Genome-Wide Identification of P450 Genes in Chironomid Propsilocerus akamusi Reveals Candidate Genes Involved in Gut Microbiota-Mediated Detoxification of Chlorpyrifos
Abstract
:Simple Summary
Abstract
1. Introduction
2. Methods and Materials
2.1. Sequence Retrieval of P450s in P. akamusi
2.2. Sequence Alignment, Conserved Motif Visualization, and Phylogenetic Analysis
2.3. Protein Domain, Gene Structure, and Architecture of Conserved Motifs
2.4. Chromosome Localization, Gene Duplication, Collinearity Analysis, and Ka/Ks Calculation
2.5. Culture and Treatment of P. akamusi Larvae
2.6. Quantification of Gut Bacteria in P. akamusi Larvae
2.7. RNA Extraction from Gut Tissues and Transcriptome Analysis
2.8. RT-qPCR Validation for Candidate Differentially Expressed Genes
3. Results
3.1. Depiction of the P450 Multigene Family in P. akamusi
3.2. Phylogenetic Distribution and Group Clustering of Putative P450 Genes
3.3. Description of Gene Structures and Conserved Motif Patterns Analyzed from PaP450s
3.4. Analysis of Gene Duplication and Chromosomal Localization
3.5. Establishment of Gut Microbiota-Deficient Larvae
3.6. The Disruption of Gut Bacterial Communities Influenced the Survivorship of P. akamusi
3.7. The Expression Profile of PaP450s in Gut Tissues Determined by RNA-Seq and RT-qPCR
4. Discussion
4.1. Comprehensive Identification and Analysis of P450s in P. akamusi
4.2. The Possible Interaction between Bacterial Colonizers and P450s in P. akamusi Larval Guts
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Danielson, P.B. The cytochrome P450 superfamily: Biochemistry, evolution and drug metabolism in humans. Curr. Drug Metab. 2002, 3, 561–597. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.-F.; Niu, J.-Z.; Jiang, X.-Z.; Yang, W.-J.; Shen, G.-M.; Wei, D.; Smagghe, G.; Wang, J.-J. Influence of various stressors on the expression of core genes of the small interfering RNA pathway in the oriental fruit fly, Bactrocera dorsalis. Insect Sci. 2017, 24, 418–430. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Li, M.; Gong, Y.; Liu, F.; Li, T. Cytochrome P450s—Their expression, regulation, and role in insecticide resistance. Pestic. Biochem. Physiol. 2015, 120, 77–81. [Google Scholar] [CrossRef]
- Li, J.; Li, X.; Bai, R.; Shi, Y.; Tang, Q.; An, S.; Song, Q.; Yan, F. RNA interference of the P450CYP6CM1gene has different efficacy in B and Q biotypes ofBemisia tabaci. Pest Manag. Sci. 2015, 71, 1175–1181. [Google Scholar] [CrossRef]
- Yan, Z.W.; He, Z.B.; Yan, Z.T.; Si, F.L.; Zhou, Y.; Chen, B. Genome-wide and expression-profiling analyses suggest the main cytochrome P450 genes related to pyrethroid resistance in the malaria vector, Anopheles sinensis (Diptera Culicidae). Pest Manag. Sci. 2018, 74, 1810–1820. [Google Scholar] [CrossRef]
- Jing, T.X.; Wang, D.F.; Ma, Y.P.; Zeng, L.L.; Meng, L.W.; Zhang, Q.; Dou, W.; Wang, J.J. Genome-wide and expression-profiling analyses of the cytochrome P450 genes in Bactrocera dorsalis (Hendel) and screening of candidate P450 genes associated with malathion resistance. Pest Manag. Sci. 2020, 76, 2932–2943. [Google Scholar] [CrossRef]
- Adolfi, A.; Poulton, B.; Anthousi, A.; Macilwee, S.; Ranson, H.; Lycett, G.J. Functional genetic validation of key genes conferring insecticide resistance in the major African malaria vector, Anopheles gambiae. Proc. Natl. Acad. Sci. USA 2019, 116, 25764–25772. [Google Scholar] [CrossRef] [Green Version]
- Xiao, Q.; Deng, L.; Elzaki, M.E.A.; Zhu, L.; Xu, Y.; Han, X.; Wang, C.; Han, Z.; Wu, M.; Medina, R. The Inducible CYP4C71 Can Metabolize Imidacloprid in Laodelphax striatellus (Hemiptera: Delphacidae). J. Econ. Entomol. 2020, 113, 399–406. [Google Scholar] [CrossRef]
