Next Article in Journal
Serum Vitamin D Concentration Is Lower in Patients with Tinnitus: A Meta-Analysis of Observational Studies
Previous Article in Journal
Diagnosis and Management of Esophagogastric Varices
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diagnostics
Volume 13
Issue 6
10.3390/diagnostics13061036
diagnostics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Prevalence of Virulence Factor Genes among Carbapenem-Non-Susceptible Acinetobacter baumannii Clinical Strains and Their Usefulness as Potential Molecular Biomarkers of Infection

by
Dagmara Depka
1,2,*,
Tomasz Bogiel
1,2,*,
Mateusz Rzepka
1,2 and
Eugenia Gospodarek-Komkowska
1,2
1
Microbiology Department, Ludwik Rydygier Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toruń, 85-094 Bydgoszcz, Poland
2
Department of Clinical Microbiology, Antoni Jurasz University Hospital No. 1, 85-094 Bydgoszcz, Poland
*
Authors to whom correspondence should be addressed.
Diagnostics 2023, 13(6), 1036; https://doi.org/10.3390/diagnostics13061036
Submission received: 16 January 2023 / Revised: 25 February 2023 / Accepted: 6 March 2023 / Published: 8 March 2023
(This article belongs to the Section Diagnostic Microbiology and Infectious Disease)
Review Reports Versions Notes

Abstract

:
Healthcare-associated infections caused by multidrug-resistant Acinetobacter baumannii strains are a serious global threat. Therefore, it is important to expand the knowledge on the mechanisms of pathogenicity of these particular bacteria. The aim of this study was to assess the distribution of selected virulence factor genes (bap, surA1, omp33-36, bauA, bauS, and pld) among carbapenem-non-susceptible clinical A. baumannii isolates and to evaluate their potential usefulness as genetic markers for rapid diagnostics of A. baumannii infections. Moreover, we aimed to compare the virulence genes prevalence with the occurrence of carbapenemases genes. A total of 100 carbapenem-non-susceptible A. baumannii clinical isolates were included in the study. The presence of virulence factors and blaOXA genes was evaluated by real-time PCR. The occurrence of virulence factors genes was as follows: 100.0% for the bap and surA1 genes, 99.0% for the basD and pld genes. The bauA and omp33-36 genes were absent among the studied strains. The predominant genes (bap and surA1) are involved in biofilm formation and their presence among all clinical strains can be applied as a genetic marker to recognize A. baumannii infection. High frequencies of the basD gene—involved in siderophore biosynthesis and the gene encoding phospholipase D (pld)—were also noted among blaOXA-positive strains, showing their potential role in a pathogenicity of blaOXA-positive A. baumannii clinical strains.

1. Introduction

Acinetobacter baumannii are non-fermenting, aerobic Gram-negative rods [1]. Due to their ability to survive in a hospital environment, these bacteria mainly cause healthcare-associated infections (HAIs) [2]. Ventilator-associated pneumonia (VAP) and bacteriaemia are the most common infections caused by them, with highest mortality rates [3].
An increasing threat of A. baumannii infections is related to a high percentage of antimicrobial-resistant isolates. Therefore, Rice et al. [4] included A. baumannii representatives into a group of bacteria known as ESKAPE (among Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Enterobacter spp.). This acronym describes bacteria that can easily avoid the effects of antimicrobials treatment. Moreover, in 2017, the World Health Organization recognized carbapenem-resistant A. baumannii (CRAb) as critical pathogens for which profound research and development of effective drugs are needed [5].
A. baumannii strains possess many intrinsic resistance mechanisms. Moreover, due to the plasticity of their genome, they also easily acquire new mechanisms, such as genes encoding antibiotic hydrolyzing enzymes [6], with carbapenem-hydrolyzing class D beta-lactamases (CHDLs, oxacillinases) prevailing among these bacteria. Among the aforementioned enzymes, the most prevalent oxacillinases families are chromosomally encoded OXA-51-like and the following enzymes encoded on mobile genetics elements (plasmids, transposons): OXA-23-like, OXA-40/24-like, OXA-58-like, OXA-143-like, and OXA-235-like carbapenemases [7].
The pathogenicity of A. baumannii is determined by factors involved in the following processes: bacteria transmission, binding to host structures, human cells damage and invasion [8]. In turn, bacterial viability in the hospital environment is associated the most with A. baumannii biofilm formation. Proteins and structures involved in biofilm formation are mainly: pili, outer membrane proteins (surface antigen protein 1—SurA1), and adhesins (biofilm-associated protein—Bap). As it has been previously shown, Bap is involved in intercellular adhesion, ensuring the maturation of biofilm on biotic and abiotic surfaces, with mutations in the bap gene causing a weakening of adhesive capacity of A. baumannii strains [9].
Bacterial porins are involved in adhesion and they have also been shown to play a crucial role in an apoptosis process. The 33-36-kDa Omp protein (Omp 33-36) is a water channel in A. baumannii cells and plays a role in apoptosis and modulates autophagy. The Omp 33-36 is released into the host cells inside the outer membrane vesicles. This protein has also been shown to have an effect on DNA fragmentation in HeLa and Hep-2 cells lines [10,11].
Bacterial cells, during the proceeding infection, have limited access to iron, which is important for their viability. Most bacteria, including A. baumannii, obtain iron within siderophores. Acinetobactin is the most important siderophore among A. baumannii strains [1]. BauS and BauA proteins are needed for acinetobactin biosynthesis and transport, respectively. These proteins have also been shown to play a vital role in the apoptotic death of epithelial cells [12].
Phosphatidylcholine (PC) is one of the phospholipids that builds the cell membrane of eukaryotic cells; among lung structures, almost 80% of all phospholipids are PC compounds, which is very important due to the localization of the majority of infections (VAP). A. baumannii cells synthesize phospholipases (e.g., phospholipase D—PLD) that hydrolyze PC and alter the permeability of the host cell membrane [13,14].
The investigated virulence genes are all chromosomally encoded and play a role inbacterial viability. In the relevant literature, there is a lack of information on the transfer of these genes between species, except for the plasmid-encoded blaOXA genes, which can potentially be transferred between bacteria [7].
The aims of the study were to: assess the frequency of the selected virulence genes presence (bap, surA1, omp33-36, bauA, bauS, and pld) involved in pathogenicity of CRAb clinical strains and to evaluate their potential usefulness as genetic markers for rapid diagnostics of A. baumannii infections. The objective of the study was also to investigate the prevalence of blaOXA genes among these strains and the occurrence of virulence factor genes among strains carrying different oxacillinases genes.

