Next Article in Journal
Morphologic Characters of the Rostrum in Two Weevils, Eucryptorrhynchus scrobiculatus Motschulsky and E. brandti Harold (Coleoptera: Curculionidae: Cryptorrhychinae)
Previous Article in Journal
Detection of Arthropod-Borne Bacteria and Assessment of MALDI-TOF MS for the Identification of Field-Collected Immature Bed Bugs from Mauritania
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 14
Issue 1
10.3390/insects14010070
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Regulation of Aquaporin Prip Expression and Its Physiological Function in Rhyzopertha dominica (Coleoptera: Bostrichidae)

by
Lan-Pin Tan
and
Mei-Er Chen
*
Department of Entomology, National Chung-Hsing University, Taichung City 40227, Taiwan
*
Author to whom correspondence should be addressed.
Insects 2023, 14(1), 70; https://doi.org/10.3390/insects14010070
Submission received: 28 November 2022 / Revised: 30 December 2022 / Accepted: 9 January 2023 / Published: 11 January 2023
(This article belongs to the Section Insect Physiology, Reproduction and Development)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Rhyzopertha dominica Prip (RdPrip) cDNA was cloned and the developmental and tissue profiles of RdPrip transcription levels were determined using qPCR. RdPrip was highly transcribed in female adults and ovaries. This suggests that RdPrip plays a vital role in female reproduction. Knockdown of RdPrip in female adults through feeding of dsRdPrip RNA significantly decreased the hatching rate of eggs laid by the females, further decreasing the number of offspring.

Abstract

Rhyzopertha dominica Prip (RdPrip) cDNA was cloned (GenBank accession no. OK318454), and the encoded 276-amino-acid protein indicated the typical aquaporin structure, including six transmembrane regions and two NPA motifs. The developmental and tissue profiles of RdPrip transcription were determined. RdPrip was highly transcribed in female adults, followed by larvae, pupae, and male adults. The transcriptional expression levels of RdPrip were significantly high in the ovary and hindgut (including cryptonephridial systems) compared with the foregut, testis, midgut, and Malpighian tubules. Knockdown of RdPrip in female adults did not decrease fecundity, but significantly decreased the hatching rate of eggs laid by the females. The results suggest that RdPrip functions in embryonic development, not in egg formation. In addition, the transcriptional expression level of RdPrip was lower in the spinosad-resistant strain than in the susceptible one, and the resistant strain produced fewer progeny than the susceptible strain did. These studies support the functional role of RdPrip in female reproduction. The absence of significant mortality reduction in the R. dominica exposed to spinosad after RdPrip RNAi suggests that other aquaporins that were not knocked down may exist for the excretion of metabolized pesticides.

1. Introduction

Water plays a vital role in homeostasis. Nutrients, metabolites, hormones, and many other molecules are all dissolved in water for cell exchange. Although water can simply diffuse into a cell, rapid water movement across cell membranes is achieved by aquaporins [1]. Aquaporins are proteins located at the cell membrane to transport water and other small solutes. The insect aquaporin superfamily contains five main subfamilies: (1) Drosophila integral protein (Drip), (2) Pyrocoelia rufa integral protein (Prip), (3) Glyceroporin (Glp), (4) big brain (Bib), and (5) others [2]. Among them, Drip and Prip are water-selective, and they mainly transport water molecules [3,4,5].
Aquaporins play various physiological roles. Drip and Prip play crucial roles in the diuresis of blood-feeding and phloem-sucking insects [4,6,7,8,9]. Increased excretion rate by aquaporins is a mechanism by which insects develop resistance to insecticides [10,11]. In addition to excretion, aquaporins also regulate reproduction [12,13,14,15] and are used by many insects to combat environmental stresses, such as low temperatures and drought [16,17,18,19].
Rhyzopertha dominica, the lesser grain borer, lives in barns worldwide and feeds on dry grains, including wheat, barley, oats, sorghum, maize, peanuts, and paddy rice. It is a primary pest that damages grains, leading to an increased likelihood of secondary pest outbreaks and thus the worsening of economic loss. R. dominica can also harm nuts, woody plants, and wood products [20,21]. The living environments of R. dominica lack water, and the water content in food is low. It appears that water homeostasis is extremely important for R. dominica. Its excretory system is a special cryptonephridial system in which the blind ends of the Malpighian tubules are closely associated with the rectum and covered by the perinephric membrane [22]. Cryptonephridial systems greatly improve water reabsorption in the rectum. Considering the adaptation of R. dominica to dry environments without drinking water, it is thought-provoking to explore the functions of aquaporins in R. dominica.
In this study, full-length aquaporin cDNA, RdPrip, was cloned, and the transcriptional profiles of developmental stages and tissues were determined. The functional study was performed using RNAi. Control of R. dominica relies primarily on chemical insecticides. Disruption of insect water homeostasis may influence the excretion of metabolized insecticides. Therefore, the role of RdPrip in spinosad-resistant R. dominica was investigated for developing a strategy to control R. dominca.