- Hafeez, M.; Liu, S.; Yousaf, H.K.; Jan, S.; Wang, R.L.; Fernandez-Grandon, G.M.; Li, X.; Gulzar, A.; Ali, B.; Rehman, M.; et al. RNA interference-mediated knockdown of a cytochrome P450 gene enhanced the toxicity of alpha-cypermethrin in xanthotoxin-fed larvae of Spodoptera exigua (Hubner). Pestic. Biochem. Physiol. 2020, 162, 6–14. [Google Scholar] [CrossRef]
- Bautista, M.A.M.; Miyata, T.; Miura, K.; Tanaka, T. RNA interference-mediated knockdown of a cytochrome P450, CYP6BG1, from the diamondback moth, Plutella xylostella, reduces larval resistance to permethrin. Insect Biochem. Mol. Biol. 2009, 39, 38–46. [Google Scholar] [CrossRef]
- Zhu, F.; Liu, N. Differential expression ofCYP6A5 andCYP6A5v2 in pyrethroid-resistant house flies, Musca domestica. Arch. Insect Biochem. Physiol. 2008, 67, 107–119. [Google Scholar] [CrossRef] [PubMed]
- Liang, Z.-K.; Pang, R.; Dong, Y.; Sun, Z.-X.; Ling, Y.; Zhang, W.-Q. Identification of SNPs involved in regulating a novel alternative transcript of P450 CYP6ER1 in the brown planthopper. Insect Sci. 2018, 25, 726–738. [Google Scholar] [CrossRef] [PubMed]
- Seong, K.M.; Coates, B.S.; Berenbaum, M.R.; Clark, J.M.; Pittendrigh, B.R. Comparative CYP-omic analysis between the DDT-susceptible and -resistant Drosophila melanogaster strains 91-C and 91-R. Pest Manag. Sci. 2018, 74, 2530–2543. [Google Scholar] [CrossRef] [Green Version]
- Iga, M.; Kataoka, H. Recent Studies on Insect Hormone Metabolic Pathways Mediated by Cytochrome P450 Enzymes. Biol. Pharm. Bull. 2012, 35, 838–843. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hansen, I.A.; Yang, T.; Liu, N. Genome Analysis of Cytochrome P450s and Their Expression Profiles in Insecticide Resistant Mosquitoes, Culex quinquefasciatus. PLoS ONE 2011, 6, e29418. [Google Scholar] [CrossRef] [Green Version]
- Zhu, F.; Moural, T.W.; Shah, K.; Palli, S.R. Integrated analysis of cytochrome P450 gene superfamily in the red flour beetle, Tribolium castaneum. BMC Genom. 2013, 14, 174. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.H.; Kang, J.S.; Min, J.S.; Yoon, K.S.; Strycharz, J.P.; Johnson, R.; Mittapalli, O.; Margam, V.M.; Sun, W.; Li, H.M.; et al. Decreased detoxification genes and genome size make the human body louse an efficient model to study xenobiotic metabolism. Insect Mol. Biol. 2010, 19, 599–615. [Google Scholar] [CrossRef] [Green Version]
- Takamura, K.; Ueno, R.; Kondo, N.I.; Ohbayashi, K. Pond chironomid communities revealed by molecular species delimitation reflect eutrophication. Ecol. Evol. 2021, 11, 4193–4204. [Google Scholar] [CrossRef]
- Martínez-Paz, P. Response of detoxification system genes on Chironomus riparius aquatic larvae after antibacterial agent triclosan exposures. Sci. Total Environ. 2018, 624, 1–8. [Google Scholar] [CrossRef]
- Sela, R.; Halpern, M. The Chironomid Microbiome Plays a Role in Protecting Its Host From Toxicants. Front. Ecol. Evol. 2022, 10, 42. [Google Scholar] [CrossRef]
- Zhang, S.; Shukle, R.; Mittapalli, O.; Zhu, Y.C.; Reese, J.C.; Wang, H.; Hua, B.-Z.; Chen, M.-S. The gut transcriptome of a gall midge, Mayetiola destructor. J. Insect Physiol. 2010, 56, 1198–1206. [Google Scholar] [CrossRef] [PubMed]
- Ceja-Navarro, J.A.; Vega, F.E.; Karaoz, U.; Hao, Z.; Jenkins, S.; Lim, H.C.; Kosina, P.; Infante, F.; Northen, T.R.; Brodie, E.L. Gut microbiota mediate caffeine detoxification in the primary insect pest of coffee. Nat. Commun. 2015, 6, 7618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, D.; Guo, Z.; Riegler, M.; Xi, Z.; Liang, G.; Xu, Y. Gut symbiont enhances insecticide resistance in a significant pest, the oriental fruit fly Bactrocera dorsalis (Hendel). Microbiome 2017, 5, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soltani, A.; Vatandoost, H.; Oshaghi, M.A.; Enayati, A.A.; Chavshin, A.R. The role of midgut symbiotic bacteria in resistance of Anopheles stephensi (Diptera: Culicidae) to organophosphate insecticides. Pathog. Glob. Health 2017, 111, 289–296. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zheng, Y.; Chen, Y.; Wang, S.; Chen, Y.; Hu, F.; Zheng, H. Honey bee (Apis mellifera) gut microbiota promotes host endogenous detoxification capability via regulation of P450 gene expression in the digestive tract. Microb. Biotechnol. 2020, 13, 1201–1212. [Google Scholar] [CrossRef] [PubMed]
- Zou, W.; Cai, Y.; Tolonen, K.T.; Zhu, G.; Qin, B.; Peng, K.; Gong, Z. The adaptations to tube-dwelling life of Propsilocerus akamusi (Diptera: Chironomidae) larvae and its eutrophication-tolerant mechanisms. Limnologica 2019, 77, 125684. [Google Scholar] [CrossRef]
- Slotkin, T.A.; Seidler, F.J.; Ryde, I.T.; Yanai, J. Developmental neurotoxic effects of chlorpyrifos on acetylcholine and serotonin pathways in an avian model. Neurotoxicol. Teratol. 2008, 30, 433–439. [Google Scholar] [CrossRef] [Green Version]
- Muñiz-González, A.-B.; Paoli, F.; Martínez-Guitarte, J.-L.; Lencioni, V. Molecular biomarkers as tool for early warning by chlorpyrifos exposure on Alpine chironomids. Environ. Pollut. 2021, 290, 118061. [Google Scholar] [CrossRef]
- Nelson, D.R. The Cytochrome P450 Homepage. Hum. Genom. 2009, 4, 59–65. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Tang, H.; DeBarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.h.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Nauen, R.; Zimmer, C.T.; Vontas, J. Heterologous expression of insect P450 enzymes that metabolize xenobiotics. Curr. Opin. Insect Sci. 2021, 43, 78–84. [Google Scholar] [CrossRef] [PubMed]
- Dermauw, W.; Van Leeuwen, T.; Feyereisen, R. Diversity and evolution of the P450 family in arthropods. Insect Biochem. Mol. Biol. 2020, 127, 103490. [Google Scholar] [CrossRef]
- Katsavou, E.; Riga, M.; Ioannidis, P.; King, R.; Zimmer, C.T.; Vontas, J. Functionally characterized arthropod pest and pollinator cytochrome P450s associated with xenobiotic metabolism. Pestic. Biochem. Physiol. 2022, 181, 105005. [Google Scholar] [CrossRef]
- Die, J.V.; Castro, P.; Millan, T.; Gil, J. Segmental and Tandem Duplications Driving the Recent NBS-LRR Gene Expansion in the Asparagus Genome. Genes 2018, 9, 568. [Google Scholar] [CrossRef] [Green Version]
- Bekpen, C.; Künzel, S.; Xie, C.; Eaaswarkhanth, M.; Lin, Y.-L.; Gokcumen, O.; Akdis, C.A.; Tautz, D. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans. BMC Genom. 2017, 18, 222. [Google Scholar] [CrossRef] [Green Version]
- Huang, X.; Cui, H.; Duan, W. Ecotoxicity of chlorpyrifos to aquatic organisms: A review. Ecotoxicol. Environ. Saf. 2020, 200, 110731. [Google Scholar] [CrossRef]
- Key, P.B.; Simonik, E.; Kish, N.; Chung, K.W.; Fulton, M.H. Differences in response of two model estuarine crustaceans after lethal and sublethal exposures to chlorpyrifos. J. Environ. Sci. Health Part B 2013, 48, 967–973. [Google Scholar] [CrossRef]
- Amanullah, B.; Stalin, A.; Prabu, P.; Dhanapal, S. Analysis of AchE and LDH in mollusc, Lamellidens marginalis after exposure to chlorpyrifos. J. Environ. Biol. 2010, 31, 417–419. [Google Scholar]
- Smagghe, G.; Tirry, L. Insect Midgut as a Site for Insecticide Detoxification and Resistance. In Biochemical Sites of Insecticide Action and Resistance; Springer Science & Business Media: Berlin, Germany, 2001; pp. 293–321. [Google Scholar]
- Chen, Y.; Zhou, H.; Lai, Y.; Chen, Q.; Yu, X.-Q.; Wang, X. Gut Microbiota Dysbiosis Influences Metabolic Homeostasis in Spodoptera frugiperda. Front. Microbiol. 2021, 12, 2803. [Google Scholar] [CrossRef] [PubMed]
- Han, J.; Park, J.C.; Hagiwara, A.; Park, H.G.; Lee, J.S. Identification of the full 26 cytochrome P450 (CYP) genes and analysis of their expression in response to benzo[alpha]pyrene in the marine rotifer Brachionus rotundiformis. Comp. Biochem. Physiol. Part D Genom. Proteom. 2019, 29, 185–192. [Google Scholar] [CrossRef]
- Yu, L.; Tang, W.; He, W.; Ma, X.; Vasseur, L.; Baxter, S.W.; Yang, G.; Huang, S.; Song, F.; You, M. Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.). Sci. Rep. 2015, 5, srep08952. [Google Scholar] [CrossRef] [PubMed]
- Luong, H.N.B.; Kalogeridi, M.; Vontas, J.; Denecke, S. Using tissue specific P450 expression in Drosophila melanogaster larvae to understand the spatial distribution of pesticide metabolism in feeding assays. Insect Mol. 2022, 31, 369–376. [Google Scholar] [CrossRef] [PubMed]
- Li, C.Y.F.; Lee, S.; Cade, S.; Kuo, L.J.; Schultz, I.R.; Bhatt, D.K.; Prasad, B.; Bammler, T.K.; Cui, J.Y. Novel Interactions between Gut Microbiome and Host Drug-Processing Genes Modify the Hepatic Metabolism of the Environmental Chemicals Polybrominated Diphenyl Ethers. Drug Metab. Dispos. 2017, 45, 1197–1214. [Google Scholar] [CrossRef] [Green Version]
- Oliveira, P.L.; Almeida, L.G.D.; Moraes, L.A.B.D.; Trigo, J.R.; Omoto, C.; Cônsoli, F.L. The gut microbiota of insecticide-resistant insects houses insecticide-degrading bacteria: A potential source for biotechnological exploitation. PLoS ONE 2017, 12, e0174754. [Google Scholar] [CrossRef]
- Nayarisseri, A.; Suppahia, A.; Nadh, A.G.; Nair, A.S. Identification and characterization of a pesticide degrading flavobacterium species EMBS0145 by 16S rRNA gene sequencing. Interdiscip. Sci. Comput. Life Sci. 2014, 7, 93–99. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′–3′) |
---|---|
16S rRNA-331F | TCCTACGGGAGGCAGCAGT |
16S rRNA-797R | GGACTACCAGGGTATCTAATCCTGTT |
Paβ-actin-F | TCTTCCAGCCATCCTTCTTG |
Paβ-actin-R | CGGTGATTTCCTTCTGCATT |
PaCYP6FW1-F | TCCAGACACCTACCGCCAACTC |
PaCYP6FW1-R | AACCGTCCTCGACCACTCTGTAG |
PaCYP4YZ1-F | TGTGTCAACTCTGCCTGTGCTTAC |
PaCYP4YZ1-R | TCGCCTCATACCTCTGGAACGG |
PaCYP6FX5-F | ACGAAGAGCGGTGATGACAAGTG |
PaCYP6FX5-R | AACTGTCCGAAGCAGGCGAATATC |
PaCYP3987D1-F | GCTAATGCTGCCCAGGTCTCAAC |
PaCYP3987D1-R | CTCGCTCAACTTCCACAACCTATCC |
PaCYP9HJ1-F | CCATCGACCCAAACCTGAAGACTG |
PaCYP9HJ1-R | TAGGCAGACGGCTTGAGGCTAG |
PaCYP3998B1-F | ACGCCTTCTCTACGCCTTCTCC |
PaCYP3998B1-R | GGTAGGTAGGTGGTCGGTCGTC |
PaCYP301A1-F | ACAAGAAGGGCGTGCGTCAAAC |
PaCYP301A1-R | GCAGCAGACAAGCCAGGTTGAG |
PaCYP325BP1-F | ACCACATCAACATCATCACCACCTG |
PaCYP325BP1-R | AGGAGTAGTTTGAACCAGCGGATTG |
PaCYP420C1-F | GCTCCCAGGTTGCGTCTTGTTC |
PaCYP420C1-R | GGCGATGGCATCTGCGTCTATC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, Z.; Liu, Y.; Xu, H.; Yan, C. Genome-Wide Identification of P450 Genes in Chironomid Propsilocerus akamusi Reveals Candidate Genes Involved in Gut Microbiota-Mediated Detoxification of Chlorpyrifos. Insects 2022, 13, 765. https://doi.org/10.3390/insects13090765
Sun Z, Liu Y, Xu H, Yan C. Genome-Wide Identification of P450 Genes in Chironomid Propsilocerus akamusi Reveals Candidate Genes Involved in Gut Microbiota-Mediated Detoxification of Chlorpyrifos. Insects. 2022; 13(9):765. https://doi.org/10.3390/insects13090765
Chicago/Turabian StyleSun, Zeyang, Yue Liu, Haixuan Xu, and Chuncai Yan. 2022. "Genome-Wide Identification of P450 Genes in Chironomid Propsilocerus akamusi Reveals Candidate Genes Involved in Gut Microbiota-Mediated Detoxification of Chlorpyrifos" Insects 13, no. 9: 765. https://doi.org/10.3390/insects13090765