2. Materials and Methods

2.1. Bacterial Isolates and Their Origin

The study included 100 CRAb clinical strains. They were all isolated in the Clinical Microbiology Department from different patients hospitalized at University Hospital No. 1 in Bydgoszcz, Poland, between 2017 and 2020. In total, 63 (63.0%) strains were derived from the patients of the Anesthesiology and Intensive Care Unit (for the detailed origin of the strains, see Table S1).
A. baumannii strains were isolated from various clinical specimen types, mainly from respiratory tract infections (RTIs) (n = 46) (for the detailed data, see Table S2).
The studied strains were identified using MALDI-TOF MS (Bruker, Mannheim, Germany) in a routine laboratory diagnostic procedure according to the manufacturer’s protocol. The MALDI Biotyper software version 4.2.28 was used for bacterial identification. The cut-off scores for identification were as follows: ≥1.7—a reliable identification to the genus level, rate ≥ 1.7—a reliable identification to the species level. In the current study, scores above 2.0 were reached for every strain. The bacterial test standard (BTS, Bruker, Mannheim, Germany) was used as identification quality control.
The isolates were stored in Brain Heart Infusion (Becton, Dickinson and Company, Sparks, MD, USA) with 15% glycerol (Sigma-Aldrich, St. Louis, MO, USA) at −80 °C and were grown on MacConkey Agar (Becton, Dickinson and Company, Sparks, MD, USA) before the testing.

2.2. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility testing (AST) of the studied isolates was performed with BD Phoenix™ M50 NMIC-402 panels (Becton, Dickinson and Company, Sparks, MD, USA) in a routine laboratory diagnostic scheme. The results of AST were interpreted according to the European Committee on Antimicrobial Susceptibility Testing recommendation v 13.0 (EUCAST). P. aeruginosa ATCC 27853 and Escherichia coli ATCC 25922 were used as quality control strains, according to EUCAST recommendations [15].
The classifications of the strains into multidrug-resistant (MDR) and pandrug-resistant (PDR) groups were as follows: MDR—strains resistant to at least three of the tested antimicrobials belonging to separate antibiotic groups, and PDR—strains resistant to all of the tested antimicrobials [16].

2.3. DNA Extraction, Virulence Factor, and blaOXA Genes Detection

DNA samples from the investigated A. baumannii strains were isolated using the Genomic Mini kit (A&A Biotechnology, Gdansk, Poland) according to the manufacturer’s protocol. DNA was stored at −20 °C before the examination.
The virulence factors and blaOXA genes were detected by real-time PCR with the LightCycler 480 II (Roche, Basel, Switzerland) and CFX OPUS 96 (Bio-Rad, Hercules, CA, USA). The specification of primers used in the study is summarized in Table 1. Final volume of each reaction was 20 µL. The reagents were used as follows: 4 µL of 5 × HOT FIREPOL® EvaGreen® Mix (SolisBiodyne, Tartu, Estonia), 5 µL of molecular biology grade water (EurX, Gdansk, Poland), 5 µL (0.25 µM/reaction) of each primer (Genomed, Warsaw, Poland), and 1 µL of the DNA extracted from the investigated isolates. The following temperature conditions were applied: one cycle at 95 °C for 12 min, followed by 40 cycles at 95 °C for 15 s, annealing temperature (depending on the detected gene, see Table 1) for 20 s, and the final elongation—72 °C for 20 s. The data collection was enabled at each extension step. The melt curve protocol was added afterwards—95 °C for 5 s and 60 °C for 1 min—followed by data acquisition at 0.11 °C increments between 60 °C and 97 °C to confirm the specificity of the amplification product (for the results, see Figures S1–S16). The data collection was enabled continuously at each increment during the temperature change (high-resolution melting).
The DNA extracted form A. baumannii DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Germany) 30008 and A. baumannii DSMZ 102930 were used as the reference strains (positive controls) for the investigated genes presence (the distribution of virulence factors genes among the references A. baumannii strains are shown in Table S3). The molecular biology grade water (EurX, Gdansk, Poland) was used as a negative control (NTC).

2.4. Statistical Data Analysis

Statistical analysis was performed using the Statistica™ 13.3 (TIBCO Software Inc., Palo Alto, CA, USA) program, using Spearman’s rank-order correlation test to investigate the correlation for particular genes’ coexistence and the strains origin (p ≤ 0.05). An interpretation of Spearman’s rank-order correlation test was as follows: for r < 0.2—no correlation observed; 0.2–0.4—weak correlation; 0.4–0.7—moderate correlation; 0.7–0.9—strong correlation; >0.9—very strong correlation.