2. Materials and Methods

2.1. Insects R. dominica

The susceptible strain was maintained in the laboratory for more than two years without exposure to any pesticides. The spinosad-resistant strain was maintained by selection about every two months by using a modified grain application method described elsewhere [23]. The spinosad (ENTRUST 80 WP (GF-733), 80% spinosad) was provided by Dow AgroSciences LLC (Indianapolis, IN, USA). Both strains were fed on wheat flakes and maintained in glass jars at 28 °C, 30 ± 1% RH, under a 12 h: 12 h photoperiod.

2.2. cDNA Cloning of RdPrip by RT-PCR and RACE, and Sequence Analysis

The templates for the reverse transcription reaction were obtained from 1 µg of total RNA from the susceptible R. dominica by using the GeneRacer Kit (Thermal, Carlsbad, CA, USA) following the manufacturer’s instructions. A polymerase chain reaction was applied with degenerate primers, RdDripdf and RdDripdr (Table 1), which were designed based on the consensus sequences of aquaporin drip from Anomala cuprea [24] (accession number: AB741517), Bombyx mori [25] (accession number: AB178640), Culex quinquefasciatus (accession number: XM_001865697), and Rhodnius prolixus [26] (accession number: HQ711952). The PCR product (394 bp) was cloned into a pGEM-T Easy vector (Promega, Madison, WI, USA). The cDNA fragment was sequenced using an ABI PRISM Big Dye Terminator Cycle Sequencing Core kit with AmpliTaq DNA polymerase (ABI, Foster City, CA, USA) and the sequences were obtained from Tri-I Biotech (Taipei, Taiwan).
The 5′ and 3′ ends of the putative R. dominica aquaporin cDNA were produced using the GeneRacer Kit (Thermal). Specific primers were designed based on the sequence of the 394-bp fragment. For initial 5′ RACE PCR, the primer pair was RdDrip450-2 (Table 1) and the GeneRacer 5′ primer (Thermal), and for the nested PCR, the primer pair was RdDrip450-4 and the GeneRacer nested 5′ primer (Thermal). For the initial 3′ RACE PCR, the primer pair was RdDrip450-1 (Table 1) and the GeneRacer 3′ primer (Thermal), and for the nested PCR, the primer pair was RdDrip450-3 and the GeneRacer nested 3′ primer (Thermal). The PCR products were purified, cloned, sequenced, and encompassed the full-length R. dominica aquaporin cDNA sequence. To avoid errors in the assembly process, specific sense and antisense primers, RdPrip1008-1 and RdPrip1008-2, respectively, were designed in the 5′ and 3′ untranslated regions to perform PCR to amplify the entire open reading frame in one piece of DNA. The DNA was purified, cloned, and sequenced.
Prediction of transmembrane regions was performed with DeepTMHMM [27] (https://dtu.biolib.com/DeepTMHMM, accessed on 7 October 2022). Percentage identity and similarity were calculated with the Needle Pairwise Sequence Alignment of EMBL-EBI [28] (https://www.ebi.ac.uk/Tools/psa/emboss_needle/, accessed on 7 October 2022).

2.3. Analysis of the Developmental and Tissue Expression Profiles of RdPrip by Real-Time Quantitative RT-PCR

Developmental and tissue expression profiles of RdPrip transcription were analyzed using real-time quantitative RT-PCR (qPCR). Total RNA (0.5 μg) from larvae, pupae, and female and male adults was reverse transcribed into cDNA by using SuperScript III Frist-Strand Synthesis SuperMix (Thermal) for qRT-PCR, according to the manufacturer’s instructions. Total RNA (0.35 μg) from the adult foregut, midgut, hindgut (including cryptonephridial systems), Malpighian tubules, testes, and ovaries was similarly reverse transcribed into cDNA. The 18s gene was used as the reference gene. The primers used in qPCR were RdPrip qPCR-1 and RdPrip qPCR-2 for the target gene, and Rd-18s qPCR-01 and Rd-18s qPCR-02 for the reference gene (Table 1). The qPCR reactions were performed using the CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA) with iQ SYBR Green SuperMix (Bio-Rad). The PCR parameters for both target and reference genes were 95 °C for 3 min, 40 cycles of 95 °C for 10 s, and 60 °C for 30 s. A melting curve analysis was performed for each test to determine the specificity of the amplification. Three independent biological replicates of each sample and three technical repeats of each biological replicate were performed.
The qPCR data were collected, and the 2−ΔΔCT method was applied for quantitative data analyses. The qPCR data were analyzed using ANOVA followed by Tukey’s multiple comparison test.

2.4. Functional Studies of RdPrip through RNA Interference

The dsRdPrip RNA was synthesized using the MEGAscript RNAi Kit (Thermo), following the manufacturer’s instructions. The plasmid containing the cDNA of RdPrip or Egfp (control) served as templates for PCR amplification. The PCR primers, RdPripdsRNA-03, and RdPripdsRNA-04, with a T7 promoter sequence at the 5′ end and a gene-specific part for RdPrip are listed in Table 1. For the feeding treatment, 10 mated female adults of similar age were placed into one well of a 24-well plate containing 0.2 g of dried wheat flakes soaked with 35 μg of dsRNA in 300 μL of nuclease-free water. The plate was maintained at 28 °C for 3 days. Subsequently, the females were removed into another 24-well plate with egg collection paper for laying eggs. After 2 days of egg collection, the egg collection papers were removed into a Petri dish (9 cm in diameter) for hatching. There were six replicates in each treatment. RdPrip expression was determined using qPCR. All of the data were analyzed by ANOVA, followed by Tukey’s multiple comparison test.

2.5. Association of RdPrip Functions with Spinosad Resistance in R. dominica

To observe the differential expression of RdPrip between the susceptible and spinosad-resistant strains, 1 μg of total RNA was collected from adults of both susceptible and resistant strains for synthesizing the first-stand cDNA. qPCR reactions were performed using the iCycler iQ5 system (Bio-Rad) with iQ SYBR Green SuperMix (Bio-Rad). The qPCR programs were described earlier. A t-test was used to analyze the qPCR data.
To determine the progeny number of the two strains, 16 pairs of each strain were placed into a glass cylindrical cup (15.5 cm in height and 7.8 cm in diameter) filled with 80 g of wheat flakes as one group. Three groups of each strain were set up. A total of six cups were maintained at 28 °C, 30 ± 1% RH, and under a 12 h:12 h photoperiod for 45 days before assessment. The number of adults was counted, and 32 adults were designated as the parents. The number of first-generation adults between the two strains was compared using a t-test.
To detect the mortality of R. dominica exposed to spinosad after knocking down RdPrip, 20 adults were fed on wheat flakes soaked with water, dsEgfp RNA, and dsRdPrip RNA, as described earlier. There were five replicates for each treatment. After 3 days of feeding on dsRNA, the susceptibility of these adults to spinosad (4 μg/mL) was determined using a modified grain application method [23]. The mortality was calculated after 24 h of spinosad treatments. The mortality with the three treatments was analyzed using ANOVA followed by Tukey’s multiple comparison test.
p < 0.05 was set as statistically significant for all of the analyses in this study.

3. Results

3.1. cDNA Cloning and Sequence Analyses

Rhyzopertha dominica aquaporin prip (RdPrip) cDNA (GenBank accession no. OK318454) was cloned using RT-PCR and RACE. Our original intent was to clone the drip cDNA of the lesser grain borer. Therefore, the degenerate primers were designed based on the conserved transmembrane region of the four insect drips. The first 394-bp PCR product appeared as an aquaporin. However, the 1008-bp full-length cDNA encoded a prip. The cloning of a different aquaporin occurred likely because the transmembrane and NPA regions of aquaporins are highly conserved [29,30]. This cloning was conducted before the R. dominica genome was released [31]. The aforementioned situation is less likely to occur with the genome.
The 1008-bp cDNA sequence contains an 831-bp open reading frame encoding a 276-amino-acid protein with six predicted transmembrane domains (TMs) and five loops adjacent to the TMs. Two highly conserved NPA (Asn–Pro–Ala) sequences of aquaporins were located in loops II and V (Figure 1). The amino acid sequence of RdPrip from this study shared 95.7% identity and displayed 96.0% similarity with that of prip from the R. dominica genome. The greatest difference was in the C-terminus (Figure 1).

3.2. Expression Profiles of RdPrip

The developmental and tissue transcriptional expression profiles of RdPrip were determined using qPCR. RdPrip was expressed in all of the developmental stages tested. The expression was the highest in female adults, followed by larvae, pupae, and male adults. The differences in the expression levels of pupae and male adults were not statistically significant (Figure 2A). RdPrip expression in the ovary and the hindgut (including cryptonephridial systems) was significantly higher than that in the foregut, midgut, Malpighian tubules, and testis. The expression level was not significantly different between the ovary and hindgut, but it was 1.7-fold higher in the ovary than in the hindgut (Figure 2B).

3.3. Functional Studies of RdPrip

Functional studies of RdPrip were performed using RNAi. After 3 days of feeding on dsRdPrip RNA, dsEgfp RNA, and water, the RdPrip transcriptional expression was decreased significantly, and the knockdown effect lasted for 2 days (Figure 3A). All of the females in the three treatment groups laid eggs, and the fecundity was not significantly different (Figure 3B). However, RdPrip expression was significantly lower in the eggs laid by the dsRdPrip-treated females than in those laid by females subjected to the two control treatments (Figure 3C). Furthermore, the hatching rate significantly decreased after RdPrip knockdown in female adults (Figure 3D).

3.4. Association of RdPrip Functions with Spinosad Resistance in R. dominica

The relative transcriptional expression of RdPrip between susceptible and spinosad-resistant strains was detected using qPCR. The results revealed that the transcriptional expression was significantly lower in the resistant strain than in the susceptible strain (Figure 4A).
The lower RdPrip expression in resistant strains may result from lower levels of its expression in the ovary and/or the hindgut. To explore the association between RdPrip functions and resistance, the following two experiments were conducted. First, the offspring number of susceptible and resistant strains were compared, which revealed an average of 92.3 and 31.7 first-generation adults in susceptible and resistant strains, respectively, which was significantly different (Figure 4B). Second, the susceptibility of the R. dominica strain susceptible to spinosad was detected after RdPrip knockdown. The results revealed that mortality decreased after RdPrip knockdown. However, the mortality did not significantly differ between the dsRdPrip and dsEgfp treatment groups (Figure 4C).

4. Discussion

R. dominica is a major stored-product pest that feeds on dry grains in barns, where the humidity is low. Therefore, water homeostasis is critical in R. dominica. In this study, aquaporin prip (RdPrip) cDNA was cloned from R. dominica. The deduced amino acid sequence was almost identical to the one in the genome including all of the conserved domains of aquaporins (Figure 1).
The tissue distribution of prip mRNA varied in different insect species. The prip of Tribolium castaneum (TcPrip) is highly expressed in cryptonephridial systems, and its knockdown inhibits water reabsorption, resulting in more water loss and leading to the reduction of larval and pupal mass [32]. The expression levels of prip of Chilo suppressalis (CsPrip) were reported to be comparable among the Malpighian tubules, fat body, hindgut, head, and epidermis, which suggests the multiple functions of CsPrip in maintaining water homeostasis [33]. In Blattella germanica, prip expression is the highest in the ovaries, followed by the fat body and muscles, and it is almost undetectable in the digestive tract, Malpighian tubules, and colleterial gland [12]. The high RdPrip expression in the ovary may contribute to the highest transcriptional expression of RdPrip in female adults in this study (Figure 2).
The finding of high RdPrip expression in the ovaries and female adults suggests its potential role in reproduction (Figure 2). In Apis mellifera, six aquaporin genes are expressed in the ovaries of both virgin and mated queens. The expression level of Am-Eglp2 is significantly high in mated and 4-day-old virgin queens. Moreover, Am-Prip is highly expressed in 4-day-old virgin queens, which is the time expected to mate. In addition, another aquaporin, drip, was immunolocalized in the follicular cells of the mated queen. These results indicate that aquaporins are involved in honeybee reproduction [15]. In B. mori, there are two water-specific aquaporins, drip and prip, present at different ovarian development phases and they play different roles in ovarian maturation [14]. The BmDrip protein is abundantly expressed in the yolk granules under the oocyte membrane. The distribution of BmDrip is inferred to avoid water evaporation. The distribution of BmPrip is at the oocyte plasma membrane and transports water during vitellogenesis for the hydration and swelling of oocytes [14]. This swelling phenomenon has also been reported in D. melanogaster. Prip is the only aquaporin in Drosophila ovaries, and it regulates water transport in the ovaries to result in swelling, which is essential for calcium propagation and to initiate egg activation, thereby initiating the embryogenesis of mature oocytes [34]. In addition to prip, there are other aquaporins found in insect ovaries. The aquaporin bib of the bed bug, Cimex lectularius (ClBib), is highly expressed in ovaries and female adults, and its knockdown increases the fecundity of bed bugs, suggesting a role in reproduction inhibition in this species [35]. In this study, RdPrip knockdown in R. dominica females did not affect the number of eggs laid (Figure 3B) but decreased their hatching rate (Figure 3D). In addition, RdPrip expression was low in the eggs laid by dsRdPrip-treated females (Figure 3C). On the basis of these results, we suggest that RdPrip plays a vital role in embryogenesis, not in oogenesis. This study is the first to describe the functional role of aquaporin prip in the reproduction in coleopterans.
RdPrip expression and the number of offspring were significantly lower in the spinosad-resistant strain than in the susceptible strain (Figure 4A,B). The decreased offspring number may be associated with reduced RdPrip expression, or other fitness costs. In Anopheles coluzzi and Frankliniella occidentalis, the expression levels of aquaporins are higher in insecticide-resistant populations [36,37]. This is contrary to our result, but they do not demonstrate in which tissue the aquaporins are expressed. However, the highly expressed aquaporins in resistant A. gambiae Malpighian tubules could be related to the excretion of insecticide [10,38]. The function of Malpighian tubules in insect excretion is to secrete water. On the other hand, the function of the hindgut is to reabsorb water. In the hindgut (including cryptonephridial systems), the lower the RdPrip expression, the less the water reabsorption. Therefore, more water would be eliminated with the excreta, including the metabolized pesticide, to increase the resistance. RdPrip knockdown in the susceptible strain to mimic the resistant strain did not significantly lower the susceptibility of R. dominica to spinosad (Figure 4C). This suggests the presence of other aquaporins in the hindgut and indicated that functionally redundant aquaporins can compensate for the reabsorption function of RdPrip.
In this study, we constructed a useful feeding methodology to knockdown gene expression in coleopterans. Injecting small insects such as R. dominica adults (3–4 mm) is difficult. Feeding methodology enables the convenient application of RNAi to a large number of insects at once. Our results revealed that RdPrip was highly expressed in ovaries, and knockdown of RdPrip reduced the number of offspring. In addition, knockdown of RdPrip would not only reduce the susceptibility to spinosad but, perhaps, other insecticides. Therefore, RdPrip should be a useful candidate for R. dominica control whether or not combined with insecticides.

Author Contributions

Conceptualization, M.-E.C.; methodology, L.-P.T.; formal analysis, L.-P.T. and M.-E.C.; data curation, M.-E.C.; writing—original draft preparation, L.-P.T. and M.-E.C.; writing—review and editing, M.-E.C.; supervision, M.-E.C.; project administration, L.-P.T. and M.-E.C.; funding acquisition, M.-E.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by funding from the Ministry of Science and Technology, Taiwan (grant number: 106-2313-B-005-017-) to M.-E. Chen.

Data Availability Statement

Data are contained within the article.

Acknowledgments

We thank Mei-Chi Yao, Taiwan Agricultural Research Institute, for their assistance in the insect collection, and Qiao-An Lei, National Chung Hsing University, for collecting the data.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Smith, B.L.; Agre, P. Erythrocyte Mr 28,000 transmembrane protein exists as a multisubunit oligomer similar to chnnel proteins. J. Biol. Chem. 1991, 266, 6407–6415. [Google Scholar] [CrossRef] [PubMed]
  2. Finn, R.N.; Chauvigné, F.; Stavang, J.A.; Belles, X.; Cerdà, J. Insect glycerol transporters evolved by functional co-option and gene replacement. Nat. Commun. 2015, 6, 7814. [Google Scholar] [CrossRef] [Green Version]
  3. Kaufmann, N.; Mathai, J.C.; Hill, W.G.; Dow, J.A.T.; Zeidel, M.L.; Brodsky, J.L. Developmental expression and biophysical characterization of a Drosophila melanogaster aquaporin. Am. J. Physiol.-Cell Physiol. 2005, 289, C397–C407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Liu, K.; Tsujimoto, H.; Cha, S.-J.; Agre, P.; Rasgon, J.L. Aquaporin water channel AgAQP1 in the malaria vector mosquito Anopheles gambiae during blood feeding and humidity adaptation. Proc. Natl. Acad. Sci. USA 2011, 108, 6062–6066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Drake, L.L.; Rodriguez, S.D.; Hansen, I.A. Functional characterization of aquaporins and aquaglyceroporins of the yellow fever mosquiot, Aedes aegypti. Sci. Rep. 2015, 5, 7795. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Shakesby, A.J.; Wallace, I.S.; Isaacs, H.V.; Pritchard, J.; Roberts, D.M.; Douglas, A.E. A water-specific aquaporin involved in aphid osmoregulation. Insect Biochem. Mol. Biol. 2009, 39, 1–10. [Google Scholar] [CrossRef]
  7. Drake, L.L.; Boudko, D.Y.; Marinotti, O.; Carpenter, V.K.; Dawe, A.L.; Hansen, I.A. The aquaporin gene family of the yellow fever mosquito, Aedes aegypti. PLoS ONE 2010, 5, e15578. [Google Scholar] [CrossRef] [Green Version]
  8. Mathew, L.G.; Campbell, E.M.; Yool, A.J.; Fabrick, J.A. Identification and characterization of functional aquaporin water channel protein from alimentary tract of whitefly, Bemisia tabaci. Insect Biochem. Mol. Biol. 2011, 41, 178–190. [Google Scholar] [CrossRef]
  9. Esquivel, C.J.; Cassone, B.J.; Piermarini, P.M. A de novo transcriptome of the Malpighian tubules in non-blood-fed and blood-fed Asian tiger mosquitoes Aedes albopictus: Insights into diuresis, detoxification, and blood meal processing. PeerJ 2016, 4, e1784. [Google Scholar] [CrossRef] [Green Version]
  10. Mitchell, S.N.; Stevenson, B.J.; Müller, P.; Wilding, C.S.; Egyir-Yawson, A.; Field, S.G.; Hemingway, J.; Paine, M.J.I.; Ranson, H.; Donnelly, M.J. Identification and validation of a gene causing cross-resistance between insecticide classes in Anopheles gambiae from Ghana. Proc. Natl. Acad. Sci. USA 2012, 109, 6147–6152. [Google Scholar] [CrossRef]
  11. Karaagaç, S.U. Insecticide Resistance. In Insecticides—Advances in Integrated Pest Management; Perveen, F., Ed.; Intech: Rijeka, Croatia, 2012; pp. 469–478. [Google Scholar]
  12. Herraiz, A.; Chauvigné, F.; Cerdà, J.; Bellés, X.; Piulachs, M.-D. Identification and functional characterization of an ovarian aquaporin from the cockroach Blattella germanica L. (Dictyoptera, Blattellidae). J. Exp. Biol. 2011, 214, 3630–3638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Benoit, J.B.; Hansen, I.A.; Attardo, G.M.; Michalková, V.; Mireji, P.O.; Bargul, J.L.; Drake, L.L.; Masiga, D.K.; Aksoy, S. Aquaporins are critical for provision of water during lactation and intrauterine progeny hydration to maintain tsetse fly reproductive success. PLoS Negl. Trop. Dis. 2014, 8, e2517. [Google Scholar] [CrossRef] [PubMed]
  14. Maruyama, M.; Kambara, K.; Naka, H.; Azuma, M. Insect water-specific aquaporins in developing ovarian follicles of the silk moth Bmobyx mori: Role in hydration during egg maturation. Biol. Bull. 2015, 229, 58–69. [Google Scholar] [CrossRef] [PubMed]
  15. Medeiros-Santana, L.; Dohanik, V.T.; Serrão, J.E. Differential expression of aquaporin genes during ovary activation in the honeybee Apis mellifera (Hymenoptera: Apidae) queens. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2021, 253, 110551. [Google Scholar] [CrossRef] [PubMed]
  16. Kikawada, T.; Saito, A.; Kanamori, Y.; Fujita, M.; Snigórska, K.; Watanabe, M.; Okuda, T. Dehydration-inducible changes in expression of two auaporins in the sleeping chironomid Polypedilum vanderplanki. Biochim. Biophys. Acta 2008, 1778, 514–520. [Google Scholar] [CrossRef] [Green Version]
  17. Philip, B.N.; Kiss, A.J.; Lee, R.E., Jr. The protective role of aquaporins in the freeze-tolerant insect Eurosta silidaginis: Functional characterization and tissue abundance of EsAQP1. J. Exp. Biol. 2011, 214, 848–857. [Google Scholar] [CrossRef] [Green Version]
  18. Yi, S.-X.; Benoit, J.B.; Elnitsky, M.A.; Kaufmann, N.; Brodsky, J.L.; Zeidel, M.L.; Denlinger, D.L.; Lee, R.E., Jr. Function and immune-localization of aquaporins in the Antarctic midge Belgica antarctica. J. Insect Physiol. 2011, 57, 1096–1105. [Google Scholar] [CrossRef]
  19. Yang, L.; Piermarini, P.M. Molecular expression of aquaporin mRNAs in the northern house mosquito, Culex pipiens. J. Insect Physiol. 2017, 96, 35–44. [Google Scholar] [CrossRef]
  20. Potter, C. The biology and distribution of Rhyzopertha dominica (Fab.). Trans. R. Entomol. Soc. Lond. 1935, 83, 449–482. [Google Scholar] [CrossRef]
  21. Edde, P.A. A review of the biology and control of Rhyzopertha dominica (F.) the lesser grain borer. J. Stored Prod. Res. 2012, 48, 1–18. [Google Scholar] [CrossRef]
  22. Saini, R.S. Histology and physiology of the cryptonephridial system of insects. Trans. R. Entomol. Soc. London 1964, 116, 347–392. [Google Scholar] [CrossRef]
  23. Chen, C.-Y.; Chen, M.-E. Susceptibility of field populations of the lesser grain borer, Rhyzopertha dominica (F.), to deltamethrin and spinosad on paddy rice in Taiwan. J. Stored Prod. Res. 2013, 55, 124–127. [Google Scholar] [CrossRef]
  24. Nagae, T.; Miyake, S.; Kosaki, S.; Azuma, M. Identification and characterization of a functional aquaporin water channel (Anomala cuprea DRIP) in a coleopteran insect. J. Exp. Biol. 2013, 216, 2564–2572. [Google Scholar] [PubMed] [Green Version]
  25. Kataoka, N.; Miyake, S.; Azuma, M. Aquaporin and aquaglyceroporin in silkworms, differently expressed in the hindgut and midgut of Bombyx mori. Insect Mol. Biol. 2009, 18, 303–314. [Google Scholar] [CrossRef] [PubMed]
  26. Staniscuaski, F.; Paluzzi, J.-P.; Real-Guerra, R.; Carlini, C.R.; Orchard, I. Expression analysis and molecular characterization of aquaporins in Rhodnius prolixus. J. Insect Physiol. 2013, 59, 1140–1150. [Google Scholar] [CrossRef]
  27. Hallgren, J.; Tsirigos, K.D.; Pedersen, M.D.; Armenteros, J.J.A.; Marcatili, P.; Nielsen, H.; Krogh, A.; Winther, O. Deep TMHMM predicts alpha and beta transmembrane proteins using deep neural networks. bioRxiv 2022. [Google Scholar] [CrossRef]
  28. Madeira, F.; Pearce, M.; Tivey, A.R.N.; Basutkar, P.; Lee, J.; Edbali, O.; Madhusoodanan, N.; Kolesnikov, A.; Lopez, R. Search and sequence analysis tools services from EMBL-EBI in 2022. Nucleic Acids Res. 2022, 50, W276–W279. [Google Scholar] [CrossRef] [PubMed]
  29. Jung, J.S.; Preston, G.G.; Smith, B.L.; Guggino, W.B.; Agre, P. Molecular structure of the water channel through aquaporin CHIP: The hourglass model. J. Biol. Chem. 1994, 269, 14648–14654. [Google Scholar] [CrossRef]
  30. Gonen, T.; Walz, T. The structure of aquaporins. Q. Rev. Biophys. 2006, 39, 361–396. [Google Scholar] [CrossRef]
  31. Oppert, B.; Muszewska, A.; Steczkiewicz, K.; Satovic-Vuksic, E.; Plohl, M.; Fabrick, J.A.; Vinokurov, K.S.; Koloniuk, I.; Johnston, J.S.; Smith, T.P.L.; et al. The genome of Rhyzopertha dominica (Fab.) (Coleoptera: Bostrichidae): Adaptation for success. Genes 2022, 13, 446. [Google Scholar] [CrossRef]
  32. Yao, X.X.; Meng, Q.-W.; Li, G.-Q. RNA interference-mediated functional characterization of aquaporin genes in Tribolium castaneum. Insect Mol. Biol. 2018, 27, 234–246. [Google Scholar] [CrossRef] [PubMed]
  33. Lu, M.-X.; He, F.-J.; Xu, J.; Liu, Y.; Wang, G.-R.; Du, Y.-Z. Identification and physiological function of CsPrip, a new aquaporin in Chilo suppressalis. Int. J. Biol. Macromol. 2021, 184, 721–730. [Google Scholar] [CrossRef] [PubMed]
  34. York-Andersen, A.H.; Wood, B.W.; Wilby, E.L.; Berry, A.S.; Weil, T.T. Osmolarity0regulated swelling initiates egg activation in Drosophila. Open Biol. 2021, 11, 210067. [Google Scholar] [CrossRef] [PubMed]
  35. Tsujimoto, H.; Sakamoto, J.M.; Rasgon, J.L. Functional characterization of aquaporin-like genes in the human bed bug Cimex lectularius. Sci. Rep. 2017, 7, 3214. [Google Scholar] [CrossRef] [Green Version]
  36. Toé, K.H.; N’Falé, S.; Dabire, R.K.; Ranson, H.; Jones, C.M. The recent escalation in strength of pyrethroid resistance in Anopheles coluzzi in West Africa is linked to increased expression of multiple gene families. BMC Genom. 2015, 16, 146. [Google Scholar] [CrossRef] [Green Version]
  37. Gao, Y.; Kim, M.J.; Kim, J.H.; Jeong, I.H.; Clark, J.M.; Lee, S.H. Transcriptomic identification and characterization of genes responding to sublethal doses of three different insecticides in the western flower thrips, Frankliniella occidentalis. Pestic. Biochem. Physiol. 2020, 167, 104596. [Google Scholar] [CrossRef]
  38. Liu, K.; Tsujimoto, H.; Huang, Y.; Rasgon, J.L.; Agre, P. Aquaglyceroporin function in the malaria mosquito Anopheles gambiae. Biol. Cell 2016, 108, 294–305. [Google Scholar] [CrossRef]
Insects 14 00070 g001 550
Figure 1. The alignment of amino acid sequences of R. dominica prip from one cloned from this study (Accession no. OK318454) and the other from the genome (Accession no. KAI7815065). The six transmembrane regions (A–F) are indicated by a gray background. The two NPA (Asn–Pro–Ala) motifs located on the second and fifth loops are marked in yellow.
Figure 1. The alignment of amino acid sequences of R. dominica prip from one cloned from this study (Accession no. OK318454) and the other from the genome (Accession no. KAI7815065). The six transmembrane regions (A–F) are indicated by a gray background. The two NPA (Asn–Pro–Ala) motifs located on the second and fifth loops are marked in yellow.
Insects 14 00070 g001
Insects 14 00070 g002 550
Figure 2. Developmental (A) and tissue (B) profiles of RdPrip expression. The error bar represents the standard error of three replicates. Different letters indicate significant differences between treatments (p < 0.05). L: larvae; P: pupae; FA: female adults; MA: male adults; FG: foregut; MG: midgut; HG: hindgut, including cryptonephridial systems; MT: Malpighian tubules; O: ovary; T: testis.
Figure 2. Developmental (A) and tissue (B) profiles of RdPrip expression. The error bar represents the standard error of three replicates. Different letters indicate significant differences between treatments (p < 0.05). L: larvae; P: pupae; FA: female adults; MA: male adults; FG: foregut; MG: midgut; HG: hindgut, including cryptonephridial systems; MT: Malpighian tubules; O: ovary; T: testis.
Insects 14 00070 g002
Insects 14 00070 g003a 550Insects 14 00070 g003b 550
Figure 3. Functional studies of RdPrip on female reproduction. (A) The knockdown efficiency of RdPrip mRNA determined using qPCR. The uppercase and lowercase are for the comparisons among open and solid bars, respectively. (B) Fecundity of RNAi-treated female adults. (C) The transcriptional expression of RdPrip in eggs laid by RNAi-treated female adults. (D) The hatching rate of eggs laid by RNAi-treated female adults. The error bar represents the standard error of three replicates. Different letters indicate significant differences between treatments (p < 0.05).
Figure 3. Functional studies of RdPrip on female reproduction. (A) The knockdown efficiency of RdPrip mRNA determined using qPCR. The uppercase and lowercase are for the comparisons among open and solid bars, respectively. (B) Fecundity of RNAi-treated female adults. (C) The transcriptional expression of RdPrip in eggs laid by RNAi-treated female adults. (D) The hatching rate of eggs laid by RNAi-treated female adults. The error bar represents the standard error of three replicates. Different letters indicate significant differences between treatments (p < 0.05).
Insects 14 00070 g003aInsects 14 00070 g003b
Insects 14 00070 g004 550
Figure 4. Association of RdPrip functions with spinosad in R. dominica. (A) qPCR analysis of RdPrip in susceptible and resistant strains. (B) The number of offspring was higher in susceptible strains than in resistant strains. (C) The mortality of R. dominica to spinosad exposure after knockdown of RdPrip. The error bar represents the standard error of replicates. * or different letters indicate significant differences between treatments (p < 0.05).
Figure 4. Association of RdPrip functions with spinosad in R. dominica. (A) qPCR analysis of RdPrip in susceptible and resistant strains. (B) The number of offspring was higher in susceptible strains than in resistant strains. (C) The mortality of R. dominica to spinosad exposure after knockdown of RdPrip. The error bar represents the standard error of replicates. * or different letters indicate significant differences between treatments (p < 0.05).
Insects 14 00070 g004
Table
Table 1. Sequences of primers used in this study.
Table 1. Sequences of primers used in this study.
Primer NamePrimer Sequence
RdDripdf GGAKGHCAYRTHAAYCCSGCKGTRAC
RdDripdr ABBGGWCCMRCCCARTAMAYCCAWTG
RdDrip450-1ATCAAGGGACTGCTATACGTCGTCG
RdDrip450-2CATTGTCCTGCGATCAAAGCAGACC
RdDrip450-3TACAATGTCTGGGAGCATTAGCTGG
RdDrip450-4TGTAGTCTACAGCCGCCAAATGTCC
RdPrip1008-1GCGATTCCTACAGTACAGTTCGGTTACG
RdPrip1008-2ATGTAGGCATTAGATGAGTGTTGTGCGC
RdPrip qPCR-1GGCAATCTAGTTGTAGGTAATATAC
RdPrip qPCR-2CTCAGTCAAACCAGAATCG
Rd-18s qPCR-01CGAGACTCTGGCCTGCTAAC
Rd-18s qPCR-02CCGCCTGTCCCTCTAAGAA
RdPripdsRNA-03TAATACGACTCACTATAGGGAGATTCTGGTTTGACTGAGCTGCAAG
RdPripdsRNA-04TAATACGACTCACTATAGGGAGAGCATTAGATGAGTGTTGTGCGCT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tan, L.-P.; Chen, M.-E. Regulation of Aquaporin Prip Expression and Its Physiological Function in Rhyzopertha dominica (Coleoptera: Bostrichidae). Insects 2023, 14, 70. https://doi.org/10.3390/insects14010070

AMA Style

Tan L-P, Chen M-E. Regulation of Aquaporin Prip Expression and Its Physiological Function in Rhyzopertha dominica (Coleoptera: Bostrichidae). Insects. 2023; 14(1):70. https://doi.org/10.3390/insects14010070

Chicago/Turabian Style

Tan, Lan-Pin, and Mei-Er Chen. 2023. "Regulation of Aquaporin Prip Expression and Its Physiological Function in Rhyzopertha dominica (Coleoptera: Bostrichidae)" Insects 14, no. 1: 70. https://doi.org/10.3390/insects14010070

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop