Next Article in Journal
Real-Time Feeding Behavior Monitoring by Electrical Penetration Graph Rapidly Reveals Host Plant Susceptibility to Crapemyrtle Bark Scale (Hemiptera: Eriococcidae)
Previous Article in Journal
Population Fitness of Eupeodes corollae Fabricius (Diptera: Syrphidae) Feeding on Different Species of Aphids
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification, Microhabitat, and Ecological Niche Prediction of Two Promising Native Parasitoids of Tuta absoluta in Kenya

by
Sahadatou Mama Sambo
1,2,*,
Shepard Ndlela
1,
Hannalene du Plessis
2,
Francis Obala
1 and
Samira Abuelgasim Mohamed
1,*
1
International Centre of Insect Physiology and Ecology (icipe), Nairobi P.O. Box 30772-00100, Kenya
2
Unit for Environmental Sciences and Management, North-West University, Potchefstroom 2520, South Africa
*
Authors to whom correspondence should be addressed.
Insects 2022, 13(6), 496; https://doi.org/10.3390/insects13060496
Submission received: 16 February 2022 / Revised: 12 May 2022 / Accepted: 19 May 2022 / Published: 25 May 2022

Simple Summary

Since the arrival of Tuta absoluta, a multivoltine insect species whose larvae develop in leaves, fruits, flowers, buds, and stems of tomatoes, producers are facing one of its biggest production challenges. The pest continues to invade new areas, causing heavy losses in the tomato value chain. Sprays of synthetic insecticides have shown very low efficacy on this pest because of its inclination to develop resistance to various insecticide-active ingredients. Biological control is one of the most promising solutions for the management of this pest. In this work, we investigated the most efficient indigenous parasitoids associated with T. absoluta in Kenya and their preferable habitat and ecological niche suitability. We identified two species, Stenomesius sp. near japonicus and Bracon nigricans, with up to 17% and 21% parasitism respectively. Stenomesius sp. near japonicus was more abundant in greenhouses and non-insecticide-treated tomatoes while B. nigricans was more abundant in the field tomatoes with a low abundance of Nesidiocoris tenuis. The ecological niche of these two species showed that B. nigricans was suitable for establishment in sub-Saharan Africa, a big part of South America, and Australia in both current and future scenarios.

Abstract

Associations between the South American tomato pinworm, Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae), and its native parasitoids need to be updated to increase the implementation of pest control strategies. In this study, T. absoluta-infested tomato plants were collected from three regions in Kenya. The emerged parasitoids were identified, and their abundance was correlated with agroecological parameters, viz. cropping systems, and the abundance of the predator Nesidiocoris tenuis Reuter (Hemiptera: Miridae). The study further conducted a habitat suitability prediction for the identified parasitoids. Two parasitoid species, Bracon nigricans (Szépligeti) (Hymenoptera: Braconidae) and Stenomesius sp. near japonicus (Ashmead) (Hymenoptera: Eulophidae) emerged from T. absoluta immature stages, with parasitism rates ranging from 0 to 21% and 0 to 17% respectively. Insecticide application and open field cropping negatively influenced the parasitism by S. sp. nr japonicus. Low occurrence of N. tenuis positively affected B. nigricans parasitism. The predicted occurrence of parasitoid species indicated vast suitable areas for B. nigricans in sub-Saharan Africa, Australia, and South America. Low suitability was observed for S. sp. nr japonicus in Africa. Therefore, native parasitoids, especially B. nigricans could be considered for implementation as a biocontrol agent in the Integrated Pest Management program of T. absoluta.

1. Introduction

Invasive species are known to exert undesirable effects on biodiversity and human health [1,2,3]. They also adversely impact economic activities and food security [4,5]. The spread, establishment, and devastating effects of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) have contributed to the over-reliance on synthetic chemical insecticides for the management of this pest in Africa [6,7]. The preference by farmers for chemical control can be attributed to the observable quick knockdown of pests after application. As a result, the adverse effects associated with the use of synthetic chemicals are therefore ignored [8,9]. Mahugija et al. [10] reported that 50% of tomatoes grown and sold in Tanzania, had pesticide residues exceeding the official maximum residue limits, indicating a higher risk for public health. At the forefront of health risks are tomato farmers who due to the T. absoluta menace, apply insecticides regularly, often without any personal protective equipment. For example, up to 60% of Kenyan farmers do not use the necessary protective clothing when applying pesticides and as a result, 26% of them are reported to be suffering from pesticide-related health problems [11]. Due to the high pesticide cost in Kenya, farmers often use pesticides bought from informal markets in neighboring countries (Uganda and Tanzania), which are not registered for use on any specific crop [12]. The use of synthetic insecticides also influences the natural assemblage of parasitoids and predators of the pest [8,13].
Biological control is recommended for the control of T. absoluta albeit integrated with other control methods [7,14]. In most cases, invasive pests often arrive in new regions with no co-evolved natural enemies. However, if effective native parasitoids are present in the agroecological system, new associations with the pest may be formed based on multi-level interactions [15]. When the prey/host population levels are low, parasitoids and predators can switch their host and prey preferences depending on the availability of alternatives [16,17,18,19]. The use of natural enemies has several advantages for environmental conservation, especially due to their non-effect on non-target organisms [20,21].
Native parasitoids and predators have been used for T. absoluta control in several regions around the world. For instance, an estimated 65% predation and 20% parasitism by native species were reported from Israel in open tomato fields where synthetic chemicals were not applied [22]. Trichogramma spp. are lucratively used in many countries [23]. For instance, in Spain, the release of 30 Trichogramma achaeae Nagaraja and Nagarkatti (Hymenoptera: Trichogrammatidae) adults per plant reduced T. absoluta damage by 91.74% under greenhouse conditions [24]. Thus, the identification of effective indigenous parasitoids associated with T. absoluta is useful in the implementation of successful biocontrol programs.
Numerous parasitoids attacking T. absoluta in Africa have been described. These include the braconids Cotesia vestalis (Haliday), Apanteles litae Nixon, Meteorus laphygmarum Brues, Chelonus sp., and Diadegma insulare (Cresson), the Ichneumonidae Pristomerus pallidus (Kriechbaumer) and the Eulophidae Elasmus sp. in Senegal [25]. In North Africa, the Eulophid, Necrenus artynes (Walker) and Neochrysocharis formosa (Westwood), the Trichrommatid, Trichrogramma bourarachae Pintureau & Babault, the Patygastrid, Telenomus sp., and the Torymid, Hemiptarsenus zilahisebessi Erdös were discovered parasitizing T. absoluta under natural conditions [26,27,28]. Other native parasitoids of T. absoluta such as Bracon nigricans Szépligeti, Bracon hebetor (Say), Ecdamua cadenat (Risbec) (Hymenoptera: Torymidae), Dolichogenidea appellator (Telenga) (Hymenoptera: Braconidae), and Neochrysocharis formosa (Westwood) (Hymenoptera: Eulophidae) have been reported in Sudan [29,30]. In the Middle East and North Africa (MENA) region, there have been several efforts of parasitoid releases against T. absoluta [31], and this showed a significant reduction in the pest damage [32,33,34,35,36].
The assemblage of native parasitoids in various tomato-producing areas needs to be documented if they are to be incorporated into augmentative and conservative biological control approaches for the management of T. absoluta. Furthermore, habitat and climate are significant factors limiting the distribution and abundance of insect pests, as well as their physiology and reproduction [37,38,39,40,41,42]. Parasitoids and predator distribution on a local scale, are also affected by agronomic practices such as pesticide application [43,44]. It is against this background that the current study sought to assess the presence and distribution of parasitoid species in open-field and greenhouse tomatoes in Kenya and their effectiveness in controlling T. absoluta as well as to determine their suitable habitat for perseverance in biological control programs.

2. Materials and Methods

2.1. Parasitoid Collection in the Study Area

The investigation was conducted in Kirinyaga, Nakuru, and Nairobi Counties, Kenya with samples collected 12 times between March 2020 and October 2021. Collections were done six times in Kirinyaga and on three occasions in Nakuru and Nairobi. Sampling sites within the Counties were randomly selected based on the presence of tomato production farms with T. absoluta infestations in open fields and greenhouses. For each collection in a site, infested leaves were randomly picked and placed in transparent 4-liter plastic containers and labeled according to GPS coordinates and date of collection. Depending on the availability of infested plants, three to twelve samples were collected. The containers were closed with a mesh-infused lid for aeration and transported to the laboratory at icipe. The samples were weighed and incubated separately under ambient laboratory conditions (25 ± 1 °C; 65 ± 5% r.h; 12HL:12HD photoperiod). Un-infested tomato plants grown under standard agronomic practices in a greenhouse at icipe were added to the containers regularly as food for the larvae. The plastic containers were monitored daily, and pupae were transferred into Perspex cages (30 cm × 30 cm × 30 cm). The number of moths, parasitoids, and Nesidiocoris tenuis Reuter (Hemiptera: Miridae) that emerged from each sample were recorded. The parasitoids were grouped based on morphological similarities, counted, and transferred into Perspex cages for initiation of rearing colonies and identification of the respective parasitoids.

2.2. Identification of the Parasitoids

2.2.1. Molecular Identification

Ten female parasitoid wasps obtained from the rearing colony were frozen at −20 °C in Eppendorf tubes. To obtain high DNA quality, the heads of the parasitoids were excised before extraction according to the protocol of Livak, [45]. For the polymerase chain reaction (PCR) amplification, a Master Mix solution was prepared by mixing the barcoding primers LCO1490 (5′GGTCAACAAATCATAAAGATATTGG3′), and HCO2198 (5′TAAACTTCAGGGTGACCAAAAAATCA) for arthropods identification [46], DDH2O and hot start. Each sample was prepared with a 48 µL master mix solution in a PCR tube and 2 µL of DNA was added to the solution. The products were then displayed in Proflex 96-well thermal cycler (Applied Biosystems, Waltham, MA, USA) for PCR running. The PCR products were gel extracted, purified, and sent to Macrogen Europe BV (Meibergreef, Amsterdam, The Netherlands) for sequencing. DNA sequences were manually edited in BioEdit version 72.5 [47]. The forward and the reverse sequences were edited pairwise, and the consensus sequences were then generated for each sample. These were then blasted in the National Center for Biotechnology Information (NCBI) and the Barcode of Life Data System (BOLD) databases using nucleotide sequences to determine any similarities with previously described sequences. Nucleic acid sequences from the two samples (herein referred to as first and second samples) were registered in GenBank® as per accession numbers MZ314460, MZ314461, and MZ314460 for the first sample and MZ318061, MZ318062, MZ318063 and MZ318064 for the second sample. Voucher specimens were deposited in the Canadian National Collection of Insects (CNC) at Agriculture and Agri-Food Canada.

2.2.2. Morphological and Ecological Identification

Morphological identification was performed on specimens that did not provide a high match with any species in NCBI and BOLD. Samples of this specific parasitoid were placed in a refrigerator at −20 ± 2 °C for 5 min to incapacitate them for identification under a reflected stereomicroscope (Leica EZ4D digital stereomicroscope; Leica Microsystems, Heerbrugg, Switzerland).

2.3. Parasitoid Species Effectiveness and Distribution in the Field

The geographical coordinates and altitude were recorded for each farm, where samples were collected, using the Global Positioning System (GPS). The percent parasitism of each parasitoid species on the associated host, T. absoluta, was estimated as (the number of parasitoids emerging divided by the total number of T. absoluta and the parasitoids from a sample) × 100 [44,48], while the level of T. absoluta infestation was recorded as the sum of the number of T. absoluta recovered from a sample and the number of recovered parasitoids.

2.4. Agroecological Parameters Effect on the Parasitoid Species

In addition to the predators and parasitoids obtained from infested plant material, a survey was conducted to assess the application of pesticides at the tomato farms. Farmers were asked whether they applied pesticides, and if so, the last pesticide application date was recorded. Farms where no pesticide had been applied in the two weeks preceding the survey, were considered as farms with infrequent pesticide application. The tomato production system was also recorded as either an open field or greenhouse/screen house production. Additionally, an average number of N. tenuis per kilogram of tomato leaves were estimated and four classes were obtained for this variable 0 = absence of N. tenuis, [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50] = low-level presence of N. tenuis, [50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100] = medium level presence of N. tenuis and [>100] = high presence level of N. tenuis. The different factors were then correlated with the parasitism level of each species.

2.5. Prediction of Habitat Suitability

Occurrence records: A total of 21 georeferenced points for the first specimen (identified as B. nigricans and 23 for the second specimen identified as S. sp. nr japonicus were obtained from different sources to predict the habitat suitability of both parasitoid species. For B. nigricans four points were obtained from Biondi et al. and Gabarra et al. [49,50]; five from the Global Biodiversity Information Facility (GBIF) and 12 from points sampled in the present study. Similarly, for the occurrence records of S. sp. nr japonicus, four points were obtained from GBIF, eight from the Centre for Agriculture and Bioscience International (CABI) [51], and eight were gathered from published articles [49,50,52,53], and three from the current study.
Environmental Variables and modeling: Nineteen bioclimatic variables and elevation data at 2.5-minute spatial resolution were sourced from the WorldClim database [54]. These data points were integrated with occurrence records to predict the habitat suitability of B. nigricans and S. sp. nr japonicus under current climatic conditions. The bioclimatic variables are important in predicting the habitat suitability of the insect species because they reflect diverse characteristics of temperature, precipitation, and seasonality which are factors that affect the distribution and abundance of insects [55]. For future predictions of the distribution of the two parasitoids (i.e., the year 2050), we used simulated bioclimatic variables of representative concentration pathways (RCP 2.6).

2.6. Data Analysis

Mega software 10.2.5 [56] was used to generate the phylogenetic tree. The models with the lowest Bayesian Information Criterion (BIC) scores and the lowest Akaike Information Criterion (AIC) value were used to describe the replacement design. All positions with less than 95% site coverage were eliminated. Parameters with fewer than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position (partial deletion option) were used to build the tree.
Tuta absoluta infestation level, as well as parasitoid species abundance, were correlated with the different biotic parameters describing the sites using a general linear model with a negative binomial distribution. All analyses were performed in R [57].
For parasitoid species ecological niche prediction, a Pearson test applying a threshold correlation coefficient (r) > 0.7 was run in R to check for collinearity among the environmental variables. Only the variables which were not correlated were used in the prediction models using the maximum entropy algorithm (Maxent) developed by Phillips et al. [58], Maxent is one of the most popular modeling tools that has been widely used for predicting the distribution and ecological niche for many insect species [59]. It uses the correlative approach to correlate species occurrence to environmental layers and performs well even with a small number of occurrence records [60]. QGIS [61] was used to show the parasitoid distribution within the study area as well as in their ecological niche model.

3. Results

3.1. Parasitoid Identification

3.1.1. Molecular Identification

The comparison of the sequence of the first specimen, Accession MZ314460, in NCBI database showed 99.53% genetic similarity (e = 0E00) with the accession MH733585 (Italy) of Bracon nigricans Szépligeti (Hymenoptera: Braconidae), 98.28% with MN525195 and 98.12% with MN525197 both unidentified Braconidae from India [53]. Thus, we concluded that the parasitoid species was B. nigricans (phylogenetic tree complex is shown in Figure 1).
For the second specimen, the comparison was done both in NCBI and in BOLD. The results from the two databases showed less than 98% similarity; with the highest percentage similarity, 97.66% obtained from sample BIOUG48548-E02 collected in Mpumalanga province, South Africa by Albert Smith. The sequences were also compared with available mitochondrial COI of Steneomesius sp. and some closely related sequences in the GenBank. Sequences from specimens of the current study are in the same clade as Stenomesius Hansson (Hymenoptera: Eulophidae) from Costa Rica (Figure 2). We concluded that the parasitoid species was in the genera Stenomesius but could not identify it to species level using molecular identification.

3.1.2. Morphological and Ecological Identification

Morphological identification was done for the Eulophidae, Stenomesius sp. only, following the description by Reina and La Salle [62]. A comparative analysis of the morphological similarities and differences was done, with the following key features considered: forewing, flagellum, post marginal and stigmal veins, scape, female antennae, mesosoma, setae, and propodeum, as well as the body color. The key features of the Stenomesius sp. recovered in the present study include: a scape slightly exceeding the apex of the vertex (Figure 3A), female antennae with a slender scape, and a 4-segmented funicle (Figure 3B). The flagellum has 1–2 anelli (Figure 3B). The forewing has a submarginal vein with more than 4 setae (Figure 3C). The post marginal vein is at least 1.4 times the length of the stigmal vein (Figure 3D). The petiole is not separate (Figure 3E). The propodeum is connected with two submedian carinae in the middle making an H- or X-shaped structure (Figure 3F,G). The complete body is shiny yellowish in color, with a dark spot on the dorsal part of the abdomen and the thorax (Figure 3F,G). These morphological characteristics agree with descriptions for the Stenomesius genus.
Three species of the genus Stenomesius have been reported in the Afrotropical region, namely Stenomesius elegantulus (Risbec) (Hymenoptera: Eulophidae) in Cameroon and Senegal and S. japonicus in the Afrotropical, Palaearctic, Indo-Malaya, and Australian regions [63,64] while Stenomesius rufescens (Retzius) (Hymenoptera: Eulophidae) was described for the first time in Africa, in Egypt [64], and this species is supposed to be distributed Nearctic and Palaearctic regions. However, the species has been identified in Kenya [65]. Stenomesius elegantulus differs from S. japonicus mainly by its relatively shorter scutellum abruptly black compared to yellow axillae [52]. The head of S. rufescens is mostly black, the mouth and eye rims are reddish yellow, the two edges of the forewing, the dorsum of the mid-ventrum with the shoulder blades and the shield are ochre yellow, and other parts are black [66].
The Stenomesius species examined in the current study has a shiny head and body (Figure 3A,F,G). The S. japonicus specimens identified by Boucek [52] developed on small size caterpillar hosts, preferentially on herbaceous plants. The parasitoid has been reared on the leaf miner Stomopteryx nerteria (Meyrick) (Lepidoptera: Gelechiidae) on groundnut, Acrocercops sp. (Lepidoptera: Gracillariidae), and on Heliothis armigera (Hübner) (Lepidoptera: Noctuidae). Stenomesius japonicus was previously known as a parasitoid of Liriomyza spp. (Diptera: Agromyzidae) [67]. A few years after the T. absoluta invasion of different parts of the world, the parasitoid S. japonicus was recovered from field-collected T. absoluta larvae in the northeast of Spain [50] and recently in Syria [68]. Based on all these analyses, we identified this stenomesius species as S. sp. nr japonicus.

3.2. Parasitoid Species Effectiveness and Distribution in the Field

The occurrence and diversity of the parasitoids and parasitism rates significantly varied in the 29 sites sampled. Bracon nigricans was recorded only in Kirinyaga county (Figure 4B and Table 1) while S. sp. nr japonicus was recovered in both Nairobi and Kirinyaga counties (Figure 4C and Table 1). However, none of these parasitoid species were recovered from Nakuru County (Figure 4 and Table 1). Between sites, parasitism rates by S. sp. nr japonicus and B. nigricans ranged between, 0 to 17 % and 0 to 21%, respectively (Figure 4B,C). Whereas the infestation level varied from 52 to 1649 (emerged T. absoluta and parasitoids) per Kg of infested leaves (Table 1). in the different counties. Additionally, the highest parasitism rate was observed in June and May respectively for B. nigricans, and S. sp. nr japonicus in 2020 (Table 1).

3.3. Effect of Agroecological Parameters on Parasitoid Abundance

The low level of N. tenuis was significantly positively correlated (z value = 3.02, p = 0.002) with B. nigricans abundance (Table 2), while both insecticide application negatively affected S. sp. nr japonicus population density (z value = −5.56, p < 0.001) as well as open-field production (z value = −4.27, p < 0.001) (Table 2).

3.4. Habitat Suitability Prediction

Evaluation of the model showed high accuracy for predicting the habitat suitability of B. nigricans with the area under the curve (AUC) = 0.80. Similarly, the model predicted S. sp. nr japonicus occurrence well with the area under the curve (AUC) = 0.90. Out of the six variables that have been used to predict the habitat suitability of B. nigricans: precipitation of driest month (Bio14), precipitation of coldest quarter (Bio19), mean temperature of the driest quarter (Bio9), mean temperature of the wettest quarter (Bio8), and precipitation seasonality (Bio15) (Table 3). Isothermality (Bio3), mean temperature of the driest quarter (Bio9), mean diurnal range (Bio2), precipitation of wettest month (Bio13), precipitation of warmest quarter (Bio18), elevation, mean temperature of the wettest quarter (Bio8), and precipitation of coldest quarter (Bio19) were the bioclimatic variables that contributed to predicting the occurrence of S. sp. nr japonicus (Table 4). The model prediction showed that most parts of the world are suitable for B. nigricans to thrive under both current and future climatic scenarios (Figure 5 and Figure 6). High to very high suitability for B. nigricans occurrence is predicted across Africa under current climatic conditions (Figure 5A). In North Africa, the habitat suitability for this species is moderate under future scenarios (Figure 5B). In the current scenario, S. sp. nr japonicus showed a high to very high suitability to South America, Australia, and some location in southern Asia and southeast Asia (Figure 6A), with the occurrence probability, greatly reduced in the future climatic scenario (Figure 6B). However, the suitability level for this parasitoid is lower in a major part of Africa in both scenarios (Figure 6).

4. Discussion

The current study investigated the presence, distribution, and natural parasitism of promising native parasitoids of T. absoluta, six years after its invasion into Kenya. This investigation was conducted to determine their potential contribution to biological control of T. absoluta as well as for implementation into IPM strategies. We reported two parasitoid species, B. nigricans, and S. sp. nr japonicus. This is not the first report of these species on the African continent [30,69], but it is the first report of the two species in Kenya, although Kinyanjui et al. [65] reported the presence of a Bracon sp. and S. rufescens.
Bracon nigricans is a generalist idiobiont parasitoid of different pests such as Spodoptera littoralis Boisduval (Lepidoptera: Noctuidae), Lobesia botrana (Denis & Schiffermüller) (Lepidoptera: Tortricidae) [70,71]. On T. absoluta, it has been found in various regions such as Western and Southern Europe, Russia, the Middle East, and China [72,73,74,75]. Other Bracon species reported on T. absoluta are Bracon lucileae (Marsh), B. lulensis, and B. tutus (All) Berta & Colomo [8,72,73]. The maximum B. nigricans parasitism rate by B. nigricans on T. absoluta recorded in this study, was 21%. However, Idriss et al. [30] reported 54% parasitism under laboratory conditions with the highest parasitism obtained on 4th instar larvae compared to only 10% parasitism of 3rd instar larvae. Additionally, a significant pest killing rate, higher than the parasitism rate is observed for this parasitoid species [30,76,77].
Stenomesius spp. are generalist ectoparasitoids from several Lepidoptera families, such as Pyralidae, Noctuidae, Gelechiidae, Tortricidae, Lyonetiidae, Glyphipterygidae [78], but also from Diptera pest [79]. Stenomesius sp. nr japonicus has been associated with Aproaerema modicella Deventer (Lepidoptera: Gelechiidae), the groundnut leafminer [53,80] and with Phyllonorycter leafminers (Lepidoptera: Gracillariidae) [81] in India and Thailand, and Japan respectively. In Africa, Stenomesius species have been identified as parasitoids of A. modicella in Uganda and the DRC [82]. On the same host plant, S. japonicus attack Liriomyza sp. Mik (Diptera: Agromyzidae) [84]. Stenomesius sp. near japonicus was also recorded from T. absoluta-infested tomato plants in Spain and France [51,72,74]. Stenomesius sp. has also been reported on T. absoluta in Algeria [26], while S. rufescens was previously identified in Kenya on the same host [65]. Stenomesius sp. nr japonicus has been ranked among the three most frequent native parasitoid species recovered from T. absoluta in Spain [50]. It is not surprising that we recovered this parasitoid on T. absoluta-infested tomato plants in Kenya.
In the current study, we established up to 17% parasitism rate per site by S. sp. nr japonicus under field conditions. However, Chailleux et al. [84] found 50% parasitism when offering five hosts to one female of S. sp. nr japonicus, under laboratory conditions, and 35% field parasitism was reported by Youssef et al. [68]. Additionally, 12 females parasitized around 33% of T. absoluta larvae when S. sp. nr japonicus was exposed alone to T. absoluta larvae while only 8% parasitism was recorded when competing with the predator Macrolophus pygmaeus Rambur (Hemiptera: Miridae) [85]. A possible explanation for the lower rate of parasitism obtained in this study is that it is from open-field tomatoes where plants were infested with different immature stages, and some 4th instar larvae could have already left the plants to pupate in the soil. Parasitism rates under field conditions will most probably always be lower than laboratory conditions since the pest and parasitoids are not kept under confined conditions. Additionally, the level of infestation, i.e., the host-parasitoid ratio could have affected parasitism of S. sp. nr japonicus, since, in Table 1, 45% parasitism was observed when the infestation was lowest.
Bracon nigricans is a known larval parasitoid of T. absoluta [30,76]. The low-level presence of the generalist, omnivorous mirid N. tenuis in the field was positively correlated with B. nigricans parasitism while no significant effect on S. sp. nr japonicus was noticed (Table 1). Similarly, the number of progeny and emerged adults of the endoparasitoid of T. absoluta, Dolichogenidea gelechiidivoris (Marsh) (Hymenoptera: Braconidae) was not affected by the release of this predator [86]. It is, however, known from several studies that the release of N. tenuis in tomato fields, considerably reduces the persistence of T. absoluta [87,88], although N. tenuis prefers eggs to larvae [89]. However, larval ectoparasitoids go through intraguild predation by mirids in natural habitats [84,90]. Bacci et al. [91] estimated that 57% of T. absoluta mortality that occurs under field conditions was during the larval stage, with physiological disorders, parasitism, predation, and entomopathogenic agents as the causes. Third and fourth instar larvae are more susceptible to predatory wasps [91]. In a laboratory study, Chailleux et al. [85] reported that S. sp. nr japonicus increased from a single couple released in a cage to 60 adults within eight weeks, while its combination with a pair of M. pygmaeus, S. sp. nr japonicus adults decreased by 50 adults for the same duration.
Application of insecticides in tomato fields was not found to affect the parasitism by B. nigricans; however, there was a negative correlation between insecticide application and parasitism by S. sp. nr japonicus (Table 1). However, Biondi et al. [92] demonstrated that spinosad caused high pupal and adult mortality of 80% and100%, respectively while other bioinsecticides showed no lethal effect on B. nigricans but sublethal ones, especially on adult longevity and female fecundity. The impact varies with the active ingredient of the insecticide, combined with biotic conditions [13]. Further, open field tomato farming was found unfavorable to S. sp. nr japonicus. Similarly, for the congeneric species, N. nr artynes recorded more adult emergence (72) in greenhouse production compare to sentinel plants (23 adults) and open field tomatoes (41adults) in Tunisia [27]. Another Eulophid, Hemiptarsenus varicornis (Girault) (Hymenoptera: Eulophidae) was promoted as a good candidate for biocontrol of Liriomyza trifolii (Burgess) (Diptera: Agromyzidae) due to its ability to effectively perform under greenhouse conditions [93].
The generated Maxent models predicted the presence of S. sp. nr japonicus and B. nigricans in many parts of the world (Figure 5). The widespread distribution of Stenomesius sp. as predicted by the Maxent model is validated by the occurrence data of the parasitoid already published [49,50,53]. The model predicted low climatic suitability for S. sp. nr japonicus in most parts of Africa, in both current and future climatic scenarios. For B. nigricans, the Palaearctic region was considered the geographical distribution area [30,50,73]. While from our findings, the Afrotropical, Neotropical, Oriental, and Australasian regions showed better suitability than the Palaearctic region. The previous findings of the habitat suitability of T. absoluta in Africa, demonstrated proportional habitat suitability for B. nigricans [94,95], a result which juxtaposes very lower habitat suitability observed for S. sp. nr japonicus in our study. This discrepancy could be explained by the difference in tolerance to environmental factors between T. absoluta and the identified parasitoid species. Otherwise, major agricultural regions of Africa are highly suitable for B. nigricans. In that regard, B. nigricans should be considered for importation into the geographic areas indicated to be suitable for its occurrence.

5. Conclusions

Two native parasitoid species, B. nigricans and S. sp. nr japonicus were reported on T. absoluta in Kenya. Differences in parasitism rates occurred and varied between the sites and regions of sample collection, where the highest parasitism by B. nigricans and S. sp. nr japonicus was 21% and 17%, respectively. A low abundance of N. tenuis was found to be positively correlated to the occurrence of B. nigricans, while pesticide application in either greenhouse or open field tomatoes, did not affect the parasitoid. Open-field cropping, as well as insecticide application, were negatively correlated with parasitism by S. sp. nr japonicus. The ecological niche prediction for the respective parasitoids indicated a high probability that the potential areas for B. nigricans occurrence is in almost all African countries. This result can therefore guide future recovery surveys and the implementation of different biological control strategies against T. absoluta. With the estimated performance of these parasitoids under field conditions, where many challenges such as exposure to a wide variety of chemical insecticides and other competitors such as predators are realities, an IPM approach integrating the conservation and/or augmentation of these two parasitoids can be very effective. The combination of the different parasitoid species including the introduced Dolichogenidea gelechiidivoris (Marsh) (Hymenoptera: Braconidae) [96,97,98] should also be tested to confirm the theory of diversity of parasitoids for better pest control [99,100,101]. Moreover, the roles of these parasitoids in conservative biological control should be investigated by simulating agro-ecological conditions, and augmentation biological control with a high number of releases should also be tested.

Author Contributions

Conceptualization, S.M.S., S.N. and S.A.M. methodology and validation, S.M.S., S.N., H.d.P., F.O. and S.A.M.; data collection and curation, S.M.S.; formal statistical analysis, S.M.S.; writing—original draft preparation, S.M.S.; writing—review and editing, S.M.S., S.N., H.d.P., F.O. and S.A.M.; supervision, S.A.M., S.N. and H.d.P.; project administration and funding acquisition, S.A.M. All authors have read and agreed to the published version of the manuscript.

Funding

The authors gratefully acknowledge the financial support for this research by the following organizations and agencies: Biovision Foundation grant number BV DPP-012/ 2019–2022; Norwegian Agency for Development Cooperation-(NORAD), the section for research, innovation, and higher education grant number RAF-3058 KEN-18/0005; Scaling-up Climate-Smart Pest Management Approaches for Enhanced Maize and Tomato Systems Productivity in Eastern Africa (SCLAMP) grant number 81250394; the Swedish International Development Cooperation Agency (Sida); the Swiss Agency for Development and Cooperation (SDC); the Federal Democratic Republic of Ethiopia; and the Government of the Republic of Kenya. The views expressed herein do not necessarily reflect the official opinion of the donors. S.M.S. was sponsored by the German Academic Exchange Services (DAAD) in the African Regional Postgraduate Programme in Insect Science (ARPPIS) hosted by icipe.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data presented in this study are available for public used with the URL: https://dmmg.icipe.org/dataportal/dataset/identification-microhabitat-and-ecological-niche-prediction-of-two-promising-native-parasitoids (15 February 2022).

Acknowledgments

We are grateful to John Huber and José L. Fernández-Triana (Canadian National Collection of Insects, CNC) for the invaluable information on the genera reported in this publication. We thank several Scientists at icipe for their input in the molecular and morphological identification of the specimens. Furthermore, we are thankful to fellow students Rehemah Gwokyalya and Vivian Hinga for their technical support in insect molecular identification. We are also thankful to Abdelmutalab Gesmalla for his comments and advice on the species distribution modeling. We are grateful to all the icipe’s Animal Rearing and Containment Unit (ARCU) Tuta absoluta team, especially Esther Awuor Owino, Alex Muthembwa, Patrick Koech Kipkorir, Peterson Nderitu and Omar Jimali Ibrahim for their technical support in the field sample collection and insect monitoring.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Fessl, B.; Tebbich, S. Philornis downsi—A recently discovered parasite on the Galápagos archipelago—A threat for Darwin’s finches? Ibis 2002, 144, 445–451. [Google Scholar] [CrossRef]
  2. Sileshi, G.W.; Gebeyehu, S.; Mafongoya, P.L. The threat of alien invasive insect and mite species to food security in Africa and the need for a continent-wide response. Food Secur. 2019, 11, 763–775. [Google Scholar] [CrossRef]
  3. Venette, R.C.; Hutchison, W.D.; Hutchison, W.D. Invasive Insect Species: Global Challenges, Strategies & Opportunities. Front. Insect Sci. 2021, 1, 650520. [Google Scholar] [CrossRef]
  4. Pimentel, D.; Zuniga, R.; Morrison, D. Update on the environmental and economic costs associated with alien-invasive species in the United States. Ecol. Econ. 2005, 52, 273–288. [Google Scholar] [CrossRef]
  5. Pyšek, P.; Richardson, D.M. Invasive Species, Environmental Change and Management, and Health. Annu. Rev. Environ. Resour. 2010, 35, 25–55. [Google Scholar] [CrossRef]
  6. Aigbedion-Atalor, P.O.; Hill, M.P.; Zalucki, M.P.; Obala, F.; Idriss, G.E.; Midingoyi, S.K.; Chidege, M.; Ekesi, S.; Mohamed, S.A. The South America Tomato Leafminer, Tuta absoluta (Lepidoptera: Gelechiidae), Spreads Its Wings in Eastern Africa: Distribution and Socioeconomic Impacts. J. Econ. Entomol. 2019, 112, 2797–2807. [Google Scholar] [CrossRef]
  7. Mansour, R.; Brévault, T.; Chailleux, A.; Cherif, A.; Grissa-Lebdi, K.; Haddi, K.; Mohamed, S.A.; Nofemela, R.S.; Oke, A.; Sylla, S.; et al. Occurrence, biology, natural enemies and management of Tuta absoluta in Africa. Entomol. Gen. 2018, 38, 83–112. [Google Scholar] [CrossRef]
  8. Biondi, A.; Guedes, R.N.C.R.; Wan, F.-H.F.; Desneux, N. Ecology, Worldwide Spread, and Management of the Invasive South American Tomato Pinworm, Tuta absoluta: Past, Present, and Future. Annu. Rev. Entomol. 2018, 63, 239–258. [Google Scholar] [CrossRef]
  9. Rwomushana, I.; Day, R.; Gonzalez-moreno, P. Evidence Note Tomato Leafminer Impacts and Coping Strategies for Africa; CABI: Wallingford, UK, 2019. [Google Scholar]
  10. Mahugija, J.A.M.; Khamis, F.A.; Lugwisha, E.H.J. Assessment of pesticide residues in tomatoes and watermelons (fruits) from markets in Dar es Salaam, Tanzania. J. Appl. Sci. Environ. Manag. 2017, 21, 497. [Google Scholar] [CrossRef][Green Version]
  11. Marete, G.M.; Lalah, J.O.; Mputhia, J.; Wekesa, V.W. Pesticide usage practices as sources of occupational exposure and health impacts on horticultural farmers in Meru County, Kenya. Heliyon 2021, 7, e06118. [Google Scholar] [CrossRef]
  12. Njiraini, J.; Kenya’s Crop Protection Industry Fears ‘Dire Consequences’ of New Pesticides Tax. AgriBusiness Global, 2 November 2018. Available online: https://www.agribusinessglobal.com/agrochemicals/kenyas-crop-protection-industry-fears-dire-consequences-of-new-pesticides-tax/ (accessed on 1 July 2021).
  13. Abbes, K.; Biondi, A.; Kurtulus, A.; Ricupero, M.; Russo, A.; Siscaro, G.; Chermiti, B.; Zappalà, L. Combined Non-Target Effects of Insecticide and High Temperature on the Parasitoid Bracon nigricans. PLoS ONE 2015, 10, e0138411. [Google Scholar] [CrossRef]
  14. Desneux, N.; Han, P.; Mansour, R.; Arnó, J.; Brévault, T.; Campos, M.R.; Chailleux, A.; Guedes, R.N.C.; Karimi, J.; Konan, K.A.J.; et al. Integrated pest management of Tuta absoluta: Practical implementations across different world regions. J. Pest Sci. 2022, 95, 17–39. [Google Scholar] [CrossRef]
  15. Yang, Z.Q.; Wei, J.R.; Wang, X.Y. Mass rearing and augmentative releases of the native parasitoid Chouioia cunea for biological control of the introduced fall webworm Hyphantria cunea in China. BioControl 2006, 51, 401–418. [Google Scholar] [CrossRef]
  16. Castañé, C.; Arnó, J.; Gabarra, R.; Alomar, O. Plant damage to vegetable crops by zoophytophagous mirid predators. Biol. Control 2011, 59, 22–29. [Google Scholar] [CrossRef]
  17. Biondi, A.; Zappalà, L.; Di Mauro, A.; Garzia, G.T.; Russo, A.; Desneux, N.; Siscaro, G. Can alternative host plant and prey affect phytophagy and biological control by the zoophytophagous mirid Nesidiocoris tenuis? BioControl 2016, 61, 79–90. [Google Scholar] [CrossRef]
  18. Samková, A.; Raška, J.; Hadrava, J.; Skuhrovec, J. Effect of host switching simulation on the fitness of the gregarious parasitoid Anaphes flavipes from a novel two-generation approach. Sci. Rep. 2021, 11, 19473. [Google Scholar] [CrossRef]
  19. Jones, T.S.; Bilton, A.R.; Mak, L.; Sait, S.M. Host switching in a generalist parasitoid: Contrasting transient and transgenerational costs associated with novel and original host species. Ecol. Evol. 2015, 5, 459–465. [Google Scholar] [CrossRef]
  20. Barratt, B.I.P.; Howarth, F.G.; Withers, T.M.; Kean, J.M.; Ridley, G.S. Progress in risk assessment for classical biological control. Biol. Control 2010, 52, 245–254. [Google Scholar] [CrossRef]
  21. Van Lenteren, J.C.; Bale, J.; Bigler, F.; Hokkanen, H.M.T.; Loomans, A.J.M. Assessing risks of releasing exotic biological control agents of arthropod pests. Annu. Rev. Entomol. 2006, 51, 609–634. [Google Scholar] [CrossRef]
  22. Shaltiel-Harpaz, L.; Gerling, D.; Graph, S.; Kedoshim, H.; Azolay, L.; Rozenberg, T.; Nachache, Y.; Steinberg, S.; Allouche, A.; Alon, T. Control of the tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae), in open-field tomatoes by indigenous natural enemies occurring in Israel. J. Econ. Entomol. 2016, 109, 120–131. [Google Scholar] [CrossRef]
  23. Gervassio, N.G.S.; Aquino, D.; Vallina, C.; Biondi, A.; Luna, M.G. A re-examination of Tuta absoluta parasitoids in South America for optimized biological control. J. Pest Sci. 2019, 92, 1343–1357. [Google Scholar] [CrossRef]
  24. Cabello, T.; Granados, J.R.G.; Vila, A.S.E.; Pérez, M.D.P.; Camero, A.; Hemández-Suarez, E.; Polaszeck, A. Biological control of the South American Tomato Pinworm, Tuta absoluta (Lep.: Gelechiidae), with releases of Trichogramma achaeae (Hym.: Trichogrammatidae) in tomato greenhouses of Spain. Integr. Control Prot. Crop. Mediterr. Clim. IOBC/wprs Bull. 2009, 49, 225–230. [Google Scholar]
  25. Seydi, O.; Sylla, S.; Diatte, M.; Labou, B.; Diarra, K. Recruitment of native parasitoids of the tomato leaf miner Tuta absoluta (Meyrick 1917), (Lepidoptera: Gelechiidae) in Senegal. Int. J. Pest Manag. 2021, 1–7. [Google Scholar] [CrossRef]
  26. Guenaoui, Y.; Dahliz, A.; Bensaad, R.; Ouezzani, K. Five years after the first record of Tuta absoluta (Meyrick) in Algeria, what do we expect from its native natural enemies? In Proceedings of the Fourth International Scientific Symposium “Agrosym 2013”, Jahorina, Bosnia and Herzegovina, 3–6 October 2013; pp. 678–682. [Google Scholar]
  27. Abbes, K.; Biondi, A.; Zappalà, L.; Chermiti, B. Fortuitous parasitoids of the invasive tomato leafminer Tuta absoluta in Tunisia. Phytoparasitica 2014, 42, 85–92. [Google Scholar] [CrossRef]
  28. Eman Abdelmaksoud, M.M.; El-Refai, S.A.; Rashwan, S.A.R. Survey of Parasitoids and Predators of Tomato Leaf Miner, Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) in Egypt. Arab Univ. J. Agric. Sci. 2016, 24, 547–553. [Google Scholar] [CrossRef]
  29. Mahmoud, M.E.E.; Mohammed, E.S.I.; Mohamed, S.A.; Khamis, F.M.; Ekesi, S. Development and Implementation of a Sustainable IPM and Surveillance Program for the Invasive Tomato Leafminer, Tuta absoluta (Meyrick) in Sudan. Athens J. Sci. 2020, 7, 159–174. [Google Scholar] [CrossRef]
  30. Idriss, G.E.A.; Mohamed, S.A.; Khamis, F.; Du Plessis, H.; Ekesi, S. Biology and performance of two indigenous larval parasitoids on Tuta absoluta (Lepidoptera: Gelechiidae) in Sudan. Biocontrol Sci. Technol. 2018, 28, 614–628. [Google Scholar] [CrossRef]
  31. Mansour, R.; Biondi, A. Releasing natural enemies and applying microbial and botanical pesticides for managing Tuta absoluta in the MENA region. Phytoparasitica 2021, 49, 179–194. [Google Scholar] [CrossRef]
  32. Kortam, M.N.; Arnaouty, S.A.E.; Afifi, A.I.; Heikal, I.H. Efficacy of Different Biological Methods for Controlling the Tomato Leaf miner, Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) on Tomato in Greenhouse in Egypt. Egypt. J. Biol. Pest Control. 2014, 24, 523–528. [Google Scholar]
  33. El-Arnaouty, S.A.; Pizzol, J.; Galal, H.H.; Kortam, M.N.; Afifi, A.I.; Beyssat, V.; Desneux, N.; Biondi, A.; Heikal, I.H. Assessment of two Trichogramma species for the control of Tuta absoluta in North African tomato greenhouses. Afr. Entomol. 2014, 22, 801–809. [Google Scholar] [CrossRef]
  34. Cherif, A.; Mansour, R.; Attia-Barhoumi, S.; Zappalà, L.; Grissa-Lebdi, K. Effectiveness of different release rates of Trichogramma cacoeciae (Hymenoptera: Trichogrammatidae) against Tuta absoluta (Lepidoptera: Gelechiidae) in protected and open field tomato crops in Tunisia. Biocontrol Sci. Technol. 2019, 29, 149–161. [Google Scholar] [CrossRef]
  35. Keçeci, M.; Öztop, A. Possibilities for biological control of Tuta absoluta (Meyrick, 1917) (Lepidoptera: Gelechiidae) in the western Mediterranean Region of Turkey. Turkish J. Entomol. 2017, 41, 219–230. [Google Scholar] [CrossRef][Green Version]
  36. Abdel-Razek, A.S.; Masry, S.H.D.; Sadek, H.E.; Gaafar, N.M. Efficacy of Trichogramma wasps for controlling tomato leaf miner Tuta absoluta. Arch. Phytopathol. Plant Prot. 2019, 52, 443–457. [Google Scholar] [CrossRef]
  37. Porter, J.H.; Parry, M.L.; Carter, T.R. The potential effects of climatic change on agricultural insect pests. Agric. For. Meteorol. 1991, 57, 221–240. [Google Scholar] [CrossRef]
  38. Chichrane, J.; Laugi, G.; Hawlitzky, N. Effects of high temperature shocks of Trichogramma brassicae [Hym.: Trichogrammatidae]. Entomophaga 1993, 38, 185–192. [Google Scholar] [CrossRef]
  39. Fuhrer, J. Agroecosystem responses to combinations of elevated CO2, ozone, and global climate change. Agric. Ecosyst. Environ. 2003, 97, 1–20. [Google Scholar] [CrossRef]
  40. Kiritani, K. Different effects of climate change on the population dynamics of insects. Appl. Entomol. Zool. 2013, 48, 97–104. [Google Scholar] [CrossRef]
  41. Mohamed, S.A.; Wamalwa, M.; Obala, F.; Tonnang, H.E.Z.; Tefera, T.; Calatayud, P.A.; Subramanian, S.; Ekesi, S. A deadly encounter: Alien invasive Spodoptera frugiperda in Africa and indigenous natural enemy, Cotesia icipe (Hymenoptera, Braconidae). PLoS ONE 2021, 16, e0253122. [Google Scholar] [CrossRef]
  42. Tepa-yotto, G.T.; Tonnang, H.E.Z.; Goergen, G.; Subramanian, S.; Kimathi, E.; Abdel-rahman, E.M.; Flø, D.; Thunes, K.H.; Fiaboe, K.K.M.; Niassy, S.; et al. Global Habitat Suitability of Spodoptera frugiperda (JE Smith) (Lepidoptera, Noctuidae): Key Parasitoids Considered for Its Biological Control. Insect 2021, 12, 273. [Google Scholar] [CrossRef]
  43. Wang, X.; Jarjees, E.A.; Mcgraw, B.K.; Bokonon-Ganta, A.H.; Messing, R.H.; Johnson, M.W. Effects of spinosad-based fruit fly bait GF-120 on tephritid fruit fly and aphid parasitoids. Biol. Control 2005, 35, 155–162. [Google Scholar] [CrossRef]
  44. Mama Sambo, S.; Togbe, D.R.; Sinzogan Antonio, A.C.; Bokonon-Ganta, H.A.; Adomou, A.; Karlsson, M.F. Habitat factors associated with Fopius caudatus parasitism and population level of its host, Ceratitis cosyra. Entomol. Exp. Appl. 2019, 168, 1–13. [Google Scholar] [CrossRef]
  45. Livak, K.J. Organization and mapping of a sequence on the drosophila melanogaster X and Y chromosomes that is transcribed during spermatogenesis. Genetics 1984, 107, 611–634. [Google Scholar] [CrossRef]
  46. Layodé, B.F.R.; Onzo, A.; Karlsson, M.F. Watermelon-infesting Tephritidae fruit fly guild and parasitism by Psyttalia phaeostigma (Hymenoptera: Braconidae). Int. J. Trop. Insect Sci. 2020, 40, 157–166. [Google Scholar] [CrossRef]
  47. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  48. Sule, H.; Muhamad, R.; Omar, D.; Hee, A.K.W. Parasitism rate, host stage preference and functional response of Tamarixia radiata on Diaphorina citri. Int. J. Agric. Biol. 2014, 16, 783–788. [Google Scholar]
  49. Biondi, A.; Chailleux, A.; Lambion, J.; Han, P.; Zappalà, L.; Desneux, N. Indigenous Natural Enemies Attacking Tuta absoluta (Lepidoptera: Gelechiidae) in Southern France. Egypt. J. Biol. Pest Control 2013, 23, 117–121. [Google Scholar]
  50. Gabarra, R.; Arno’, J.; Lara, L.; Verdu´, M.J.; Ribes, A.; Beitia, F.; Urbaneja, A.; Te´llez, M.d.M.; Molla, O.; Riudavets, J. Native parasitoids associated with Tuta absoluta in the tomato production areas of the Spanish Mediterranean Coast. BioControl 2013, 59, 45–54. [Google Scholar] [CrossRef]
  51. CABI. Stenomesius japonicus. In Invasive Species Compendium; CAB Int.: Wallingford, UK, 2021. [Google Scholar]
  52. Boucek, Z. Taxonomic studies on some Eulophidae [Hym.] of economic interest mainly from Africa. Entomophaga 1976, 21, 401–414. [Google Scholar] [CrossRef]
  53. Murugasridevi, K.; Jeyarani, S.; Nelson, S.J.; Kumar, S.M.; Nakkeeran, S. Assessment of Diversity Indices and DNA Barcoding of Parasitic Fauna Associated with Groundnut Leafminer (GLM), Aproaerema modicella Deventer (Lepidoptera: Gelechiidae). Legum. Res. 2021, I, 1–9. [Google Scholar] [CrossRef]
  54. Hijmans, R.; Cameron, S.; Parra, J. Worldclim Global Climate Layers Version 1.4; WorldClim Database. Available online: https://www.worldclim.org/data/v1.4/worldclim14.html (accessed on 1 July 2021).
  55. O’Donnell, M.S.; Ignizio, D.A. Bioclimatic Predictors for Supporting Ecological Applications in the Conterminous United States. US Geol. Surv. Data Ser. 2012, 691, 10. [Google Scholar]
  56. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  57. R Core Team. R: A language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2018; Available online: https//www.R-project.org/ (accessed on 17 September 2021).
  58. Phillips, S.J.; Anderson, R.P.; Schapire, R.E. Maximum entropy modeling of species geographic distributions. Ecol. Modell. 2006, 190, 231–259. [Google Scholar] [CrossRef]
  59. Merow, C.; Smith, M.J.; Silander, J.A. A practical guide to MaxEnt for modeling species’ distributions: What it does, and why inputs and settings matter. Ecography 2013, 36, 1–12. [Google Scholar] [CrossRef]
  60. Elith, J.; Phillips, S.J.; Hastie, T.; Dudík, M.; Chee, Y.E.; Yates, C.J. A statistical explanation of MaxEnt for ecologists. Divers. Distrib. 2011, 17, 43–57. [Google Scholar] [CrossRef]
  61. QGIS.org QGIS Geographic Information System. QGIS Association. 2021. Available online: http://www.qgis.org (accessed on 20 September 2021).
  62. Reina, P.; Salle, J.L. Key to the World Genera of Eulophidae Parasitoids (Hymenoptera) of Leafmining Agromyzidae (Diptera). Available online: https://keys.lucidcentral.org/keys/v3/eulophidae_parasitoids/eulophidae_parasitoids.html (accessed on 2 May 2021).
  63. Van Noort, S. WaspWeb: Hymenoptera of the Afrotropical Region. Available online: www.waspweb.org (accessed on 1 October 2021).
  64. Gadallah, N.S.; Yefremova, Z.A.; Yegorenkova, E.N.; Soliman, A.M.; El-Ghiet, U.M.A.; Edmardash, Y.A. A review of the family Eulophidae (Hymenoptera: Chalcidoidea) of Egypt, with thirty three new records. Zootaxa 2015, 4058, 66–80. [Google Scholar] [CrossRef]
  65. Kinyanjui, G.; Khamis, F.M.; Ombura, F.L.O.; Kenya, E.U.; Ekesi, S.; Mohamed, S.A. Distribution, abundance and natural enemies of the invasive tomato leafminer, Tuta absoluta (Meyrick) in Kenya. Bull. Entomol. Res. 2021, 111, 1–16. [Google Scholar] [CrossRef]
  66. Fazekas, I. Stenomesius rufescens (Retzius, 1783), a parasite of Choreutis nemorana (Hübner, 1799) in Hungary (Hymenoptera, Lepidoptera). Microlepidoptera 2021, 15, 21–28. [Google Scholar] [CrossRef]
  67. Murphy, S.; Salle, J.L. Balancing biological control strategies in the IPM of New World invasive Liriomyza leafminers in field vegetable crops. Biocontrol News Inf. 1999, 20, 91–104. [Google Scholar]
  68. Youssef, R.M.; Abo Kaf, N.H.; Aboud, R. Stenomesius japonicus (Ashmead) (Hymenoptera: Eulophidae): A new parasitoid of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) in Syria. J. Insect Biodivers. Syst. 2022, 8, 219–227. [Google Scholar] [CrossRef]
  69. Kelly, J.; Ranwashe, F. ARC-PPRI: Chalcidoidea Collection (1900–2010); South African National Biodiversity Institute: Brummeria, Pretoria, 2018. [Google Scholar]
  70. Loni, A.; Samartsev, K.G.; Scaramozzino, P.L.; Belokobylskij, S.A.; Lucchi, A. Braconinae parasitoids (Hymenoptera, Braconidae) emerged from larvae of Lobesia Botrana (Denis & Schiffermüller) (lepidoptera, tortricidae) feeding on Daphne gnidium L. Zookeys 2016, 587, 125–150. [Google Scholar] [CrossRef]
  71. Becchimanzi, A.; Avolio, M.; Bostan, H.; Colantuono, C.; Cozzolino, F.; Mancini, D.; Chiusano, M.L.; Pucci, P.; Caccia, S.; Pennacchio, F. Venomics of the ectoparasitoid wasp Bracon nigricans. BMC Genom. 2020, 21, 1–15. [Google Scholar] [CrossRef] [PubMed]
  72. Al-Jboory, I.J.; Katbeh-Bader, A.; Shakir, A.Z. First observation and identification of some natural enemies collected from heavily infested tomato by Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) in Jordan. Middle-East J. Sci. Res. 2012, 11, 787–790. [Google Scholar]
  73. Zappalà, L.; Bernardo, U.; Biondi, A.; Cocco, A.; Deliperi, S.; Delrio, G.; Giorgini, M.; Pedata, P.; Rapisarda, C.; Garzia, G.T.; et al. Recruitment of native parasitoids by the exotic pest Tuta absoluta in southern Italy. Bull. Insectology 2012, 65, 51–61. [Google Scholar]
  74. Biondi, A.; Alma, A.; Zappala, L.; Desneux, N. Natural enemies of the South American moth, Tuta absoluta, in Europe, North Africa and Middle East, and their potential use in pest control strategies. J. Pest Sci. 2013, 86, 635–647. [Google Scholar] [CrossRef]
  75. Ghoneim, K. Parasitic insects and mites as potential biocontrol agents for a devastative pest of tomato, Tuta absoluta Meyrick (Lepidoptera: Gelechiidae) in the world: A review. IJRRAS 2014, 19, 36–68. [Google Scholar]
  76. Biondi, A.; Desneux, N.; Amiens-Desneux, E.; Siscaro, G.; Zappalà, L. Biology and Developmental Strategies of the Palaearctic Parasitoid Bracon nigricans (Hymenoptera: Braconidae) on the Neotropical Moth Tuta absoluta (Lepidoptera: Gelechiidae). J. Econ. Entomol. 2013, 106, 1638–1647. [Google Scholar] [CrossRef]
  77. van Lenteren, J.C.; Lanzoni, A.; Hemerik, L.; Bueno, V.H.P.; Cuervo, J.G.B.; Biondi, A.; Burgio, G.; Calvo, F.J.; de Jong, P.W.; López, S.N.; et al. The pest kill rate of thirteen natural enemies as aggregate evaluation criterion of their biological control potential of Tuta absoluta. Sci. Rep. 2021, 11, 10756. [Google Scholar] [CrossRef]
  78. Boucek, Z. Australasian Chalcidoidea (Hymenoptera): A Biosystematic Revision of Genera of Fourteen Families, with a Reclassiflcation of Species; CAB Int.: Wallingford, UK, 1988. [Google Scholar]
  79. Ridland, P.M.; Umina, P.A.; Pirtle, E.I.; Hoffmann, A.A. Potential for biological control of the vegetable leafminer, Liriomyza sativae (Diptera: Agromyzidae), in Australia with parasitoid wasps. Austral Entomol. 2020, 59, 16–36. [Google Scholar] [CrossRef]
  80. Kenis, M.; Cugala, D. Prospects for the biological control of the groundnut leaf miner, Aproaerema modicella, in Africa. CAB Rev. Perspect. Agric. Vet. Sci. Nutr. Nat. Resour. 2006, 1, 1–9. [Google Scholar] [CrossRef]
  81. Sato, H.; Okabayashi, Y.; Kamijo, K. Structure and Function of Parasitoid Assemblages Associated with Phyllonorycter Leafminers (Lepidoptera: Gracillariidae) on Deciduous Oaks in Japan. Environ. Entomol. 2002, 31, 1052–1061. [Google Scholar] [CrossRef]
  82. Munyuli, T.; Luther, G.; Kyamanywa, S.; Hammond, R. Diversity and distribution of native arthropod parasitoids of groundnut pests in Uganda and Democratic Republic of Congo. African Crop Sci. Conf. Proc. 2003, 6, 231–237. [Google Scholar]
  83. Martin, A.D.; Stanley-Horn, D.; Hallett, R.H. Adult host preference and larval performance of Liriomyza huidobrensis (Diptera: Agromyzidae) on selected hosts. Environ. Entomol. 2005, 34, 1170–1177. [Google Scholar] [CrossRef][Green Version]
  84. Chailleux, A.; Desneux, N.; Arnó, J.; Gabarra, R. Biology of two key Palaearctic larval ectoparasitoids when parasitizing the invasive pest Tuta absoluta. J. Pest Sci. 2014, 87, 441–448. [Google Scholar] [CrossRef]
  85. Chailleux, A.; Droui, A.; Bearez, P.; Desneux, N. Survival of a specialist natural enemy experiencing resource competition with an omnivorous predator when sharing the invasive prey Tuta absoluta. Ecol. Evol. 2017, 7, 8329–8337. [Google Scholar] [CrossRef]
  86. Aigbedion-Atalor, P.O.; Hill, M.P.; Ayelo, P.M.; Ndlela, S.; Zalucki, M.P.; Mohamed, S.A. Can the combined use of the mirid predator Nesidiocoris tenuis and a braconid larval endoparasitoid Dolichogenidea gelechiidivoris improve the biological control of Tuta absoluta? Insects 2021, 12, 1004. [Google Scholar] [CrossRef]
  87. Calvo, F.J.; Lorente, M.J.; Stansly, P.A.; Belda, J.E. Preplant release of Nesidiocoris tenuis and supplementary tactics for control of Tuta absoluta and Bemisa tabaci in greenhouse tomato. Entomol. Exp. Appl. 2012, 143, 111–119. [Google Scholar] [CrossRef]
  88. Mirhosseini, M.A.; Fathipour, Y.; Soufbaf, M.; Reddy, G.V.P. Implications of using two natural enemies of Tuta absoluta (Lepidoptera: Gelechiidae) toward tomato yield enhancement. Bull. Entomol. Res. 2019, 109, 617–625. [Google Scholar] [CrossRef]
  89. Sylla, S.; Brévault, T.; Streito, J.; Diarra, K. First Record of Nesidiocoris tenuis (Reuter) (Heteroptera: Miridae), as a Predator of the Tomato Leaf Miner, Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae), in Senegal. Egypt. J. Biol. Pest Control 2016, 26, 851–853. [Google Scholar]
  90. Naselli, M.; Biondi, A.; Garzia, G.T.; Desneux, N.; Russo, A.; Siscaro, G.; Zappalà, L. Insights into food webs associated with the South American tomato pinworm. Pest Manag. Sci. 2017, 73, 1352–1357. [Google Scholar] [CrossRef]
  91. Bacci, L.; Silva, É.M.; Silva, G.A.; Silva, L.J.; Rosado, J.F.; Samuels, R.I.; Picanço, M.C. Natural mortality factors of tomato leafminer Tuta absoluta in open-field tomato crops in South America. Pest Manag. Sci. 2019, 75, 736–743. [Google Scholar] [CrossRef]
  92. Biondi, A.; Zappala, L.; Stark, J.D.; Desneux, N. Do Biopesticides Affect the Demographic Traits of a Parasitoid Wasp and Its Biocontrol Services through Sublethal Effects? PLoS ONE 2013, 8, e76548. [Google Scholar] [CrossRef]
  93. Yano, E. Recent advances in the study of biocontrol with indigenous natural enemies in Japan. IOBC WPRS Bull. Fr. 1999, 22, 291–294. [Google Scholar]
  94. Tonnang, H.E.Z.; Mohamed, S.F.; Khamis, F.; Ekesi, S. Identification and Risk Assessment for Worldwide Invasion and Spread of Tuta absoluta with a Focus on Sub-Saharan Africa: Implications for Phytosanitary Measures and Management. PLoS ONE 2015, 10, e0135283. [Google Scholar] [CrossRef]
  95. Guimapi, R.Y.A.; Mohamed, S.A.; Okeyo, G.O.; Ndjomatchoua, F.T.; Ekesi, S.; Tonnang, H.E.Z. Modeling the risk of invasion and spread of Tuta absoluta in Africa. Ecol. Complex. 2016, 28, 1–17. [Google Scholar] [CrossRef]
  96. Shiraku, H. ICIPE Makes the First Release of Parasitoids into the Farm in Fight against Tuta absoluta, Infonet-Biovision. Available online: https://infonet-biovision.org/News/ICIPE-Makes-first-release-parasitoids-farm-fight-against-Tuta-Absoluta (accessed on 14 November 2020).
  97. Mama Sambo, S.; Ndlela, S.; Plessis, H.; Obala, F.; Mohamed, S.A. Ratio dependence effects of the parasitoid Dolichogenidea gelechiidivoris on its associated host Tuta absoluta. Biocontrol Sci. Technol. 2022, 32, 497–510. [Google Scholar] [CrossRef]
  98. Aigbedion-Atalor, P.O.; Abuelgasim, S.; Hill, M.P.; Zalucki, M.P.; Azrag, A.G.A.; Srinivasan, R.; Ekesi, S. Host stage preference and performance of Dolichogenidea gelechiidivoris (Hymenoptera: Braconidae), a candidate for classical biological control of Tuta absoluta in Africa. Biol. Control 2020, 144, 104215. [Google Scholar] [CrossRef]
  99. Tylianakis, J.M.; Romo, C.M. Natural enemy diversity and biological control: Making sense of the context-dependency. Basic Appl. Ecol. 2010, 11, 657–668. [Google Scholar] [CrossRef]
  100. Jonsson, M.; Wratten, S.D.; Landis, D.A.; Gurr, G.M. Recent advances in conservation biological control of arthropods by arthropods. Biol. Control 2008, 45, 172–175. [Google Scholar] [CrossRef]
  101. Jonsson, M.; Kaartinen, R.; Straub, C.S. Relationships between natural enemy diversity and biological control. Curr. Opin. Insect Sci. 2017, 20, 1–6. [Google Scholar] [CrossRef]
Figure 1. Maximum likelihood phylogenetic tree for the mitochondrial COI sequences of Bracon species from GenBank together with the specimen Bracon nigricans identified in our study.
Figure 1. Maximum likelihood phylogenetic tree for the mitochondrial COI sequences of Bracon species from GenBank together with the specimen Bracon nigricans identified in our study.
Insects 13 00496 g001
Figure 2. Maximum likelihood phylogenetic tree for the mitochondrial COI sequences of Stenomesius species from GenBank and BOLD together with the specimen identified in our study.
Figure 2. Maximum likelihood phylogenetic tree for the mitochondrial COI sequences of Stenomesius species from GenBank and BOLD together with the specimen identified in our study.
Insects 13 00496 g002
Figure 3. The collected Stenomesius sp. near japonicus description: (A): Scape and vertex, (B): Female antenna with scape slender and funicle 4-segmented, (B): The flagellum with 1–2 anelli, (C): Forewing with submarginal vein with more than 3: setae, (D): Postmarginal vein at least 1.5 times the length of the stigmal vein, (E): Petiole not separate, (F,G): Adult with X-shaped structure.
Figure 3. The collected Stenomesius sp. near japonicus description: (A): Scape and vertex, (B): Female antenna with scape slender and funicle 4-segmented, (B): The flagellum with 1–2 anelli, (C): Forewing with submarginal vein with more than 3: setae, (D): Postmarginal vein at least 1.5 times the length of the stigmal vein, (E): Petiole not separate, (F,G): Adult with X-shaped structure.
Insects 13 00496 g003
Figure 4. Maps showing (A) the study area, (B) Bracon nigricans parasitism rate, and (C) Stenomesius sp. nr. japonicus parasitism rate, within the sampling sites.
Figure 4. Maps showing (A) the study area, (B) Bracon nigricans parasitism rate, and (C) Stenomesius sp. nr. japonicus parasitism rate, within the sampling sites.
Insects 13 00496 g004
Figure 5. Probable bioclimatic suitability of Bracon nigricans under (A) current, and (B) representative concentration pathways (RCP2.5) of 2050 climate scenarios.
Figure 5. Probable bioclimatic suitability of Bracon nigricans under (A) current, and (B) representative concentration pathways (RCP2.5) of 2050 climate scenarios.
Insects 13 00496 g005
Figure 6. Probable bioclimatic suitability of Stenomesius sp. near japonicus under (A) current, and (B) representative concentration pathways (RCP2.5) of 2050 climate scenario.
Figure 6. Probable bioclimatic suitability of Stenomesius sp. near japonicus under (A) current, and (B) representative concentration pathways (RCP2.5) of 2050 climate scenario.
Insects 13 00496 g006
Table 1. Description of T. absoluta emergence per kilogram of infested leaves and the corresponding parasitism rate for each species in the 2020 and 2021 collections.
Table 1. Description of T. absoluta emergence per kilogram of infested leaves and the corresponding parasitism rate for each species in the 2020 and 2021 collections.
YearsMonthsCountyNo. of SitesT. absoluta Infestation/kg of Leaves (No.)B. nigricans (%)S. sp. nr japonicus (%)
2020MarchKirinyaga1290 ± NA00
MayNairobi152 ± NA045.16 ± NA
JuneKirinyaga2230 ± 9712.02 ± 3.770
2021FebruaryNairobi2267 ± 182025.37 ± 11.96
MarchNairobi11649 ± NA01.10 ± NA
MarchNakuru2948 ± 54200
MayKirinyaga9825 ± 1460.73 ± 0.601.21 ± 0.80
AugustNakuru2116 ± 9900
OctoberKirinyaga12353 ± 695.55 ± 1.860.03 ± 0.03
NovemberNakuru1241 ± NA00
Table 2. Statistical estimates for the effect of agroecological parameters on the parasitoid’s abundance.
Table 2. Statistical estimates for the effect of agroecological parameters on the parasitoid’s abundance.
EstimateSEz ValuePr(>|z|)
B. nigricans
(Intercept)0.920.911.020.31
Farm with frequent pesticide application−1.600.82−1.950.05
Low level of N. tenuis2.500.833.020.002
Medium level of N. tenuis0.041.260.030.97
High level of N. tenuis1.331.231.080.28
S. sp. nr japonicus
(Intercept)3.060.2412.88<0.001
Farm with frequent pesticide application−3.460.62−5.56<0.001
Open-field production−3.250.76−4.27<0.001
Low level of N. tenuis−0.271.06−0.250.80
Medium level of N. tenuis0.260.390.650.52
High level of N. tenuis−0.880.47−1.850.06
Table 3. Relative contribution of the various bioclimatic variables for Bracon nigricans ecological niche modeling.
Table 3. Relative contribution of the various bioclimatic variables for Bracon nigricans ecological niche modeling.
VariablesPercentage ContributionPermutation Importance
Bio1440.1064.00
Bio1923.260
Bio914.004.10
Bio812.7017.10
Bio159.6014.80
Elevation00
Table 4. Relative contribution of the various bioclimatic variables for Stenomesius sp. near japonicus ecological niche modeling.
Table 4. Relative contribution of the various bioclimatic variables for Stenomesius sp. near japonicus ecological niche modeling.
VariablesPercentage ContributionPermutation Importance
Bio357.251.9
Bio918.020.5
Bio28.14.3
Bio136.913.0
Bio183.97.3
Elevation3.30
Bio82.42.6
Bio190.20.2
Bio1500
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Mama Sambo, S.; Ndlela, S.; du Plessis, H.; Obala, F.; Mohamed, S.A. Identification, Microhabitat, and Ecological Niche Prediction of Two Promising Native Parasitoids of Tuta absoluta in Kenya. Insects 2022, 13, 496. https://doi.org/10.3390/insects13060496

AMA Style

Mama Sambo S, Ndlela S, du Plessis H, Obala F, Mohamed SA. Identification, Microhabitat, and Ecological Niche Prediction of Two Promising Native Parasitoids of Tuta absoluta in Kenya. Insects. 2022; 13(6):496. https://doi.org/10.3390/insects13060496

Chicago/Turabian Style

Mama Sambo, Sahadatou, Shepard Ndlela, Hannalene du Plessis, Francis Obala, and Samira Abuelgasim Mohamed. 2022. "Identification, Microhabitat, and Ecological Niche Prediction of Two Promising Native Parasitoids of Tuta absoluta in Kenya" Insects 13, no. 6: 496. https://doi.org/10.3390/insects13060496

APA Style

Mama Sambo, S., Ndlela, S., du Plessis, H., Obala, F., & Mohamed, S. A. (2022). Identification, Microhabitat, and Ecological Niche Prediction of Two Promising Native Parasitoids of Tuta absoluta in Kenya. Insects, 13(6), 496. https://doi.org/10.3390/insects13060496

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop