1. Introduction

Coronavirus disease 2019 (COVID-19) is caused by severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) [1]. SARS-CoV-2 is a positive-sense single-stranded RNA virus with a wide range of hosts, including bats, snakes, pangolins, humans, cats, and dogs [2]. Among clinical symptoms, the most prevalent symptom is fever, followed by cough, myalgia, headache, and sore throat [3]. Patients who required intensive care were older and more likely to have underlying disorders [4]. Tiecco et al. recently reported the stealthy resurgence of COVID-19 as a result of the dissemination of the SARS-CoV-2 variant of concern, Omicron [5]. The authors emphasized the BA.2 lineage and reviewed the virological properties, such as transmissibility, pathogenicity, and resistance to vaccine- and infection-induced immunity, as well as antiviral medicines, raising a public health concern. Various data have shown that the fundamental cause of COVID-19 is an unregulated host immune response, which can potentially lead to a lethal cytokine storm [6,7]. Toll-like receptors (TLRs) play a role in immediate pathogen detection and subsequent activation of innate immunity by stimulating inflammatory responses to eliminate the invading organisms [8,9]. Genetic diversity in TLR genes influences cellular immune response and disease risk [10]. As TLRs have a role in the induction of cytokine storms, they might also be vitally involved in the cytokine storm associated with SARS-CoV-2 infection [11,12]. Consequently, the immune response to SARS-CoV-2 infection and the role of the TLRs are being considered to identify therapeutic approaches [13].
Genetic variation in TLR-encoding genes has been linked to COVID-19’s significant respiratory symptoms [14,15]. Several studies have discovered different TLR genes related to COVID-19 susceptibility through genome-wide association studies or specific gene analysis [16,17]. The following polymorphisms are associated with the prognosis and susceptibility to COVID-19 infection: TLR3 rs3775290, TLR4 Asp299Gly, Thr399Ile, and TLR9 [16]. The TLR7 gene is expressed in monocytes and dendritic cells that are involved in inflammation and infection, leading to mediating the production of type I interferon (IFN) and other inflammatory cytokines upon stimulation [18]. Van der Made et al. detected loss-of-function variants of the X-chromosomal TLR7 gene on whole-exome sequencing of four male patients with severe COVID-19 infection [19]. The presence of these rare variants in young men with severe COVID-19 has been studied, resulting in TLR7 missense variants in 14.3% of the patients [20].
While there is no difference in COVID-19 prevalence between men and women, male patients tend to have more clinical symptoms and a higher risk of requiring intensive care than female patients [21]. It has been suggested that X-linked genes may explain this phenomenon. The 10 TLR genes are found on chromosomes 3, 4, 9, and X in a total of 6 chromosome regions. The TLR7 gene is located on the X chromosome; therefore, studies suggest that SARS-CoV-2 may exhibit a gender-dependent response [22]. The immune cells of females exhibit biallelic TLR7 expression, producing more inflammatory factors upon TLR7 stimulation compared to males. This enhanced inflammatory response contributes to low COVID-19 mortality observed in the female population. However, it is important to note that certain factors associated with females, including obesity, changes in menstrual and sleep cycles, and maternal outcomes, are identified as risk factors for COVID-19 mortality [23,24,25]. Genetic variation may explain differences in cytokine production within COVID-19 patients. Single nucleotide polymorphisms (SNPs) in the TLR7 gene may be associated with TLR7 gene expression. Given the role that TLR7 plays in COVID-19, genetic screening of TLR7 gene polymorphisms in COVID-19 patients must be investigated.
In the current study, we searched for polymorphisms in the coding region of the TLR7 gene in the female Korean population using amplicon sequencing. We aimed to identify any link between TLR7 polymorphisms and their potential influence on COVID-19 susceptibility.

2. Materials and Methods

2.1. Selection of Participants

This study included 90 healthy females in the control group and 87 patients diagnosed with COVID-19 (Table 1).
The two groups had similar ages and sexes. COVID-19 patients with a median age of 55.0 years were admitted to Jeonbuk National University Hospital, Jeonju-si, Republic of Korea, between April 2020 and September 2021. Healthy controls with a median age of 61.0 years were unrelated subjects recruited from the Korea Biobank Network.

2.2. Inclusion Criteria

This study included Korean female patients diagnosed with SARS-CoV-2 through polymerase chain reaction (PCR). The patients were categorized into two groups based on clinical symptoms: mild and severe. The mild COVID-19 group included 74 cases with symptoms such as sore throat, arthralgia, and anosmia. The severe COVID-19 group included 13 cases with conditions such as respiratory distress, mechanical ventilation, and low oxygen concentration in arterial blood. A total of 23 patients received vaccinations, including 10 AstraZeneca, 1 Janssen, and 12 Pfizer (6 one dose and 6 two doses).

2.3. Exclusion Criteria

Patients with known HIV, hepatitis B or C, and/or chronic lung diseases were excluded from this study. Additionally, children and pregnant females were also excluded from this research.

2.4. Calculation of Sample Size

Using the prevalence rate of COVID-19 in the Korean population [26], the sample size was estimated using the QUANTO program version 1.2.4. The minimum required sample size indicated that 79 subjects were needed for each group with a power of 80% and a significance level of 5%. To enhance statistical analysis, we added an additional 8–20 individuals in each group.

2.5. DNA Isolation and Genotyping

Blood samples (200 μL) were used for the preparation of genomic DNA using a blood genomic DNA isolation kit (Qiagen, CA, USA) following the manufacturer’s directions. To cover the coding region of the TLR7 gene, five primers were designed for PCR (Table 2). These primers were used to amplify the entire protein-coding region of the human TLR7 gene (Gene ID: 51284).
The PCR mixture included 1 µL of genomic DNA, 10 pmol of each primer, 2.5 µL of 10 Taq DNA polymerase buffer, 0.5 µL of a 0.2 µM dNTP combination, 5 µL of 5 Band Helper, and 0.25 µL Taq DNA polymerase (BioFACT, Daejeon, Korea). The PCR conditions were set according to the manufacturer’s instructions. The TLR7 gene primers were annealed at 58 °C using the C1000 Touch Thermal Cycler (Bio-Rad, Hercules, CA, USA). The PCR findings were visualized using electrophoresis on 1% agarose gel.
The PCR products were purified with the FavorPrep GEL/PCR Purification Kit (Favogen Biotech, Ping Tung, Taiwan) and sequenced using an ABI 3730 sequencer (ABI, Foster City, CA, USA). The sequencing reaction was performed using Applied Biosystems’ BigDyeTM Terminator v3.1 kit (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s instructions. The 10 µL sequencing reaction comprised 7.0 µL BigDye™ Terminator v3.1 Ready Reaction Mix, 10 pmol primer, and 50 ng PCR product. The sequencing results were analyzed using Sequencing Analysis Software version 5.3.1 (Applied Biosystems, USA). Finch TV software 1.4.0 (Geospiza Inc., Seattle, WA, USA) was used to visualize sequencing.

2.6. Statistical Analysis

The genotype and allele frequencies of the TLR7 gene were analyzed and compared between the COVID-19 patients and healthy controls by Fisher’s exact test using SAS 9.4 software. Analysis of the Hardy–Weinberg equilibrium (HWE) test was also performed. The age between the two groups was analyzed using median test. Statistical significance was defined as p < 0.05, and all p-values were two-tailed.

3. Results

There were no statistically significant differences in terms of age between the patients and control groups (p = 0.11).
The sequenced PCR products were found to be identical to the Homo sapiens TLR7 gene, which was registered in GenBank (Gene ID: 51284).
In our study, we utilized PCR product sequencing data to conduct genotyping of the TLR7 gene. Analysis of the sequence variation in the coding region of the TLR7 gene identified a low-frequency and a rare synonymous SNP, c.20330 G>A (rs864058), which does not result in an amino acid replacement, in both healthy controls and patients. The identified SNP is classified as a low-frequency SNP based on its frequency, one frequency in both the healthy controls and patients. The electropherograms displaying the SNP are presented in Figure 1.
The genotype and allele frequencies of the TLR7 polymorphisms were assessed through amplicon sequencing of healthy controls and patients, using each primer. The distributions of genotype frequencies, allele frequencies, and HWE for TLR7 rs864058 in the present study are comprehensively presented in Table 3.
There was no significant association between TLR7 rs864058 SNP and SARS-CoV-2 infection.

4. Discussion

To investigate the impact of beneficial gene expression of the second X chromosome in females, we recently investigated the potential association between four identified potentially functional SNPs in the promoter region and exon 1 of the TLR8 gene and COVID-19 susceptibility between healthy control and COVID-19 patient groups in a Korean population. The results, however, revealed no significant difference in the genotype and allele frequencies in the studied population. Therefore, an X chromosomal gene of interest is TLR7, which has been identified to be involved in type 1 interferon production in COVID-19 [27,28] needs to be investigated. In the current study, we aimed to search for genetic variations associated with COVID-19 patients in the coding region of TLR7 gene of a Korean female population. We detected TLR7 rs864058 SNP, not resulting in an amino acid replacement (rs864058), indicating that females can do better in SARS-CoV-2 infection [21]. The TLR7 rs864058 genotype frequencies are very low (less than 5%) and did not show any significant differences between COVID-19 patients and healthy controls. It is commonly observed that associations with low-frequency and rare variants have minor impacts on disease [29]. Moreover, the assessment of low-frequency variants often necessitates additional genomic tools, such as genotype imputation and the use of whole-exome or whole-genome sequencing [29].
The genetic background can impact the incidence and consequences of infectious diseases, including H1N1 influenza virus and COVID-19 [30,31,32,33,34,35]. In SARS-CoV-2 infection, TLRs (2–9) play significant roles in detecting the viral particles and stimulating the innate immune system to eliminate the infection [16]. However, TLR7 is thought to be the most significant among the TLRs that have demonstrated a response to coronaviruses. While TLR7 expression has been implicated in respiratory syncytial virus-induced lung inflammation [36], several studies have reported associations between COVID-19 and TLR7 variants. For instance, TLR7 rs179008 genotypes are associated with an extremely high risk of COVID-19 pneumonia but not with disease outcome [37]. The same study reported that patients with ‘T/T’ genotype of TLR7 had 4.76 times higher odds of displaying COVID-19 pneumonia compared to patients with the wild homozygous ‘A/A’ genotype. The TLR7 rs179008 genotype has also been linked to low expression levels of the TLR7 gene. Another study showed that the TLR7 rs3853839 GG genotype was considerably more prevalent in COVID-19 patients (38.7%) than in the control individuals (4.4%) [38]. In contrast, the genotype CC was significantly higher amongst controls (56.3%) than cases (24.7%). Thus, the G allele was significantly more prevalent among cases (57.0%), and the C allele was significantly more prevalent among controls [38].
TLRs variants have also been linked to respiratory disorders [39]. The TLR7 rs179008 polymorphism, for example, is strongly associated with the pathogenesis of bronchial asthma [40]. There is confirmation that polymorphisms in the TLR7 gene are associated with susceptibility to respiratory viral infections [41]. Zhang et al. showed that TLR7 and TLR8 polymorphisms may play an essential role in the pathogenesis of asthma [42]. Several studies have investigated the TLR7 rs864058 polymorphism in various respiratory diseases, such as allergic rhinitis [43], measles infection [44], and prostate cancer [45]. In SARS-CoV-2 infection, no association studies of TLR7 rs864058 with COVID-19 susceptibility have been reported. In the current study, we did not find a significant difference in the genotype and allele frequencies of TLR7 rs864058 between COVID-19 patients and healthy controls in Korean population (p > 0.05).
This is one of the few studies investigating the genetic variation associated with SARS-CoV-2 infection among females. The study only investigated the Korean population. Further studies are needed to examine the genetic variation in the TLR7 gene in other ethnic groups. Additional studies should also investigate other polymorphisms of the TLR7 gene and their haplotype effects on susceptibility to SARS-CoV-2 infection.
Despite the small sample size in our current investigation, it is noteworthy that analogous studies have previously performed association analyses in similarly small sample sizes to gain initial insights before undertaking extensive validation endeavors in larger populations [46,47,48]. In line with these previous reports, our study conducted a preliminary analysis within a limited cohort, revealing no association between TLR7 (rs864058) polymorphism and susceptibility to COVID-19. Nevertheless, it is necessary to conclusively affirm the absence of an association between TLR7 (rs864058) polymorphism and susceptibility to COVID-19 in a larger population using more robust statistical power.

5. Conclusions

To our knowledge, this is one of the few studies that have screened genetic variations in the TLR7 gene in females. According to the results, the TLR7 (rs864058) polymorphism is low frequency in Korean populations and not associated with SARS-CoV-2 infection.

Author Contributions

Conceptualization, M.Z., Y.-C.K. and B.-H.J.; methodology, M.Z., Y.-C.K. and B.-H.J.; formal analysis, M.Z., Y.-C.K. and B.-H.J.; data curation, M.Z., Y.-C.K., C.-S.L. and B.-H.J.; writing—original draft preparation, M.Z.; writing—review and editing, M.Z., Y.-C.K., C.-S.L. and B.-H.J.; supervision, B.-H.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by a National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (2021R1A2C1013213, 2022R1C1C2004792). This research was supported by the Basic Science Research Program through the National Research Foundation (NRF) of Korea, funded by the Ministry of Education (2017R1A6A1A03015876, 2021R1A6A3A01086488). This paper was supported by Fund of Biomedical Research Institute, Jeonbuk National University Hospital. This research was supported by a Korea Basic Science Institute (National Research Facilities and Equipment Center) grant funded by the Ministry of Education (grant No. 2021R1A6C101C369).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by Jeonbuk National University Hospital’s Institutional Review Board (approval number: 2020-02-050).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data that support the findings of this study are available upon reasonable request from the corresponding author.

Acknowledgments

We thank all the patients that participated in this study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Lai, C.C.; Shih, T.P.; Ko, W.C.; Tang, H.J.; Hsueh, P.R. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and coronavirus disease-2019 (COVID-19): The epidemic and the challenges. Int. J. Antimicrob. Agents 2020, 55, 105924. [Google Scholar] [CrossRef] [PubMed]
  2. Hossain, M.G.; Javed, A.; Akter, S.; Saha, S. SARS-CoV-2 host diversity: An update of natural infections and experimental evidence. J. Microbiol. Immunol. Infect. 2021, 54, 175–181. [Google Scholar] [CrossRef]
  3. Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, D.; Hu, B.; Hu, C.; Zhu, F.; Liu, X.; Zhang, J.; Wang, B.; Xiang, H.; Cheng, Z.; Xiong, Y.; et al. Clinical Characteristics of 138 Hospitalized Patients with 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA 2020, 323, 1061–1069. [Google Scholar] [CrossRef]
  5. Tiecco, G.; Storti, S.; Arsuffi, S.; Antoni, M.D.; Focà, E.; Castelli, F.; Quiros-Roldan, E. Omicron BA.2 Lineage, the “Stealth” Variant: Is It Truly a Silent Epidemic? A Literature Review. Int. J. Mol. Sci. 2022, 23, 7315. [Google Scholar] [CrossRef]
  6. Hu, B.; Huang, S.; Yin, L. The cytokine storm and COVID-19. J. Med. Virol. 2021, 93, 250–256. [Google Scholar] [CrossRef]
  7. Ragab, D.; Eldin, H.S.; Taeimah, M.; Khattab, R.; Salem, R. The COVID-19 Cytokine Storm; What We Know So Far. Front. Immunol. 2020, 11, 1446. [Google Scholar] [CrossRef] [PubMed]
  8. Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef]
  9. Kawasaki, T.; Kawai, T. Toll-Like Receptor Signaling Pathways. Front. Immunol. 2014, 5, 461. [Google Scholar] [CrossRef]
  10. Misch, E.A.; Hawn, T.R. Toll-like receptor polymorphisms and susceptibility to human disease. Clin. Sci. 2008, 114, 347–360. [Google Scholar] [CrossRef]
  11. Dai, J.; Wang, Y.; Wang, H.; Gao, Z.; Wang, Y.; Fang, M.; Shi, S.; Zhang, P.; Wang, H.; Su, Y.; et al. Toll-Like Receptor Signaling in Severe Acute Respiratory Syndrome Coronavirus 2-Induced Innate Immune Responses and the Potential Application Value of Toll-Like Receptor Immunomodulators in Patients with Coronavirus Disease 2019. Front. Microbiol. 2022, 13, 948770. [Google Scholar] [CrossRef]
  12. Zheng, M.; Karki, R.; Williams, E.P.; Yang, D.; Fitzpatrick, E.; Vogel, P.; Jonsson, C.B.; Kanneganti, T.-D. TLR2 senses the SARS-CoV-2 envelope protein to produce inflammatory cytokines. Nat. Immunol. 2021, 22, 829–838. [Google Scholar] [CrossRef]
  13. Liu, Z.-M.; Yang, M.-H.; Yu, K.; Lian, Z.-X.; Deng, S.-L. Toll-like receptor (TLRs) agonists and antagonists for COVID-19 treatments. Front. Pharmacol. 2022, 13, 989664. [Google Scholar] [CrossRef]
  14. Mantovani, S.; Daga, S.; Fallerini, C.; Baldassarri, M.; Benetti, E.; Picchiotti, N.; Fava, F.; Gallì, A.; Zibellini, S.; Bruttini, M.; et al. Rare variants in Toll-like receptor 7 results in functional impairment and downregulation of cytokine-mediated signaling in COVID-19 patients. Genes Immun. 2022, 23, 51–56. [Google Scholar] [CrossRef] [PubMed]
  15. van der Made, C.I.; Netea, M.G.; van der Veerdonk, F.L.; Hoischen, A. Clinical implications of host genetic variation and susceptibility to severe or critical COVID-19. Genome Med. 2022, 14, 96. [Google Scholar] [CrossRef] [PubMed]
  16. Khanmohammadi, S.; Rezaei, N. Role of Toll-like receptors in the pathogenesis of COVID-19. J. Med. Virol. 2021, 93, 2735–2739. [Google Scholar] [CrossRef] [PubMed]
  17. Novelli, G.; Biancolella, M.; Mehrian-Shai, R.; Colona, V.L.; Brito, A.F.; Grubaugh, N.D.; Vasiliou, V.; Luzzatto, L.; Reichardt, J.K.V. COVID-19 one year into the pandemic: From genetics and genomics to therapy, vaccination, and policy. Hum. Genom. 2021, 15, 27. [Google Scholar] [CrossRef]
  18. Petes, C.; Odoardi, N.; Gee, K. The Toll for Trafficking: Toll-Like Receptor 7 Delivery to the Endosome. Front. Immunol. 2017, 8, 1075. [Google Scholar] [CrossRef]
  19. van der Made, C.I.; Simons, A.; Schuurs-Hoeijmakers, J.; van den Heuvel, G.; Mantere, T.; Kersten, S.; van Deuren, R.C.; Steehouwer, M.; van Reijmersdal, S.V.; Jaeger, M.; et al. Presence of Genetic Variants among Young Men with Severe COVID-19. JAMA 2020, 324, 663–673. [Google Scholar] [CrossRef]
  20. Solanich, X.; Vargas-Parra, G.; van der Made, C.I.; Simons, A.; Schuurs-Hoeijmakers, J.; Antolí, A.; Del Valle, J.; Rocamora-Blanch, G.; Setién, F.; Esteller, M.; et al. Genetic Screening for TLR7 Variants in Young and Previously Healthy Men with Severe COVID-19. Front. Immunol. 2021, 12, 719115. [Google Scholar] [CrossRef]
  21. Peckham, H.; de Gruijter, N.M.; Raine, C.; Radziszewska, A.; Ciurtin, C.; Wedderburn, L.R.; Rosser, E.C.; Webb, K.; Deakin, C.T. Male sex identified by global COVID-19 meta-analysis as a risk factor for death and ITU admission. Nat. Commun. 2020, 11, 6317. [Google Scholar] [CrossRef] [PubMed]
  22. Zaher, K.; Basingab, F.; Alrahimi, J.; Basahel, K.; Aldahlawi, A. Gender Differences in Response to COVID-19 Infection and Vaccination. Biomedicines 2023, 11, 1677. [Google Scholar] [CrossRef] [PubMed]
  23. Peters, S.A.E.; MacMahon, S.; Woodward, M. Obesity as a risk factor for COVID-19 mortality in women and men in the UK biobank: Comparisons with influenza/pneumonia and coronary heart disease. Diabetes Obes. Metab. 2021, 23, 258–262. [Google Scholar] [CrossRef] [PubMed]
  24. Yang, R.; Mei, H.; Zheng, T.; Fu, Q.; Zhang, Y.; Buka, S.; Yao, X.; Tang, Z.; Zhang, X.; Qiu, L.; et al. Pregnant women with COVID-19 and risk of adverse birth outcomes and maternal-fetal vertical transmission: A population-based cohort study in Wuhan, China. BMC Med. 2020, 18, 330. [Google Scholar] [CrossRef] [PubMed]
  25. Tsukahara, Y.; Hieda, Y.; Takayanagi, S.; Macznik, A. Risk Factors for Contracting COVID-19 and Changes in Menstrual and Sleep Cycles in Japanese Female Athletes during the COVID-19 Pandemic. Sports 2022, 10, 114. [Google Scholar] [CrossRef] [PubMed]
  26. Lim, S.; Sohn, M. How to cope with emerging viral diseases: Lessons from South Korea’s strategy for COVID-19, and collateral damage to cardiometabolic health. Lancet Reg. Health West. Pac. 2023, 30, 100581. [Google Scholar] [CrossRef]
  27. van der Sluis, R.M.; Cham, L.B.; Gris-Oliver, A.; Gammelgaard, K.R.; Pedersen, J.G.; Idorn, M.; Ahmadov, U.; Hernandez, S.S.; Cémalovic, E.; Godsk, S.H.; et al. TLR2 and TLR7 mediate distinct immunopathological and antiviral plasmacytoid dendritic cell responses to SARS-CoV-2 infection. EMBO J. 2022, 41, e109622. [Google Scholar] [CrossRef]
  28. Dyavar, S.R.; Singh, R.; Emani, R.; Pawar, G.P.; Chaudhari, V.D.; Podany, A.T.; Avedissian, S.N.; Fletcher, C.V.; Salunke, D.B. Role of toll-like receptor 7/8 pathways in regulation of interferon response and inflammatory mediators during SARS-CoV2 infection and potential therapeutic options. Biomed. Pharmacother. 2021, 141, 111794. [Google Scholar] [CrossRef]
  29. Bomba, L.; Walter, K.; Soranzo, N. The impact of rare and low-frequency genetic variants in common disease. Genome Biol. 2017, 18, 77. [Google Scholar] [CrossRef]
  30. Debnath, M.; Banerjee, M.; Berk, M. Genetic gateways to COVID-19 infection: Implications for risk, severity, and outcomes. FASEB J. 2020, 34, 8787–8795. [Google Scholar] [CrossRef]
  31. Kim, Y.C.; Jeong, B.H. Ethnic variation in risk genotypes based on single nucleotide polymorphisms (SNPs) of the interferon-inducible transmembrane 3 (IFITM3) gene, a susceptibility factor for pandemic 2009 H1N1 influenza A virus. Immunogenetics 2020, 72, 447–453. [Google Scholar] [CrossRef]
  32. Kim, Y.C.; Jeong, B.H. Strong Correlation between the Case Fatality Rate of COVID-19 and the rs6598045 Single Nucleotide Polymorphism (SNP) of the Interferon-Induced Transmembrane Protein 3 (IFITM3) Gene at the Population-Level. Genes 2020, 12, 42. [Google Scholar] [CrossRef]
  33. Kim, Y.C.; Jeong, M.J.; Jeong, B.H. Strong association of regulatory single nucleotide polymorphisms (SNPs) of the IFITM3 gene with influenza H1N1 2009 pandemic virus infection. Cell. Mol. Immunol. 2020, 17, 662–664. [Google Scholar] [CrossRef]
  34. Kim, Y.C.; Jeong, M.J.; Jeong, B.H. Genetic association between the rs12252 SNP of the interferon-induced transmembrane protein gene and influenza A virus infection in the Korean population. Mol. Cell. Toxicol. 2021, 17, 51–57. [Google Scholar] [CrossRef] [PubMed]
  35. Kim, Y.C.; Won, S.Y.; Jeong, B.H. The first association study of single-nucleotide polymorphisms (SNPs) of the IFITM1 gene with influenza H1N1 2009 pandemic virus infection. Mol. Cell. Toxicol. 2021, 17, 179–186. [Google Scholar] [CrossRef] [PubMed]
  36. Huang, S.; Wei, W.; Yun, Y. Upregulation of TLR7 and TLR3 gene expression in the lung of respiratory syncytial virus infected mice. Wei Sheng Wu Xue Bao 2009, 49, 239–245. [Google Scholar]
  37. Alseoudy, M.M.; Elgamal, M.; Abdelghany, D.A.; Borg, A.M.; El-Mesery, A.; Elzeiny, D.; Hammad, M.O. Prognostic impact of toll-like receptors gene polymorphism on outcome of COVID-19 pneumonia: A case-control study. Clin. Immunol. 2022, 235, 108929. [Google Scholar] [CrossRef] [PubMed]
  38. El-Hefnawy, S.M.; Eid, H.A.; Mostafa, R.G.; Soliman, S.S.; Omar, T.A.; Azmy, R.M. COVID-19 susceptibility, severity, clinical outcome and Toll-like receptor (7) mRNA expression driven by TLR7 gene polymorphism (rs3853839) in middle-aged individuals without previous comorbidities. Gene Rep. 2022, 27, 101612. [Google Scholar] [CrossRef]
  39. Patel, V.K.; Paudel, K.R.; Shukla, S.D.; Liu, G.; Oliver, B.G.; Hansbro, P.M.; Dua, K. Toll-like receptors, innate immune system, and lung diseases: A vital trilateral association. EXCLI J. 2022, 21, 519–523. [Google Scholar] [CrossRef]
  40. Møller-Larsen, S.; Nyegaard, M.; Haagerup, A.; Vestbo, J.; Kruse, T.A.; Børglum, A.D. Association analysis identifies TLR7 and TLR8 as novel risk genes in asthma and related disorders. Thorax 2008, 63, 1064–1069. [Google Scholar] [CrossRef] [PubMed]
  41. Roponen, M.; Yerkovich, S.T.; Hollams, E.; Sly, P.D.; Holt, P.G.; Upham, J.W. Toll-like receptor 7 function is reduced in adolescents with asthma. Eur. Respir. J. 2010, 35, 64–71. [Google Scholar] [CrossRef]
  42. Zhang, Q.; Qian, F.; Zhou, L.; Wei, G.; Wang, Y.; Hu, Z.; Jin, G.; Bai, J.; Yin, K. Polymorphisms of TLR7 and TLR8 associated with risk of asthma and asthma-related phenotypes in a southeastern Chinese Han population. J. Nanjing Med. Univ. 2009, 23, 25–32. [Google Scholar] [CrossRef]
  43. Nilsson, D.; Andiappan, A.K.; Halldén, C.; De Yun, W.; Säll, T.; Tim, C.F.; Cardell, L.-O. Toll-like receptor gene polymorphisms are associated with allergic rhinitis: A case control study. BMC Med. Genet. 2012, 13, 66. [Google Scholar] [CrossRef]
  44. Kennedy, R.B.; Ovsyannikova, I.G.; Haralambieva, I.H.; O’Byrne, M.M.; Jacobson, R.M.; Pankratz, V.S.; Poland, G.A. Multigenic control of measles vaccine immunity mediated by polymorphisms in measles receptor, innate pathway, and cytokine genes. Vaccine 2012, 30, 2159–2167. [Google Scholar] [CrossRef] [PubMed]
  45. Stark, J.R.; Wiklund, F.; Grönberg, H.; Schumacher, F.; Sinnott, J.A.; Stampfer, M.J.; Mucci, L.A.; Kraft, P. Toll-like receptor signaling pathway variants and prostate cancer mortality. Cancer Epidemiol. Biomark. Prev. 2009, 18, 1859–1863. [Google Scholar] [CrossRef]
  46. Alhabibi, A.M.; Hassan, A.S.; Elbaky, N.M.A.; Eid, H.A.; Khalifa, M.; Wahab, M.A.; Althoqapy, A.A.; Abdou, A.E.; Zakaria, D.M.; Nassef, E.M.; et al. Impact of Toll-Like Receptor 2 and 9 Gene Polymorphisms on COVID-19: Susceptibility, Severity, and Thrombosis. J. Inflamm. Res. 2023, 16, 665–675. [Google Scholar] [CrossRef]
  47. Alaa, A.; Sarhan, N.; El-Ansary, M.G.L.; Bazan, N.S.; Farouk, K.; Ismail, R.S.; Schalaan, M.F.; Abd-Allah, A.R.A. Association between genetic polymorphism, severity, and treatment response among COVID-19 infected Egyptian patients. Front. Pharmacol. 2023, 14, 1209286. [Google Scholar] [CrossRef]
  48. Salamaikina, S.; Karnaushkina, M.; Korchagin, V.; Litvinova, M.; Mironov, K.; Akimkin, V. TLRs Gene Polymorphisms Associated with Pneumonia before and during COVID-19 Pandemic. Diagnostics 2022, 13, 121. [Google Scholar] [CrossRef] [PubMed]
Diagnostics 13 03510 g001
Figure 1. Identification of genetic polymorphisms of the human TLR7 gene in healthy and COVID-19 patients. (A) Simplified the sequenced region map of the human TLR7 gene. The edged horizontal bar indicates the regions sequenced (3387 bp). Vertical lines indicate the genetic polymorphism identified in this study. (B) Electropherograms of a rare single nucleotide polymorphism (SNP) of the TLR7 gene found in the current study. The colors of the peaks indicate each base of nucleotides (green: adenine; red: thymine; blue: cytosine; and black: guanine).
Figure 1. Identification of genetic polymorphisms of the human TLR7 gene in healthy and COVID-19 patients. (A) Simplified the sequenced region map of the human TLR7 gene. The edged horizontal bar indicates the regions sequenced (3387 bp). Vertical lines indicate the genetic polymorphism identified in this study. (B) Electropherograms of a rare single nucleotide polymorphism (SNP) of the TLR7 gene found in the current study. The colors of the peaks indicate each base of nucleotides (green: adenine; red: thymine; blue: cytosine; and black: guanine).
Diagnostics 13 03510 g001
Table 1. Detailed information on the study population.
Table 1. Detailed information on the study population.
CharacteristicsHealthy ControlsCOVID-19 Patientsp-Value
Number, n9087
Age, median (IQR)61.0 (49.2–71.7)55.0 (45–68)0.11
Table 2. Primers used to cover the coding region of the human TLR7 gene.
Table 2. Primers used to cover the coding region of the human TLR7 gene.
Primer NameForwardReverseAmp. SizeAnn. Temp.
CDS 1GGTTGGGGATGCTGTTTAGAGTAGGGACGGCTGTGACATT 806 bp58 °C
CDS 2TCTACCTGGGCCAAAACTGTCAGGACCTGGGGTTCATAACT851 bp58 °C
CDS 3TGAAGTTGGCTTCTGCTCAACAGTGGTCAGTTGGTTGTGG821 bp58 °C
CDS 4CCTGGAAACTTTGGACCTCAGCTGTATGCTCTGGGAAAGG746 bp58 °C
CDS 5GGCCAAGATAAAGGGGTATCACAAAACACGCTTTTGGTGTG619 bp58 °C
Coding sequence (CDS).
Table 3. Comparison of genotype and allele frequencies of the TLR7 low-frequency polymorphism between healthy controls and COVID-19-affected patients.
Table 3. Comparison of genotype and allele frequencies of the TLR7 low-frequency polymorphism between healthy controls and COVID-19-affected patients.
Variant Genotype Frequency, n (%)p-ValueAllele Frequency, n (%)p-ValueHWE
c.20330G>A
rs864058		 GGGAAA1GA1
Controls89 (98.88)1 (1.11)0 (0)179 (99.44)1 (0.55)0.9577
Patients86 (98.85)1 (1.14)0 (0)173 (99.42)1 (0.57)0.9570
Hardy–Weinberg equilibrium (HWE).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zayed, M.; Kim, Y.-C.; Lee, C.-S.; Jeong, B.-H. No Association between SARS-CoV-2 Infection and the Polymorphism of the Toll-like Receptor 7 (TLR7) Gene in Female Population. Diagnostics 2023, 13, 3510. https://doi.org/10.3390/diagnostics13233510

AMA Style

Zayed M, Kim Y-C, Lee C-S, Jeong B-H. No Association between SARS-CoV-2 Infection and the Polymorphism of the Toll-like Receptor 7 (TLR7) Gene in Female Population. Diagnostics. 2023; 13(23):3510. https://doi.org/10.3390/diagnostics13233510

Chicago/Turabian Style

Zayed, Mohammed, Yong-Chan Kim, Chang-Seop Lee, and Byung-Hoon Jeong. 2023. "No Association between SARS-CoV-2 Infection and the Polymorphism of the Toll-like Receptor 7 (TLR7) Gene in Female Population" Diagnostics 13, no. 23: 3510. https://doi.org/10.3390/diagnostics13233510

APA Style

Zayed, M., Kim, Y. -C., Lee, C. -S., & Jeong, B. -H. (2023). No Association between SARS-CoV-2 Infection and the Polymorphism of the Toll-like Receptor 7 (TLR7) Gene in Female Population. Diagnostics, 13(23), 3510. https://doi.org/10.3390/diagnostics13233510

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop