Target-Site Mutations and Glutathione S-Transferases Are Associated with Acequinocyl and Pyridaben Resistance in the Two-Spotted Spider Mite Tetranychus urticae (Acari: Tetranychidae)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. T. urticae Strains
2.2. Acaricides
2.3. Toxicological Assay in the Laboratory
2.3.1. T. urticae Females
2.3.2. T. urticae Eggs
2.4. General Sequencing and Pyrosequencing of cytb
2.5. Detoxification Enzyme Assays
2.6. Real-Time Quantitative PCR
2.7. Data Analysis
3. Results
3.1. Evaluation of the Resistance Ratio (RR)
3.2. Cytochrome b and PSST Genotypes of the Mite Strains
3.3. Detoxifying Enzyme Activities
3.4. Expression Levels of Five GST Subclasses
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Lee, Y.S.; Song, M.H.; Ahn, K.S.; Lee, K.Y.; Kim, J.W.; Kim, G.H. Monitoring of acaricide resistance in two-spotted spider mite (Tetranychus urticae) populations from rose greenhouses in Korea. J. Asia Pac. Entomol. 2003, 6, 91–96. [Google Scholar] [CrossRef]
- Osakabe, M.; Uesugi, R.; Goka, K. Evolutionary aspects of acaricide-resistance development in spider mites. Psyche J. Entomol. 2009, 2009, 947439. [Google Scholar] [CrossRef] [Green Version]
- Stumpf, N.; Nauen, R. Cross-resistance, inheritance, and biochemistry of mitochondrial electron transport inhibitor-acaricide resistance in Tetranychus urticae (Acari: Tetranychidae). J. Econ. Entomol. 2001, 94, 1577–1583. [Google Scholar] [CrossRef] [PubMed]
- Stumpf, N.; Nauen, R. Biochemical markers linked to abamectin resistance in Tetranychus urticae (Acari: Tetranychidae). Pestic. Biochem. Physiol. 2002, 72, 111–121. [Google Scholar] [CrossRef]
- Lee, K.R.; Koo, H.N.; Yoon, C.; Kim, G.H. Cross resistance and point mutation of the mitochondrial cytochrome b of bifenazate-resistant two-spotted spider mite. Tetranychus urticae. Korean Soc. Pestic. Sci. 2010, 14, 247–254. [Google Scholar]
- Sparks, T.C.; Nauen, R. IRAC: Mode of action classification and insecticide resistance management. Pestic. Biochem. Physiol. 2015, 121, 122–128. [Google Scholar] [CrossRef] [Green Version]
- Bellina, R.F.; Fost, D.L. Miticidal and Aphicidal Method Utilizing 2-Higher Alkyl-3-Hydroxy-1,4-Naphthoquinone Carboxylic Acid Esters. U.S. Patent US4055661A, 25 October 1977. [Google Scholar]
- Koura, Y.; Kinoshita, S.; Takasuka, K.; Koura, S.; Osaki, N.; Matsumoto, S.; Miyoshi, H. Respiratory inhibition of acaricide AKD-2023 and its deacetyl metabolite. J. Pestic. Sci. 1998, 23, 18–21. [Google Scholar] [CrossRef] [Green Version]
- Dekeyser, M.A. Review acaricide mode of action. Pest Manag. Sci. 2005, 61, 103–110. [Google Scholar] [CrossRef]
- Salman, S.Y.; Sarıtaş, E. Acequinocyl resistance in Tetranychus urticae Koch (Acari: Tetranychidae): Inheritance, synergists, cross-resistance and biochemical resistance mechanisms. Int. J. Acarol. 2014, 40, 428–435. [Google Scholar] [CrossRef]
- Taniguchi, M.; Hirose, M.; Baba, M.; Hirata, K.; Ochiai, Y. Pyridazinones. Japanese Patent JP 60 004 173, 16 May 1985. [Google Scholar]
- Hirata, K.; Kudo, M.; Miyake, T.; Kawamura, Y.; Ogura, T. NC-129—A new acaricide. In Proceedings of the Brighton Crop Prot Conf—Pests Dis, Hilton Brighton Metropole, Brighton, UK, 21–24 November 1988; BCPC: Farnham, Surrey, UK, 1988; pp. 41–48. [Google Scholar]
- Kobayashi, S.; Uchiyama, G. Sanmite—A new miticide. Agrochem. Jpn. 1993, 63, 12–14. [Google Scholar]
- Hollingworth, R.M.; Ahammadsahib, K.I.; Gadelhak, G.; McLaughlin, J.L. New inhibitors of complex I of the mitochondrial electron transport chain with activity as pesticides. Biochem. Soc. Trans. 1994, 22, 230–233. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Schuler, M.A.; Berenbaum, M.R. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 2007, 52, 231–253. [Google Scholar] [CrossRef] [PubMed]
- Feyereisen, R.; Dermauw, W.; Van Leeuwen, T. Genotype to phenotype, the molecular and physiological dimensions of resistance in arthropods. Pestic. Biochem. Physiol. 2015, 121, 61–77. [Google Scholar] [CrossRef] [PubMed]
- Van Leeuwen, T.; Dermauw, W. The molecular evolution of xenobiotic metabolism and resistance in chelicerate mites. Annu. Rev. Entomol. 2016, 61, 475–498. [Google Scholar] [CrossRef] [PubMed]
- Fotoukkiaii, S.M.; Tan, Z.; Xue, W.; Wybouw, N.; Van Leeuwen, T. Identification and characterization of new mutations in mitochondrial cytochrome b that confer resistance to bifenazate and acequinocyl in the spider mite Tetranychus urticae. Pest Manag. Sci. 2020, 76, 1154–1163. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.I.; Koo, H.N.; Choi, Y.; Park, B.; Kim, H.K.; Kim, G.H. Acequinocyl resistance associated with I256V and N321S mutations in the two-spotted spider mite (Acari: Tetranychidae). J. Econ. Entomol. 2019, 112, 835–841. [Google Scholar] [CrossRef]
- Van Leeuwen, T.; Vontas, J.; Tsagkarakou, A.; Dermauw, W.; Tirry, L. Acaricide resistance mechanisms in the two-spotted spider mite Tetranychus urticae and other important Acari: A review. Insect Biochem. Mol. Biol. 2010, 40, 563–572. [Google Scholar] [CrossRef] [Green Version]
- Van Nieuwenhuyse, P.; Van Leeuwen, T.; Khajehali, J.; Vanholme, B.; Tirry, L. Mutations in the mitochondrial cytochrome b of Tetranychus urticae Koch (Acari: Tetranychidae) confer cross-resistance between bifenazate and acequinocyl. Pest Manag. Sci. 2009, 65, 404–412. [Google Scholar] [CrossRef]
- Bajda, S.; Dermauw, W.; Panteleri, R.; Sugimoto, N.; Douris, V.; Tirry, L.; Osakabe, M.; Vontas, J.; Van Leeuwen, T. A mutation in the PSST homologue of complex I (NADH:ubiquinone oxidoreductase) from Tetranychus urticae is associated with resistance to METI acaricides. Insect Biochem. Mol. Biol. 2017, 80, 79–90. [Google Scholar] [CrossRef]
- Lee, K.R.; Shin, Y.H.; Cho, S.R.; Koo, H.N.; Choi, J.J.; Ahn, K.S.; Kim, G.H. Monitoring of bifenazate resistant two-spotted spider mite, Tetranychus urticae using molecular detection method. Korean J. Pestic. Sci. 2011, 15, 61–67. [Google Scholar]
- Troczka, B.; Zimmer, C.T.; Elias, J.; Schorn, C.; Bass, C.; Davies, T.G.; Field, L.M.; Williamson, M.S.; Slater, R.; Nauen, R. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochem. Mol. Biol. 2012, 42, 873–880. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- SAS Institute. SAS/STAT User’s Guide: Statistics, Version 9.1; SAS Institute: Cary, NC, USA, 2010. [Google Scholar]
- Kinoshita, S.; Koura, Y.; Kariya, H.; Ohsaki, N.; Watanabe, T. AKD-2023: A novel miticide. Biological activity and mode of action. Pestic. Sci. 1999, 55, 659–660. [Google Scholar] [CrossRef]
- Pree, D.J.; Whitty, K.J.; Van Driel, L. Baseline susceptibility and cross resistances of some new acaricides in the European red mite, Panonychus ulmi. Exp. Appl. Acarol. 2005, 37, 165–171. [Google Scholar] [CrossRef]
- Khajehali, J.; Van Leeuwen, T.; Grispou, M.; Morou, E.; Alout, H.; Weill, M.; Tirry, L.; Vontas, J.; Tsagkarakou, A. Acetylcholinesterase point mutations in European strains of Tetranychus urticae (Acari: Tetranychidae) resistant to organophosphates. Pest Manag. Sci. 2010, 66, 220–228. [Google Scholar] [CrossRef]
- Dermauw, W.; Ilias, A.; Riga, M.; Tsagkarakou, A.; Grbić, M.; Tirry, L.; Van Leeuwen, T.; Vontas, J. The cys-loop ligand-gated ion channel gene family of Tetranychus urticae: Implications for acaricide toxicology and a novel mutation associated with abamectin resistance. Insect Biochem. Mol. Biol. 2012, 42, 455–465. [Google Scholar] [CrossRef]
- Van Leeuwen, T.; Demaeght, P.; Osborne, E.J.; Dermauw, W.; Gohlke, S.; Nauen, R.; Grbic, M.; Tirry, L.; Merzendorfer, H.; Clark, R.M. Population bulk segregant mapping uncovers resistance mutations and the mode of action of a chitin synthesis inhibitor in arthropods. Proc. Natl. Acad. Sci. USA 2012, 109, 4407–4412. [Google Scholar] [CrossRef] [Green Version]
- Van Leeuwen, T.; Vanholme, B.; Van Pottelberge, S.; Van Nieuwenhuyse, P.; Nauen, R.; Tirry, L.; Denholm, I. Mitochondrial heteroplasmy and the evolution of insecticide resistance: Non-Mendelian inheritance in action. Proc. Natl. Acad. Sci. USA 2008, 105, 5980–5985. [Google Scholar] [CrossRef] [Green Version]
- Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Res. 1999, 27, 1767–1780. [Google Scholar] [CrossRef] [Green Version]
- Wirth, C.; Brandt, U.; Hunte, C.; Zickermann, V. Structure and function of mitochondrial complex I. Biochim. Biophys. Acta 2016, 1857, 902–914. [Google Scholar] [CrossRef]
- Bass, C.; Field, L.M. Gene amplification and insecticide resistance. Pest Manag. Sci. 2011, 67, 886–890. [Google Scholar] [CrossRef] [PubMed]
- Qiu, X. Insecticide resistance: Genetics, genomics and implications for pest control. Acta Entomol. Sin. 2005, 48, 960–967. [Google Scholar]
Purpose | Gene | Primer Name | Sequence (5′ → 3′) |
---|---|---|---|
General PCR | Cytb | PEWY-F | AAAGGCTCATCTAACCAAATAGG |
PEWY-R | AATGAAATTTCTGTAAAAGGGTATTC | ||
PSST | PSST-F | ACAGGTCAGCCAATCGAATC | |
PSST-R | ATACCAAGCCTGAGCAGTGG | ||
Pyrosequencing | Cytb | cytb1-F | TCCAGCTGACCCTCTAAATACAC |
cytb1-R | AGATCGTAGAATTGCGTAAGCAAAT | ||
cytb2-F | GGAGGAATTTTGAGACTATTAATTCAT | ||
cytb2-R | ATTTCTGTAAAAGGGTATTCAATT | ||
PSST | PSST-F | TGACTTTTGGATTAGCCTGTTGTG | |
PSST-R | AGGACTTGCTCTGAATAACATACCA | ||
Quantitative RT-PCR | GST | Delta-F | TGGGAAAGTCGGGCAATCAT |
Delta-R | GCACCAAGAGAGGCGTAGAG | ||
Omega-F | TTGGGAAAGTCGCTCCATCA | ||
Omega-R | AAACAAGGTTCCTGCATCCCA | ||
Mu-F | TGGCTCCTGTTCTTGGCTAT | ||
Mu-R | TCCGGAGCTGGTCCATAGTT | ||
Zeta-F | ATGGGCGCACCGATTGATT | ||
Zeta-R | GAACCAAGAACACATCGGCAA | ||
Kappa-F | AGCTAAAGGGGCTCACTTGAC | ||
Kappa-R | ACAAAGTCTCCAGCGGCTAT | ||
Actin | Actin-F | TGTGTGACGACGAAGTAGCC | |
Actin-R | AGTCCTTTTGGCCCATACCG |
Acaricides | Strain | N | LC50 (mg/L) (95% CL (a)) | Slope ± SE | RR (b) |
---|---|---|---|---|---|
Abamectin | S | 180 | 0.14 (0.09–0.21) | 1.01 ± 0.10 | 1.0 |
AR | 225 | 0.56 (0.12–0.83) | 2.02 ± 0.10 | 4.0 | |
PR | 225 | 0.065 (0.02–0.23) | 1.71 ± 0.29 | 0.5 | |
Acequinocyl | S | 225 | 2.78 (1.48–6.58) | 0.51 ± 0.07 | 1.0 |
AR | 210 | >5000 | - | >1798.6 | |
PR | 225 | 13.41 (10.06–21.94) | 0.92 ± 0.10 | 4.8 | |
Azocyclotin | S | 225 | 43.16 (35.63–51.11) | 3.06 ± 0.36 | 1.0 |
AR | 225 | 118.17 (85.56–146.64) | 1.87 ± 0.28 | 2.7 | |
PR | 210 | 20.79 (10.46–33.83) | 1.54 ± 0.20 | 0.5 | |
Bifenazate | S | 180 | 1.12 (0.76–1.66) | 2.09 ± 0.47 | 1.0 |
AR | 225 | 4.18 (7.52–18.09) | 1.57 ± 0.27 | 3.7 | |
PR | 210 | 3.70 (1.80–8.79) | 1.08 ± 0.12 | 3.3 | |
Cyenopyrafen | S | 210 | 0.96 (0.39–3.32) | 1.25 ± 0.17 | 1.0 |
AR | 180 | 0.29 (0.18–0.47) | 0.75 ± 0.10 | 0.3 | |
PR | 225 | 5.57 (2.27–14.76) | 0.81 ± 0.10 | 5.8 | |
Cyflumetofen | S | 280 | 10.94 (7.55–16.20) | 0.96 ± 0.11 | 1.0 |
AR | 225 | 0.46 (0.29–0.71) | 0.84 ± 0.10 | 0.04 | |
PR | 225 | 5.57 (2.27–14.76) | 2.02 ± 0.20 | 5.8 | |
Etoxazole | S | 240 | 4.65 (2.22–10.49) | 1.07 ± 0.13 | 1.0 |
AR | 210 | >1500 | - | >332.6 | |
PR | 225 | >1000 | - | >215.1 | |
Milbemectin | S | 225 | 0.51 (0.12–2.60) | 1.83 ± 0.30 | 1.0 |
AR | 135 | 1.81 (1.11–3.27) | 0.95 ± 0.20 | 2.3 | |
PR | 180 | 0.20 (0.15–0.26) | 1.33 ± 0.09 | 0.4 | |
Pyridaben | S | 180 | 0.36 (0.28–0.47) | 1.31 ± 0.14 | 1.0 |
AR | 225 | >1000 | - | >2777.8 | |
PR | 225 | >2000 | - | >5555.6 | |
Pyflubumide | S | 180 | 1.35 (0.94–2.08) | 0.85 ± 0.11 | 1.0 |
AR | 225 | 0.65 (0.39–1.03) | 0.76 ± 0.09 | 0.5 | |
PR | 210 | 0.35 (0.25–0.50) | 0.96 ± 0.12 | 0.3 | |
Spirodiclofen | S | 225 | 563.12 (482.69–667.24) | 2.94 ± 0.33 | 1.0 |
AR | 180 | 1399 (1048–1960) | 1.80 ± 0.21 | 2.5 | |
PR | 210 | 1243 (937.04–1780) | 0.92 ± 0.15 | 2.2 | |
Spiromesifen | S | 240 | 2.94 (0.87–5.53) | 1.19 ± 0.21 | 1.0 |
AR | 210 | >1500 | - | >510.2 | |
PR | 225 | 473.22 (308.49–786.59) | 0.65 ± 0.07 | 161.0 |
Acaricides | Strain | N | LC50 (mg/L) (95% CL (a)) | Slope ± SE | RR (b) |
---|---|---|---|---|---|
Abamectin | S | 850 | 0.88 (0.64–1.24) | 1.58 ± 0.18 | 1.0 |
AR | 668 | 1.35 0.94–7.97) | 1.71 ± 0.22 | 1.5 | |
PR | 554 | 0.83 (0.39–1.69) | 1.54 ± 0.26 | 0.9 | |
Acequinocyl | S | 553 | 1.48 (0.56–6.37) | 1.06 ± 0.19 | 1.0 |
AR | 668 | 189.71 (117.52.-281.56) | 1.99 ± 0.18 | 128.2 | |
PR | 881 | 1.47 (0.53–3.10) | 1.42 ± 0.21 | 1.0 | |
Azocyclotin | S | 1140 | 7.69 (5.63–10.78) | 1.69 ± 0.19 | 1.0 |
AR | 1041 | 19.54 (13.43–26.48) | 1.17 ± 0.22 | 2.5 | |
PR | 764 | 87.45 (78.35–97.27) | 3.53 ± 0.37 | 11.4 | |
Bifenazate | S | 855 | 4.01 (1.46–8.74) | 1.16 ± 0.17 | 1.0 |
AR | 437 | 4.34 (1.97–7.80) | 0.98 ± 0.11 | 1.1 | |
PR | 648 | 2.89 (0.84–6.78) | 0.84 ± 0.10 | 0.7 | |
Cyenopyrafen | S | 736 | 0.76 (0.40–1.34) | 1.61 ± 0.26 | 1.0 |
AR | 964 | 0.48 (0.17–1.21) | 0.85 ± 0.11 | 0.6 | |
PR | 886 | 1.55 (0.75–3.40) | 1.24 ± 0.17 | 2.0 | |
Cyflumetofen | S | 892 | 0.58 (0.29–0.99) | 1.83 ± 0.31 | 1.0 |
AR | 762 | 4.64 (2.22–8.67) | 1.21 ± 0.15 | 8.0 | |
PR | 563 | 4.87 (2.67–9.23) | 1.39 ± 0.17 | 8.4 | |
Etoxazole | S | 1401 | 0.08 (0.06–0.11) | 1.35 ± 0.14 | 1.0 |
AR | 310 | 0.92 (0.41–1.85) | 1.06 ± 0.13 | 11.5 | |
PR | 284 | >500 | - | >6250 | |
Milbemectin | S | 525 | 0.09 (0.05–0.13) | 1.24 ± 0.09 | 1.0 |
AR | 754 | 0.28 (0.17–0.54) | 0.07 ± 0.09 | 3.1 | |
PR | 469 | 0.61 (0.22–2.75) | 0.92 ± 0.14 | 6.8 | |
Pyridaben | S | 462 | 0.73 (0.31–1.48) | 0.91 ± 0.10 | 1.0 |
AR | 447 | >500 | - | >684.9 | |
PR | 619 | >2000 | - | >2739.7 | |
Pyflubumide | S | 1015 | 0.05 (0.02–0.09) | 1.28 ± 0.15 | 1.0 |
AR | 843 | 0.16 (0.06–0.44) | 1.08 ± 0.13 | 3.2 | |
PR | 785 | 3.05 (2.01–4.66) | 0.75 ± 0.07 | 61.0 | |
Spirodiclofen | S | 742 | 16.47 (13.39–19.51) | 3.46 ± 0.38 | 1.0 |
AR | 957 | 79.20 (68.19–92.45) | 4.31 ± 0.46 | 4.8 | |
PR | 667 | 18.89 (13.32–28.24) | 0.85 ± 0.11 | 1.1 | |
Spiromesifen | S | 1104 | 0.51 (0.29–0.80) | 2.01 ± 0.27 | 1.0 |
AR | 1012 | 0.34 (0.19–0.58) | 1.37 ± 0.17 | 0.7 | |
PR | 876 | 1.03 (0.81–1.34) | 0.94 ±0.02 | 2.0 |
Strain | N | cytb Genotypes (%) | PSST Genotypes (%) | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
G126S | A133T | I256V | N321S | H92R | |||||||
G | S | A | T | I | V | N | S | H | R | ||
S | 200 | 99 | 1 | 100 | 0 | 98 | 2 | 100 | 0 | 90 | 10 |
AR | 200 | 96 | 4 | 100 | 0 | 19 | 81 | 0 | 100 | 12 | 88 |
PR | 200 | 98 | 2 | 99 | 1 | 99 | 1 | 99 | 1 | 6 | 94 |
S | AR | PR | |||||
---|---|---|---|---|---|---|---|
Activity ± SD | Ratio | p(b) | Activity ± SD | Ratio | p(b) | ||
Glutathione S-Transferase | |||||||
CNDB | 30.3 ± 4.9b | 68.2 ± 11.0a | 2.3 | 0.0083 ** | 35.8 ± 5.3b | 1.2 | 0.4679 |
DCNB | 1.0 ± 0.3bc | 1.8 ± 0.1a | 1.8 | 0.0206 * | 1.6 ± 0.4ab | 0.9 | 0.0559 |
NBC | 1.4 ± 0.7b | 3.1 ± 0.7a | 2.2 | 0.0044 ** | 1.4 ± 0.6b | 1.0 | 0.9734 |
Nonspecific Esterase | |||||||
α-NA | 626.6 ± 51.5ab | 554.3 ± 55.9b | 0.9 | 0.3340 | 741.3 ± 56.3a | 1.2 | 0.1482 |
β-NA | 686.5 ± 36.0bc | 583.4 ± 39.1c | 0.8 | 0.0751 | 771.2 ± 46.7ab | 1.1 | 0.1890 |
P450 | |||||||
TMBZ | 1623.3 ± 209.8a | 1562.0 ± 226.9a | 1.0 | 0.8155 | 1763.2 ± 200.7a | 1.1 | 0.6150 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, J.; Koo, H.-N.; Kim, S.I.; Park, B.; Kim, H.; Kim, G.-H. Target-Site Mutations and Glutathione S-Transferases Are Associated with Acequinocyl and Pyridaben Resistance in the Two-Spotted Spider Mite Tetranychus urticae (Acari: Tetranychidae). Insects 2020, 11, 511. https://doi.org/10.3390/insects11080511
Choi J, Koo H-N, Kim SI, Park B, Kim H, Kim G-H. Target-Site Mutations and Glutathione S-Transferases Are Associated with Acequinocyl and Pyridaben Resistance in the Two-Spotted Spider Mite Tetranychus urticae (Acari: Tetranychidae). Insects. 2020; 11(8):511. https://doi.org/10.3390/insects11080511
Chicago/Turabian StyleChoi, Jihye, Hyun-Na Koo, Sung Il Kim, Bueyong Park, Hyunkyung Kim, and Gil-Hah Kim. 2020. "Target-Site Mutations and Glutathione S-Transferases Are Associated with Acequinocyl and Pyridaben Resistance in the Two-Spotted Spider Mite Tetranychus urticae (Acari: Tetranychidae)" Insects 11, no. 8: 511. https://doi.org/10.3390/insects11080511