3. Results

3.1. Antimicrobial Susceptibility

All the tested A. baumannii isolates were non-susceptible to carbapenems and showed a high percentage of resistance to most of the antimicrobial agents tested. Except for colistin, the in vitro activity of other antimicrobial agents was relatively low (with about 20% strains susceptible to aminoglycosides). All of the strains belonged to MDR, while 6 (6.0%) were additionally PDR. Antimicrobial susceptibility results of the studied strains are shown in Table 2.

3.2. blaOXA Genes Presence

Among the studied strains, blaOXA-40 and blaOXA-23 were detected in 62 (62.0%) and 35 (35.0%) isolates, respectively. Very strong negative correlation was revealed between the occurrence of both genes (r = −0.937306).
blaOXA genes were not detected in three (3.0%) isolates. These were the only CRAb strains without already known carbapenemases that were available during the study and therefore included in the study. One of them was susceptible, with increased exposure to imipenem and meropenem, while the second one was susceptible, with increased exposure to imipenem and susceptible to meropenem. The distribution of susceptibility profiles for the investigated strains is shown in Table 3. Twenty antimicrobial susceptibility profiles were distinguished. The profile of susceptibility to colistin was the only one (44.0%) that was most prevalent, regardless of the blaOXA genes detected.
There was a weak positive correlation between the presence of the blaOXA-23 gene and the strains’ origin from RTI cases (r = 0.24819). The blaOXA-40-positive isolates were derived statistically more often from other sites of infections—very weak positive correlation (r = 0.22818). The detailed prevalence of the blaOXA genes in A. baumannii in relation to the strains’ origin is shown in Table 4.

3.3. Virulence Factor Genes Presence and Co-Existence

The prevalence of virulence factors genes was as follows: 100 (100.0%) for the bap and surA1 genes, 99 (99.0%) for the basD and pld genes. The bauA and omp33-36 genes were not detected among the studied strains. Table 5 shows the occurrence of virulence factors genes with relation to the detected carbapenemase gene.
There were no statistically significant differences between the detected carbapenemase gene and the particular virulence factor gene presence (Spearman’s rank-order correlation below 0.2). The only difference was shown for the two blaOXA-23-positive isolates, one of which was absent for the basD gene, while the other lacked the pld gene.

4. Discussion

HAIs caused by CRAb are a global problem due to limited therapeutic options for their treatment. A. baumannii strains are persistent in the hospital environment due to the development of resistance mechanisms to disinfection and a high survival rate in dry environments [22]. The CRAb strains account for almost 90% of A. baumannii infections in some countries, mostly in southern Europe and Asia [23]. Moreover, the European Center for Disease Prevention and Control report in 2021 highlights the increased isolation rate of Acinetobacter spp., mainly A. baumannii complex representatives, during the two years of the pandemic (2020–2021). The reason might have been that more patients were mechanically ventilated in the aforementioned time period due to Coronavirus disease [24].
A. baumannii strains frequently exhibit antimicrobial susceptibility profiles categorized as MDR or even PDR. In our study, six (6.0%) of the isolates were PDR. Resistance to carbapenems is often connected with lack of susceptibility to other groups of antibiotics (e.g., fluoroquinolones) [25]. In our study, 100% of CRAbs were simultaneously resistant to fluoroquinolones, only about 20% of isolates were susceptible to aminoglycosides, which correlates with the reports of other researchers [26,27]. Therefore, the only treatment option for the infections with this etiology is often colistin [28]. This is in concordance with the results of our study, with the most prevalent antimicrobial susceptibility profile consisting of the strains exclusively susceptible to colistin.
The overuse of antibiotics, such as carbapenems, results in CRAb selection [29]. The most prevalent mechanisms of carbapenem resistance among A. baumannii isolates are CHDLs, with OXA-23 occurring the most often among A. baumannii worldwide [30,31]. Meanwhile, the results of our study showed that in our region, OXA-40-positive isolates are dominant, which is consistent with other studies conducted in Poland [32]. In our study, no isolates were simultaneously positive for both tested blaOXA genes.
The main factor in the early stages of pathogenicity and persistence of A. baumannii strains is biofilm formation. Bap is a factor involved in biofilm synthesis, but also in an adhesion to epithelial cells and abiotic surfaces [33]. The results of our study show that all A. baumannii isolates carried the bap gene, which makes this gene useful as one of the markers of A. baumannii infections. Our findings are similar to the results obtained by Monfared et al. [34]. They have also shown that the bacteria lacking the bap gene are incapable of biofilm synthesis. Of note, the isolates used in this study were derived from specific clinical specimens (mostly broncho-alveolar lavage and wound swabs) where the biofilm formation is crucial for an infection initiation.
The outer membrane protein also involved in biofilm formation, adhesion, and serum resistance is a surface antigen protein 1 (surA1) [18]. Liu et al. described that 100.0% of MDR and 83.3% of non-MDR A. baumannii isolates carry the surA1 gene [20]. The results of the aforementioned study are similar with our observations; all the tested isolates were positive for the surA1 gene, also making this gene a potential biomarker of infections with this etiology.
Interestingly, due to the fact that the presence of the bap and surA1 genes is noted in all of the clinical strains, they can be altogether used as a genetic marker to confirm A. baumannii infection, with an application using molecular biology methods, however, this observation requires further research.
Outer membrane protein 33-36 (omp 33-36) is involved in adherence, invasion, and cytotoxicity to human epithelial cells [10,11]. The previous study showed that the decrease expression of Omp33-36 could be also associated with imipenem resistance [35]. None of the A. baumannii tested in this study possessed this gene, but all were non susceptible to imipenem. In turn, other researchers have shown that there is no statistically significant difference in the frequency of this gene among CARb and non-CRAb strains [20].
Phospholipase D is an enzyme involved in serum resistance and invasion due to hydrolysis of phospholipids which build the host cell membrane [13]. Phospholipase D cleaves off a head group of phospholipids and could interfere with the immune system response [1]. The results of our study indicate a high prevalence of the pld gene (99.0%) among CRAb strains, which is similar to the results of the previous study [20]. Therefore, it has been concluded that phospolipase D may play an important role in the pathogenesis of A. baumannii infections.
The system of iron acquisition in A. baumannii is based on the production of low-molecular iron-specific chelators—siderophores. The best known siderophore, produced by A. baumannii strains, is acinetobactin. The biosynthesis of acinetobactin is accomplished by the proteins BasA–D and BasF–J [36]. Siderophores enter the bacterial cell in an active transport way, for which appropriate receptors on the cell membrane are needed, e.g., BauA is a receptor for acinetobactin. One of the previous studies showed a high prevalence of gene encoding BauA (bauA) especially among MDR isolates [37]. Our results are contradictory—no isolates with the bauA gene were detected. In turn, the basD gene was detected in 99.0% of isolates and this is in line with the results of other studies, showing basD more often (92.0%) than bauA (62.5%) among MDR isolates [20]. Porbaran et al. [38] showed the prevalence of basD and bauA in a lower percentage of A. baumannii isolates among 12.5% and 15.2%, respectively. This is more concordant with the results of our study. They also showed a strong correlation between the prevalence of metallo-beta-lactamases and AmpC genes and the occurrence of genes involved in the iron/siderophore uptake system. The genes encoding the acinetobactin metabolism protein are normally located within the Acinetobactin Cluster, meanwhile Eijkelkamp et al. [39] described that the A. baumannii SDF isolate lacks the Acinetobactin gene cluster. This may be one of the explanations why the bauA gene was not detected among any of the isolates included into our study.
All the investigated genes encode proteins involved in the viability and pathogenicity of A. baumannii. In this study, we only examined the pathogenic potential of the tested strains, however, evaluating the presence of these genes among clinical A. baumannii isolates gives better insight into their molecular characteristics. A potential importance of particular genes as biomarkers of these pathogens was also underlined, however, more research is needed to investigate the actual significance of these virulence factors, for example, the ability to biofilm synthesis or assessing the expression levels of the genes studied.
A limitation of this study was that only carbapenem-non-susceptible A. baumannii strains were considered. However, they are definitely the most prevalent isolates worldwide and therefore the most promising study objects. Nevertheless, in order to complete the data on the distribution of virulence factor genes, it would be preferable to investigate carbapenem-susceptible isolates also. However, due to such widespread presence of MDR and PDR A. baumannii isolates, the multidrug-susceptible strains are currently not easily reachable.
To the best of our knowledge, this is the first work showing the prevalence of virulence factors genes in terms of the presence of blaOXA genes among A. baumannii isolates derived from patients hospitalized in Poland. Definite further studies on this issue are necessary, e.g., genes presence confirmation by DNA sequencing, testing for more clinically threatening beta-lactamases such as OXA-48 or NDM-1. However, there are no statistically significant differences or obvious correlations between the presence of virulence factor genes and blaOXA genes. Comparing the result of our study to the studies of other researchers, it can be concluded that the omp33-36 and bauA genes are not essential for the pathogenesis of infections caused by blaOXA-positive A. baumannii clinical isolates, at least for the infections localized in the sites considered in the present study.

5. Conclusions

The most prevalent virulence factors genes among studied A. baumannii isolates are the bap and surA1 genes. These genes, especially their co-existence, could be used as biomarkers for the diagnostics of A. baumannii infections. A high percentage of the gene encoding a protein involved in the biosynthesis of the siderophore (acinetobactin)—basD is also observed among A. baumannii. Meanwhile, the bauA gene—encoding the transport protein for acinetobactin is absent among carbapenem-non-susceptible isolates. Therefore, there is a possibility of another pathway for the siderophore transport for this particular group of A. baumannii strains.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/diagnostics13061036/s1, Table S1: The origin of Acinetobacter baumannii (n = 100) clinical strains used in the study (units); Table S2: The origin of Acinetobacter baumannii (n = 100) strains included in the study (specimen types); Table S3: The distribution of virulence factors genes among the reference Acinetobacter baumannii strains; Figure S1: Picture of amplification curves showing results of real-time PCR for the bap gene detection—LightCycler 480 II (Roche, Basel, Switzerland); Figure S2: An example of picture showing melting peaks of the real-time PCR product specificity for the bap gene—LightCycler 480 II (Roche, Basel, Switzerland); Figure S3: Picture of amplification curves showing results of real-time PCR for the surA1 gene detection—LightCycler 480 II (Roche, Basel, Switzerland); Figure S4: An example of picture showing melting peaks of the real-time PCR product specificity for the surA1 gene—LightCycler 480 II (Roche, Basel, Switzerland); Figure S5: Picture of amplification curves showing results of real-time PCR for the basD gene detection—LightCycler 480 II (Roche, Basel, Switzerland); Figure S6: An example of picture showing melting peaks of the real-time PCR product specificity for the basD gene—LightCycler 480 II (Roche, Basel, Switzerland); Figure S7: Picture of amplification curves showing results of real-time PCR for the bauA gene detection—CFX OPUS 96 (Bio-Rad, Hercules, CA, USA); Figure S8: An example of picture showing melting peaks of the real-time PCR product specificity for the bauA gene—CFX OPUS 96 (Bio-Rad, Hercules, CA, USA); Figure S9: Picture of amplification curves showing results of real-time PCR for the pld gene detection—CFX OPUS 96 (Bio-Rad, Hercules, CA, USA); Figure S10: An example of picture showing melting peaks of the real-time PCR product specificity for the pld gene—CFX OPUS 96 (Bio-Rad, Hercules, CA, USA); Figure S11: Picture of amplification curves showing results of real-time PCR for the omp33-36 gene detection—CFX OPUS 96 (Bio-Rad, Hercules, CA, USA); Figure S12: An example of picture showing melting peaks of the real-time PCR product specificity for the omp33-36 gene—CFX OPUS 96 (Bio-Rad, Hercules, CA, USA); Figure S13: Picture of amplification curves showing results of real-time PCR for the blaOXA-40 gene detection—LightCycler 480 II (Roche, Basel, Switzerland); Figure S14: An example of melting peaks picture showing specificity of the real-time PCR product for the blaOXA-40 gene—LightCycler 480 II (Roche, Basel, Switzerland); Figure S15: Picture of amplification curves showing results of real-time PCR for the blaOXA-23 gene detection—LightCycler 480 II (Roche, Basel, Switzerland); Figure S16: An example of picture showing melting peaks of the real-time PCR product specificity for the blaOXA-23 gene—LightCycler 480 II (Roche, Basel, Switzerland).

Author Contributions

Conceptualization, D.D.; methodology, D.D. and T.B.; software, D.D.; validation, D.D.; formal analysis, D.D. and M.R.; investigation, D.D.; resources, D.D. and T.B.; data curation, D.D. and M.R.; writing—original draft preparation, D.D.; writing—review and editing, D.D., T.B., M.R. and E.G.-K.; visualization, D.D.; supervision, T.B. and E.G.-K.; project administration, D.D.; funding acquisition, D.D. and T.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financially supported by Nicolaus Copernicus University funds for the basic research activity of the Microbiology Department Ludwik Rydygier Collegium Medicum in Bydgoszcz, Poland (PDB WF 839).

Institutional Review Board Statement

This study was approved by the Bioethics Committee of the Nicolaus Copernicus University in Toruń functioning at Collegium Medicum in Bydgoszcz; Approval Code: KB 560/2022.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on a reasonable request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Lee, C.-R.; Lee, J.H.; Park, M.; Park, K.S.; Bae, I.K.; Kim, Y.B.; Cha, C.-J.; Jeong, B.C.; Lee, S.H. Biology of Acinetobacter Bamannii: Pathogenesis, Antibiotic Resistance Mechanisms, and Prospective Treatment Options. Front. Cell. Infect. Microbiol. 2017, 7, 55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Antunes, L.C.S.; Visca, P.; Towner, K.J. Acinetobacter baumannii: Evolution of a Global Pathogen. Pathog. Dis. 2014, 71, 292–301. [Google Scholar] [CrossRef] [Green Version]
  3. Ballouz, T.; Aridi, J.; Afif, C.; Irani, J.; Lakis, C.; Nasreddine, R.; Azar, E. Risk Factors, Clinical Presentation, and Outcome of Acinetobacter baumannii Bacteremia. Front. Cell. Infect. Microbiol. 2017, 7, 156. [Google Scholar] [CrossRef]
  4. Rice, L.B. Federal Funding for the Study of Antimicrobial Resistance in Nosocomial Pathogens: No ESKAPE. J. Infect. Dis. 2008, 197, 1079–1081. [Google Scholar] [CrossRef]
  5. Tacconelli, E.; Carrara, E.; Savoldi, A.; Harbarth, S.; Mendelson, M.; Monnet, D.L.; Pulcini, C.; Kahlmeter, G.; Kluytmans, J.; Carmeli, Y.; et al. Discovery, Research, and Development of New Antibiotics: The WHO Priority List of Antibiotic-Resistant Bacteria and Tuberculosis. Lancet Infect. Dis. 2018, 18, 318–327. [Google Scholar] [CrossRef]
  6. Poirel, L.; Naas, T.; Nordmann, P. Diversity, Epidemiology, and Genetics of Class D β-Lactamases. Antimicrob. Agents Chemother. 2010, 54, 24–38. [Google Scholar] [CrossRef] [Green Version]
  7. Poirel, L.; Nordmann, P. Carbapenem Resistance in Acinetobacter baumannii: Mechanisms and Epidemiology. Clin. Microbiol. Infect. 2006, 12, 826–836. [Google Scholar] [CrossRef] [Green Version]
  8. Doi, Y.; Murray, G.L.; Peleg, A.Y. Acinetobacter baumannii: Evolution of Antimicrobial Resistance-Treatment Options. Semin. Respir. Crit. Care Med. 2015, 36, 85–98. [Google Scholar] [CrossRef] [Green Version]
  9. Longo, F.; Vuotto, C.; Donelli, G. Biofilm Formation in Acinetobacter baumannii. New Microbiol. 2014, 37, 119–127. [Google Scholar]
  10. Rumbo, C.; Tomás, M.; Fernández Moreira, E.; Soares, N.C.; Carvajal, M.; Santillana, E.; Beceiro, A.; Romero, A.; Bou, G. The Acinetobacter baumannii Omp33-36 Porin Is a Virulence Factor That Induces Apoptosis and Modulates Autophagy in Human Cells. Infect. Immun. 2014, 82, 4666–4680. [Google Scholar] [CrossRef] [Green Version]
  11. Smani, Y.; Dominguez-Herrera, J.; Pachón, J. Association of the Outer Membrane Protein Omp33 with Fitness and Virulence of Acinetobacter baumannii. J. Infect. Dis. 2013, 208, 1561–1570. [Google Scholar] [CrossRef] [Green Version]
  12. Gaddy, J.A.; Arivett, B.A.; McConnell, M.J.; López-Rojas, R.; Pachón, J.; Actis, L.A. Role of Acinetobactin-Mediated Iron Acquisition Functions in the Interaction of Acinetobacter baumannii Strain ATCC 19606T with Human Lung Epithelial Cells, Galleria Mellonella Caterpillars, and Mice. Infect. Immun. 2012, 80, 1015–1024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Jacobs, A.C.; Hood, I.; Boyd, K.L.; Olson, P.D.; Morrison, J.M.; Carson, S.; Sayood, K.; Iwen, P.C.; Skaar, E.P.; Dunman, P.M. Inactivation of Phospholipase D Diminishes Acinetobacter baumannii Pathogenesis. Infect. Immun. 2010, 78, 1952–1962. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Stahl, J.; Bergmann, H.; Göttig, S.; Ebersberger, I.; Averhoff, B. Acinetobacter baumannii Virulence Is Mediated by the Concerted Action of Three Phospholipases D. PLoS ONE 2015, 10, e0138360. [Google Scholar] [CrossRef] [PubMed]
  15. European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters Version 13.0, Valid from 2023-01-01. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_13.0_Breakpoint_Tables.pdf (accessed on 10 February 2023).
  16. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Green Version]
  17. Badmasti, F.; Siadat, S.D.; Bouzari, S.; Ajdary, S.; Shahcheraghi, F. Molecular detection of genes related to biofilm formation in multidrug-resistant Acinetobacter baumannii isolated from clinical settings. J. Med. Microbiol. 2015, 64 Pt 5, 559–564. [Google Scholar] [CrossRef]
  18. Liu, D.; Liu, Z.-S.; Hu, P.; Cai, L.; Fu, B.-Q.; Li, Y.-S.; Lu, S.-Y.; Liu, N.-N.; Ma, X.-L.; Chi, D.; et al. Characterization of Surface Antigen Protein 1 (SurA1) from Acinetobacter baumannii and Its Role in Virulence and Fitness. Vet. Microbiol. 2016, 186, 126–138. [Google Scholar] [CrossRef]
  19. Dorsey, C.W.; Tomaras, A.P.; Connerly, P.L.; Tolmasky, M.E.; Crosa, J.H.; Actis, L.A. The siderophore-mediated iron acquisition systems of Acinetobacter baumannii ATCC 19606 and Vibrio anguillarum 775 are structurally and functionally related. Microbiology 2004, 150 Pt 11, 3657–3667. [Google Scholar] [CrossRef] [Green Version]
  20. Liu, C.; Chang, Y.; Xu, Y.; Luo, Y.; Wu, L.; Mei, Z.; Li, S.; Wang, R.; Jia, X. Distribution of Virulence-Associated Genes and Antimicrobial Susceptibility in Clinical Acinetobacter baumannii Isolates. Oncotarget 2018, 9, 21663–21673. [Google Scholar] [CrossRef] [Green Version]
  21. Woodford, N.; Ellington, M.J.; Coelho, J.M.; Turton, J.F.; Ward, M.E.; Brown, S.; Amyes, S.G.B.; Livermore, D.M. Multiplex PCR for Genes Encoding Prevalent OXA Carbapenemases in Acinetobacter spp. Int. J. Antimicrob. Agents 2006, 27, 351–353. [Google Scholar] [CrossRef]
  22. Nguyen, M.; Joshi, S.G. Carbapenem Resistance in Acinetobacter baumannii, and Their Importance in Hospital-Acquired Infections: A Scientific Review. J. Appl. Microbiol. 2021, 131, 2715–2738. [Google Scholar] [CrossRef]
  23. Ma, C.; McClean, S. Mapping Global Prevalence of Acinetobacter baumannii and Recent Vaccine Development to Tackle It. Vaccines 2021, 9, 570. [Google Scholar] [CrossRef]
  24. European Centre for Disease Prevention and Control. Antimicrobial Resistance in the EU/EEA (EARS-Net)–Annual Epidemiological Report for 2021. Available online: https://www.ecdc.europa.eu/en/publications-data/surveillance-antimicrobial-resistance-europe-2021 (accessed on 10 February 2023).
  25. Vázquez-López, R.; Solano-Gálvez, S.G.; Juárez Vignon-Whaley, J.J.; Abello Vaamonde, J.A.; Padró Alonzo, L.A.; Rivera Reséndiz, A.; Muleiro Álvarez, M.; Vega López, E.N.; Franyuti-Kelly, G.; Álvarez-Hernández, D.A.; et al. Acinetobacter baumannii Resistance: A Real Challenge for Clinicians. Antibiotics 2020, 9, 205. [Google Scholar] [CrossRef] [PubMed]
  26. Castilho, S.R.A.; Godoy, C.S.D.M.; Guilarde, A.O.; Cardoso, J.L.; André, M.C.P.; Junqueira-Kipnis, A.P.; Kipnis, A. Acinetobacter baumannii Strains Isolated from Patients in Intensive Care Units in Goiânia, Brazil: Molecular and Drug Susceptibility Profiles. PLoS ONE 2017, 12, e0176790. [Google Scholar] [CrossRef] [Green Version]
  27. Bahador, A.; Farshadzadeh, Z.; Raoofian, R.; Mokhtaran, M.; Pourakbari, B.; Pourhajibagher, M.; Hashemi, F.B. Association of virulence gene expression with colistin-resistance in Acinetobacter baumannii: Analysis of genotype, antimicrobial susceptibility, and biofilm formation. Ann. Clin. Microbiol. Antimicrob. 2018, 17, 24. [Google Scholar] [CrossRef]
  28. Jain, M.; Sharma, A.; Sen, M.K.; Rani, V.; Gaind, R.; Suri, J.C. Phenotypic and Molecular Characterization of Acinetobacter baumannii Isolates Causing Lower Respiratory Infections among ICU Patients. Microb. Pathog. 2019, 128, 75–81. [Google Scholar] [CrossRef]
  29. Yang, P.; Chen, Y.; Jiang, S.; Shen, P.; Lu, X.; Xiao, Y. Association between antibiotic consumption and the rate of carbapenem-resistant Gram-negative bacteria from China based on 153 tertiary hospitals data in 2014. Antimicrob. Resist. Infect. Control 2018, 7, 137. [Google Scholar] [CrossRef]
  30. Ramirez, M.S.; Bonomo, R.A.; Tolmasky, M.E. Carbapenemases: Transforming Acinetobacter baumannii into a Yet More Dangerous Menace. Biomolecules 2020, 10, 720. [Google Scholar] [CrossRef]
  31. Vahhabi, A.; Hasani, A.; Rezaee, M.A.; Baradaran, B.; Hasani, A.; Kafil, H.S.; Soltani, E. Carbapenem Resistance in Acinetobacter baumannii Clinical Isolates from Northwest Iran: High Prevalence of OXA Genes in Sync. Iran. J. Microbiol. 2021, 13, 282–293. [Google Scholar] [CrossRef]
  32. Słoczyńska, A.; Wand, M.E.; Tyski, S.; Laudy, A.E. Analysis of BlaCHDL Genes and Insertion Sequences Related to Carbapenem Resistance in Acinetobacter baumannii Clinical Strains Isolated in Warsaw, Poland. Int. J. Mol. Sci. 2021, 22, 2486. [Google Scholar] [CrossRef]
  33. Brossard, K.A.; Campagnari, A.A. The Acinetobacter baumannii Biofilm-Associated Protein Plays a Role in Adherence to Human Epithelial Cells. Infect. Immun. 2012, 80, 228–233. [Google Scholar] [CrossRef] [Green Version]
  34. Monfared, A.M.; Rezaei, A.; Poursina, F.; Faghri, J. Detection of Genes Involved in Biofilm Formation in MDR and XDR Acinetobacter baumannii Isolated from Human Clinical Specimens in Isfahan, Iran. Arch. Clin. Infect. Dis. 2019, 14, e85766. [Google Scholar] [CrossRef] [Green Version]
  35. Uppalapati, S.R.; Sett, A.; Pathania, R. The Outer Membrane Proteins OmpA, CarO, and OprD of Acinetobacter baumannii Confer a Two-Pronged Defense in Facilitating Its Success as a Potent Human Pathogen. Front. Microbiol. 2020, 11, 589234. [Google Scholar] [CrossRef]
  36. Hasan, T.; Choi, C.H.; Oh, M.H. Genes Involved in the Biosynthesis and Transport of Acinetobactin in Acinetobacter baumannii. Genom. Inf. 2015, 13, 2–6. [Google Scholar] [CrossRef] [Green Version]
  37. Aghajani, Z.; Rasooli, I.; Mousavi Gargari, S.L. Exploitation of Two Siderophore Receptors, BauA and BfnH, for Protection against Acinetobacter baumannii Infection. Apmis 2019, 127, 753–763. [Google Scholar] [CrossRef]
  38. Porbaran, M.; Tahmasebi, H.; Arabestani, M. A Comprehensive Study of the Relationship between the Production of β-Lactamase Enzymes and Iron/Siderophore Uptake Regulatory Genes in Clinical Isolates of Acinetobacter baumannii. Int. J. Microbiol. 2021, 2021, e5565537. [Google Scholar] [CrossRef]
  39. Eijkelkamp, B.A.; Hassan, K.A.; Paulsen, I.T.; Brown, M.H. Investigation of the Human Pathogen Acinetobacter baumannii under Iron Limiting Conditions. BMC Genom. 2011, 12, 126. [Google Scholar] [CrossRef] [Green Version]
Table
Table 1. Sequences of primers applied for virulence genes detection and real-time PCR parameters used in the study.
Table 1. Sequences of primers applied for virulence genes detection and real-time PCR parameters used in the study.
Gene
Detected		Primer Sequences 5′→3′Tm (°C)Annealing Temperature (°C)References
bapF: AGTTAAAGAAGGGCAAGAAG47.758 [17]
R: GGAGCACCACCTAACTGA50.3
surA1F: CAATTGGTAGCTGGCGATCA51.858 [18]
R: TTAGGCGGGACTCAGCTTTT51.8
basDF: CTCTTGCATGGCAACACCAC53.860 [19]
R: CCAACGAGACCGCTTATGGT53.8
bauAF: TGGCAAGGTGAAAATGCACG51.860 [20]
R: GCCGCATATGCCATCAACTG53.8
pldF: CCGTCAATTACGCCAAGCTG53.860 [13]
R: CTGACGCTACCTGACGGTTT53.8
omp33-36F: ATTAGCCATGACCGGTGCTC53.860 [10]
R: CCACCCCAAACATGGTCGTA53.8
blaOXA-40F: GGTTAGTTGGCCCCCTTAA51.858 [21]
R: AGTTGAGCGAAAAGGGGATT49.7
blaOXA-23F: GATCGGATTGGAGAACCAGA50.358 [21]
R: ATTTCTGACCGCATTTCCAT47.7
F—forward primer, R—reverse primer, Tm—primer melting temperature.
Table
Table 2. Antimicrobial susceptibility of the studied strains (n = 100).
Table 2. Antimicrobial susceptibility of the studied strains (n = 100).
Number (%) of Strains
AntimicrobialSusceptibleSusceptible, Increased ExposureResistant
Imipenem (IPM)0 (0.0)2 (2.0)98 (98.0)
Meropenem (MEM)2 (2.0)1 (1.0)97 (97.0)
Gentamicin (GEN) 121 (21.9)0 (0.0)75 (78.1)
Amikacin (AMK)17 (17.0)5 (5.0)78 (78.0)
Tobramycin (NN)22 (22.0)0 (0.0)78 (78.0)
Ciprofloxacin (CIP)0 (0.0)0 (0.0)100 (100.0)
Levofloxacin (LEV)0 (0.0)0 (0.0)100 (100.0)
Trimethoprim/sulfamethoxazole (SXT)2 (2.0)0 (0.0)98 (98.0)
Colistin (COL)90 (90.0)0 (0.0)10 (10.0)
1 susceptibility to gentamicin was tested on 96 isolates.
Table
Table 3. Distribution of susceptibility profiles and oxacillinases genes among A. baumannii strains included into the study (n = 100).
Table 3. Distribution of susceptibility profiles and oxacillinases genes among A. baumannii strains included into the study (n = 100).
ProfileIPMMEMGEN 1AMKNNCIPLEVSXTCOLblaOXANumber (%) of Strains (n = 100)
IRRRRRRRRSblaOXA-2324 (24.0)
IIRRRRRRRRSblaOXA-4020 (20.0)
IIIRRSRRRRRSblaOXA-4010 (10.0)
IVRRRSSRRRSblaOXA-409 (9.0)
VRRSSSRRRSblaOXA-404 (4.0)
VIRRRIRRRRSblaOXA-404 (4.0)
VIIRRRRSRRRSblaOXA-234 (4.0)
VIIIRRSRRRRRSblaOXA-234 (4.0)
IXRRRRRRRRRblaOXA-233 (3.0)
XRRRRRRRRRblaOXA-403 (3.0)
XIRRRSSRRRRblaOXA-402 (2.0)
XIIRRRRRRRRS-1 (1.0)
XIIIRRRRRRRSSblaOXA-401 (1.0)
XIVRRRSSRRRSblaOXA-231 (1.0)
XVRRRRSRRRSblaOXA-401 (1.0)
XVIRRSRRRRRRblaOXA-401 (1.0)
XVIIIIRRRRRRS-1 (1.0)
XVIIIISRRRRRRS-1 (1.0)
XIXRSSSSRRRRblaOXA-401 (1.0)
XXRRSIRRRRSblaOXA-401 (1.0)
XXI 1RR RRRRRSblaOXA-233 (3.0)
XXII 1RR RRRRSSblaOXA-401 (1.0)
1 susceptibility to gentamicin was tested on 96 isolates, R—resistant (pink boxes), I—susceptible, increased exposure (yellow boxes), S—susceptible (green boxes), IPM—imipenem, MEM—meropenem, GEN—gentamicin, AMK—amikacin, NN—tobramycin, CIP—ciprofloxacin, LEV—levofloxacin, SXT—trimethoprim/sulfamethoxazole, COL—colistin.
Table
Table 4. The occurrence of blaOXA genes in A. baumannii with respect to strains’ origin.
Table 4. The occurrence of blaOXA genes in A. baumannii with respect to strains’ origin.
Clinical MaterialblaOXA-40blaOXA-23blaOXA-40/23-NegativeTotal (n = 100)
RTI23 (50.0%)22 (47.8%)1 (2.2%)46 (46.0%)
Other origin 139 (72.2%)13 (24.1%)2 (3.7%)54 (54.0%)
1 wound infections/pus, invasive infections, urinary tract infections, body fluids, tissue, granulation tissue, vascular catheter (for detailed data, see Table S2).
Table
Table 5. The occurrence of virulence factor genes among A. baumannii strains included in the study (n = 100).
Table 5. The occurrence of virulence factor genes among A. baumannii strains included in the study (n = 100).
Number (%) of Strains with a Particular Virulence Factor Gene
bapsurA1basDbauApldomp33-36
blaOXA-40 (n = 62)62 (100.0)62 (100.0)62 (100.0)0 (0.0)62 (100.0)0 (0.0)
blaOXA-23 (n = 35)35 (100.0)35 (100.0)34 (97.1)0 (0.0)34 (97.1)0 (0.0)
blaOXA-40/23-negative (n = 3)3 (100.0)3 (100.0)3 (100.0)0 (0.0)3 (100.0)0 (0.0)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Depka, D.; Bogiel, T.; Rzepka, M.; Gospodarek-Komkowska, E. The Prevalence of Virulence Factor Genes among Carbapenem-Non-Susceptible Acinetobacter baumannii Clinical Strains and Their Usefulness as Potential Molecular Biomarkers of Infection. Diagnostics 2023, 13, 1036. https://doi.org/10.3390/diagnostics13061036

AMA Style

Depka D, Bogiel T, Rzepka M, Gospodarek-Komkowska E. The Prevalence of Virulence Factor Genes among Carbapenem-Non-Susceptible Acinetobacter baumannii Clinical Strains and Their Usefulness as Potential Molecular Biomarkers of Infection. Diagnostics. 2023; 13(6):1036. https://doi.org/10.3390/diagnostics13061036

Chicago/Turabian Style

Depka, Dagmara, Tomasz Bogiel, Mateusz Rzepka, and Eugenia Gospodarek-Komkowska. 2023. "The Prevalence of Virulence Factor Genes among Carbapenem-Non-Susceptible Acinetobacter baumannii Clinical Strains and Their Usefulness as Potential Molecular Biomarkers of Infection" Diagnostics 13, no. 6: 1036. https://doi.org/10.3390/diagnostics13061036

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop