Next Article in Journal
Growth Regulation in the Larvae of the Lepidopteran Pieris brassicae: A Field Study
Next Article in Special Issue
Optimal dsRNA Concentration for RNA Interference in Asian Citrus Psyllid
Previous Article in Journal
A Taxonomic Revision of the Assassin Bug Genus, Tympanistocoris (Hemiptera: Reduviidae: Reduviinae)
Previous Article in Special Issue
In Silico Characterization and Gene Expression Analysis of Toll Signaling Pathway-Related Genes in Diaphorina citri
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 14
Issue 2
10.3390/insects14020166
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identifying the Gut Virome of Diaphorina citri from Florida Groves

by
Chun-Yi Lin
1,
Ozgur Batuman
2,3 and
Amit Levy
1,2,*
1
Citrus Research and Education Center, University of Florida, Lake Alfred, FL 33850, USA
2
Department of Plant Pathology, University of Florida, Gainesville, FL 32611, USA
3
Southwest Florida Research and Education Center, University of Florida, Immokalee, FL 34142, USA
*
Author to whom correspondence should be addressed.
Insects 2023, 14(2), 166; https://doi.org/10.3390/insects14020166
Submission received: 18 November 2022 / Revised: 18 January 2023 / Accepted: 3 February 2023 / Published: 8 February 2023
(This article belongs to the Collection Psyllid Vectors: From Genetics to Pest Integrated Management)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Controlling Asian citrus psyllid (Diaphorina citri), the insect vector of Candidatus Liberibacter asiaticus (CLas), is an important part of Huanglongbing management. Specific viruses were recently discovered in a psyllid host where they may act as biological agents for minimizing psyllid populations or CLas transmission. We analyzed the psyllid gut virome from five regions in Florida and identified four D. citri-associated viruses at different compositions. The presence of these specific viruses in the gut indicated potential interactions between these viruses and CLas. Our results provided evidence that D. citri-associated viruses located in the host gut and their potential activities may be useful for pest management.

Abstract

Asian citrus psyllid (Diaphorina citri) transmits the bacterial pathogen Candidatus Liberibacter asiaticus (CLas), the putative causative agent of citrus Huanglongbing disease (HLB). Insect-specific viruses can act against insects as their natural enemies, and recently, several D. citri-associated viruses were discovered. The insect gut plays an important role as not only a pool for diverse microbes but also as a physical barrier to prevent the spread of pathogens such as CLas. However, there is little evidence of the presence of D. citri-associated viruses in the gut and of the interaction between them and CLas. Here, we dissected psyllid guts collected from five growing regions in Florida, and the gut virome was analyzed by high throughput sequencing. Four insect viruses, including D. citri-associated C virus (DcACV), D. citri densovirus (DcDV), D. citri reovirus (DcRV), and D. citri flavi-like virus (DcFLV), were identified, and their presence in the gut, including an additional D. citri cimodo-like virus (DcCLV), were confirmed with PCR-based assays. Microscopic analysis showed that DcFLV infection leads to morphological abnormalities in the nuclear structure in the infected psyllid gut cells. The complex and diverse composition of microbiota in the psyllid gut suggests a possible interaction and dynamics between CLas and the D. citri-associated viruses. Our study identified various D. citri-associated viruses that localized in the psyllid gut and provided more information that helps to evaluate the potential vectors for manipulating CLas in the psyllid gut.

1. Introduction

Asian citrus psyllid (ACP; Diaphorina citri Kuwayama), the insect vector of Candidatus Liberibacter asiaticus (CLas), has transmitted and spread the citrus Huanglongbing (HLB) disease worldwide [1]. All commercial citrus cultivars are susceptible, and the destructive disease has threatened citrus production in the United States and other countries in the world [2,3]. In the US, the approximately $9 billion citrus industry in Florida, as well as in other states such as Texas, California, and Georgia, is facing challenges due to HLB disease [4,5,6,7,8]. Some treatments of citrus plants, including antibiotic applications, nutritional supplements, heat therapy, and plant-immune inducers, have been shown to somewhat delay the plant decline; however, none of these methods overcomes or cures HLB disease [9,10]. Therefore, control of D. citri has become an essential and important issue in HLB disease management. Current control strategies are limited and rely on insecticides to suppress the insect population. Unfortunately, these chemical-based methods are often ineffective because they are non-specific, costly, environmentally unfriendly, and lead to insecticide resistance [11,12,13,14]. Therefore, biological control has been studied and considered to be an effective, specific tool for controlling insect vectors [15,16,17]. The introduction of entomopathogens as a biological control was studied and practiced in fungi, bacteria, viruses, and protozoa [18]. Insect viruses have been used since 1970, to control cotton bollworm [19]. The family Baculoviridae is the best-studied and most-used viral agent worldwide for controlling insect pests from the order Lepidoptera, Hymenoptera, and Coleoptera [20,21]. The baculovirus expression vector system (BEVs) was developed for applications such as (1) post-translational modification to introduce gene delivery in mosquito cell types, larvae and adults [22]; and (2) the surface-display platform to surprise foreign proteins on a viral or cell surface [23]. However, as these natural enemies have narrow host ranges, the diversity of novel insect viruses needs to be studied to cover wide spectra of different insect orders.
Insect microbiomes have been studied, especially in the guts. The interaction of insect and its gut-microflora is involved in many biological and physiological alterations such as (a) mating and reproductive control; (b) essential materials and nutrients supply; (c) immunity and protection against pathogens; (d) diet and digestion compensation [24,25,26,27,28]. To find potential candidates, more recently studies of insect virome were conducted [29,30,31,32]. The diversity and abundance of either DNA or RNA viruses in insects were shown via metagenomics analysis. In D. citri, at least five novel viruses are known: Diaphorina citri-associated C virus (DcACV), Diaphorina citri densovirus (DcDV), Diaphorina citri flavi-like virus (DcFLV), Diaphorina citri picorna-like virus (DcPLV), and Diaphorina citri reovirus (DcRV), from the families Parvoviridae, Flaviviridae, Iflaviridae, Reoviridae, and an unclassified (+) ssRNA virus [33,34,35,36,37]. In Florida, Britt et al. [15] completed a comprehensive surveys of psyllid populations in the major citrus production regions of 21 counties. The results demonstrated that all these five viruses and another novel reo-like virus (D. citri cimodo-like virus, DcCLV) existed in citrus groves [38], and that DcACV was the most prevalent virus (>60%) followed by DcPLV and DcFLV. Additionally, massive reads related to Citrus tristeza virus (CTV) by RNA sequencing were also found in all sample-collecting regions. The results indicated that a high prevalence rate of CTV disease occurred in Florida and the possible acquirement of CTV by D. citri [39]. Recent reports supported the possibility that D. citri could act as a potential vector of CTV to acquire, persist and transmit [40]. To further understand the characteristics of these D. citri-associated viruses in D. citri, more studies of these viruses, such as their distribution and how they interact with psyllid gut tissue, are needed.
Studies have illustrated that the midgut acts as the first physical barrier preventing CLas movement and invasion of hemolymph [41,42,43]. The observed replication sites of CLas in midgut cells highlighted the important role of the midgut [43,44]. Considering that the insect midgut plays a critical role for CLas in establishing and colonizing their insect vectors, the involvement of insect-specific virus may affect those pathogens. Rashidi et al. [45] confirmed that both DcACV and DcFLV co-occurred with CLas and showed a positive correlation in the psyllid population in Florida groves, and that DcFLV co-localized with CLas in the midgut and salivary gland of psyllid. The co-existence of both CLas and each D. citri-associated virus needs to be confirmed, especially in the midgut tissue, which serves as a reservoir and provides additional biological or molecular functions interacting with both pathogens. The interactions of CLas and these viruses and the possible impacts of the interaction on the ability of acquisition, replication, and transmission by psyllid remain unclear.
In this study, the gut virome was studied in psyllids that were collected from five citrus-growing regions of Florida, and novel viral sequences were analyzed via high throughput sequencing. Four D. citri-associated viruses (DcACV, DcDV, DcFLV, and DcRV) were annotated from the RNA-seq database, and their presence together with that of DcCLV were confirmed in the midgut tissue of D. citri by using PCR and RT-PCR. Using microscopic observation, we found abnormal morphology of nuclei in the DcFLV-infected psyllid gut cell, but not in the DcACV-infected gut cell. The study shows that various D. citri-associated viruses exist in the midgut cells of D. citri, indicating complex and diverse interactions among these viral pathogens and the host insect. The results provide additional information to determine the potential roles of these insect-specific viruses as biological tools to manage the psyllid population and limit the transmission of HLB disease.

2. Materials and Methods

2.1. Asian Citrus Psyllid Collection, Gut Dissection and Total RNA Preparation

Adult D. citri psyllids were collected from five commercial citrus groves (Winter Garden, WG; Lake Alfred, LA; Lake Wales, LW; Vero Beach, VB; and Immokalee, IM) in four counties (Orange, Polk, Indian River, and Collier) around central and southern Florida. Approximately 200 adult psyllids were randomly sampled from multiple trees in each grove by using an insect vacuum (BioQuip Product, Inc., Compton, CA, USA). Psyllids collected from each region were separated into BugDorm mesh cages that contained pathogen-free citrus plants (Citrus macrophylla), at 25 ± 2 °C under a 14 light:10 h dark photoperiod and 60–70% relative humidity in the greenhouse. To obtain whole guts, psyllid adults were put in Eppendorf tubes and sedated on ice for 15 min; each adult was then dissected with sharp forceps in phosphate-buffered saline (1× PBS) solution under a stereomicroscope to isolate the midgut [45]. At least 50 guts were prepared from each region and concentrated in a 2.0 mL Eppendorf tube with 1× PBS solution by centrifugation at 12,000 rpm at room temperature; the solution was then removed, and the guts were stored at −20 °C. Total RNAs for RNA-seq analysis were extracted from 50 dissected gut tissues of adult psyllids from each separate cage, using TRIzol reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer’s instructions. The extracted RNAs were verified for sufficient purity (the value of A260/A280: 1.9–2.0) and quantity (avg. 150 ng/µL) for RNA-seq using a BioDrop Spectrophotometer (Biochrom Ltd., Cambridge, UK).

2.2. RNA-Sequencing, Assembly, and Sequence Analyses

RNA samples were sent to the Foundation Plant Service at UC Davis, CA, USA for high-throughput sequencing (HTS) analysis. The HTS analysis was conducted as described by Al Rwahnih et al. [46] and Britt et al. [15]. In brief, aliquots of the total RNA samples were separated and ribosomal RNA depletion and the construction of a cDNA library were performed using TruSeq Stranded Total RNA with RIbo-Zero Plant Kit (Illumina Inc., San Diego, CA, USA). All five samples were sequenced on the Illumina NextSeq 500 platform. To determine the presence of reads from D. citri gut-associated viruses and other viruses in the HTS analysis, two analysis methods were used: a) the raw reads were trimmed and were aligned to the viral GenBank database using a PathoScope version 2.0.6 [47]; b) the resulting reads were adapter-trimmed and de novo assembled with a CLC Genomics Workbench (v8.5.1; Qiagen, Hilden, Germany) into contiguous consensus sequences (contigs) with at least 200 bases lengths. Generated contigs were annotated and compared with the viral genome database of the National Center for Biotechnology Information (NCBI) Refseq using tBLASTx (v2.4.0), (http://www.ncbi.nlm.nih.gov/genome/viruses/) accessed on 2 August 2021 [48]. Possible viral sequence candidates were determined while contigs matched to the viral genome database with a combined E-value equal to or less than 10−4 [46]. A BLASTn (v2.10.1) tool was further used to align assembled contigs to the GenBank database of the NCBI.

2.3. Verification of Viral Sequences in D. citri

A virus-specific reverse transcriptase-polymerase chain reaction (RT-PCR) and quantitative PCR (qPCR) primers were used to validate the presence of these novel viruses in the D. citri gut, based on the assembled list of contigs from HTS results. The sequences, annealing temperatures, and product sizes of the detection primers are shown in Table 1. In brief, two-step RT-PCR and the total RNA extracts from D. citri gut tissue as described above were used. Total RNA was diluted in 30 µL of RNase- and DNase-free water and used for cDNA synthesis. cDNA was synthesized from 100–200 ng RNA using a MultiScribe™ Reverse Transcriptase Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer’s instructions; the cDNA was then used as a template for novel virus detection by PCR and qPCR, respectively. RT-PCR was performed under these conditions: 95 °C for 2 min, 35 cycles of 95 °C 30 s, 50–60 °C 30 s, 72 °C for 1 min, and a final extension at 72 °C for 5 min. The amplicons were separated in 1% agarose gel with 100 vol for 1 h and visualized in Gel doc (Bio-Techne, Minneapolis, MN, USA) for the presence of novel viruses. qPCR detection of CTV was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems, Waltham, MA, USA) using a Taqman® RNA-to-CTTM 1-Step Kit (Applied Biosystems, Waltham, MA, USA) with the CTV-specific primer/probe (Table 1). The reaction was performed in a 12 µL reaction mixture containing 6 µL of 2 × TaqMan® RT-PCR Mix, 0.3 µL of 40× TaqMan® RT Enzyme Mix, 1.25 µL of each primer, 0.1875 µL of the probe and 1 µL of cDNA template. The condition of the qPCR was 50 °C for 15 min, 94 °C for 10 min, 40 cycles at 94 °C for 15 s, and 60 °C for 1 min.

2.4. Psyllid Gut Staining with DAPI

Reproductive organs and guts were dissected from healthy, DcACV-infected and DcFLV-infected adults psyllids as mentioned above. After collecting sufficient numbers of dissected guts (20 or more), we washed the guts three times with 1× PBS solution. Using 4“, 6-diamidino-2-phenylindole (DAPI) Fluoromount-G® (Southern Biotechnology Associates, Inc., Birmingham, AL, USA) staining to visualize the nuclei in gut cells. The dissected guts of healthy and DcFLV-infected psyllids were removed from the excess PBS solution, immersed in approximately 50 µL DAPI Fluoromount-G® and were mounted on microscope slides, covered with coverslips. An inverted laboratory microscope Leica DM IL LED (Leica Microsystems Inc., Deerfield, IL, USA) was used for visualization.

3. Results

3.1. Identification of D. citri-Associated Viruses in the Gut Tissue by HTS and Validation by RT-PCR

The HTS yielded between 13 and 26 million raw reads and generated an average of 41,215 assembled contigs (length > 250 bases) for the five cDNA libraries (Table 2). Assembled sequences were blasted against to the NCBI database and the results showed a similarity to different insect-specific and plant viruses in the gut samples from all five regions (Table 3). Among these, some viral sequences were identical to sequences of five known D. citri-associated viruses, including DcACV, DcDV, DcFLV, and DcRV. To validate the presence of these D. citri-associated viruses in the psyllid gut tissues from each region, RT-PCR was performed to trace back and compare with the results of the HTS. The results showed a 100% match between RT-PCR and HTS that confirmed the presence of these five associated viruses in our surveyed samples (Table 4). In addition, we detected an additional sequence of DcCLV via RT-PCR in Winter Garden. DcACV was found in all the five regions, while DcRV had the lowest incidence in our survey. Furthermore, both HTS and qPCR analysis showed a high prevalence of CTV sequences in the Florida regions as well as Candidatus Liberibacter asiaticus (CLas) (Table 4). More than 40% of the total reads were matched to the CTV genome in three regions; however, less than 3% matches were observed in the other two regions (Figure 1).

3.2. Nuclear Damage of Psyllid Adult Guts under D. citri-Associated Virus Infection

DcACV- and DcFLV- infected insects were observed for the changes in their gut and nuclei morphologies. Compared to the guts from healthy (Figure 2A) psyllids, we observed dark and necrotic-like spots in DcACV- (Figure 2B) and DcFLV-infected psyllid guts (Figure 2C). To investigate the impacts of viral infection on gut cell morphology and nuclear structures, DAPI staining was used on healthy, DcACV- and DcFLV-infected psyllid guts. The stained guts from DcFLV-infected psyllids showed irregular shapes and abnormal structures (Figure 2F), indicating the occurrence of pyknosis and karyorrhexis. In contrast, nuclei from healthy and DcACV-infected psyllids appeared in uniform shapes and normal structures (Figure 2D,E). The morphological abnormalities of nuclei in the gut cells were observed in 41.2% of DcFLV-infected psyllids (total 913 nuclei), while low percentages of nuclei abnormalities were observed in both healthy (18.2%; total 793 nuclei) and DcACV-infected (20.8%; total 378 nuclei) psyllids.

4. Discussion

Biological control has been considered as an effective, persistent, eco-friendly option for pathogen/pest control. In particular, in the field of pest control, potential candidates such as bacteria, fungi, viruses, or endosymbionts were evaluated for their ability and suitability as biological agents [16,20,50,51,52]. Using insect-specific viruses (ISVs) as biological control agents has become a valuable method to control vector-borne diseases [21,36,53,54,55,56]. However, due to their narrow host range, low pathogenicity [57], and the lack of proper cell lines, it is difficult to study insect pests and their viruses. How D. citri-specific pathogens affect their host and, more importantly, how they interfere with CLas, remain unknown. Thus, determining the suitable D. citri-associated virus that can serve as expression vectors can be a first step to providing us with a useful tool to deliver desirable traits into D. citri for further study and control.
Our previous studies showed that DcFLV is systemically distributed throughout D. citri and can be vertically transmitted to offspring. The association between DcFLV and CLas was determined by showing that their incidences are positively correlated and both pathogens co-localize in the midgut [45]. These results suggest that these novel D. citri-associated viruses may not only infect the insect host, but also interact with CLas in the midgut. In this study, HTS results confirmed that four viruses exist in the midgut and indicated that the virus composition in Florida varies in different regions. This composition seems to be much more complex and diverse based on many factors such as climate condition, plant cultivars, and the ecosystem. It also further helps us to identify and determine the biological aspects and possible interaction with the host because the midgut serves as a critical barrier for the replication and transmission of insect-borne pathogens [42,58,59]. It is intriguing to understand how these psyllid-specific viruses, either DNA- or RNA-based, face host defense machinery and interact with other gut symbionts or pathogens such as CLas or CTV. We studied the gut pathogenicity of DcFLV and DcACV, in a single infection in each surveyed region, on the insect host. The microscopic results showed that DcFLV infection can cause gut damage, particularly the nuclear morphology in cells. The necrotic-like symptoms were similar to the process of apoptosis, including nuclear pyknosis and karyorrhexis. In the DcFLV-infected guts, moderate percentages (41.2%) of the nuclear disruption occurred, compared to the normal cell cycle in healthy (18.2%) or DcACV-infected guts (20.8%). The results indicated that DcFLV may have mild virulence to its native insect host. Ghanim et al. [42] previously showed that similar symptoms were observed in the CLas-infected psyllid midgut with a higher occurrence (~65%), but not in the midguts of the potato psyllid-infecting Candidatus Liberibacter solanacerarun (CLso) [60]. The results suggest that either the bacterium or the virus induces different and adaptive levels of immune responses in its insect hosts, leading to cell apoptosis to limit the transmission of pathogens. Although the results indicated the potential pathogenicity of both D. citri-associated virus and CLas to the psyllid gut tissue, we still need more evidence to clarify if either synergism or attenuation occurs when both pathogens exist at the same time. It is critical to understand whether the ISV plays a simple role as a biological agent, or alternatively helps CLas colonization and spread. Based on our HTS and PCR results, it is clear that mix infections of D. citri-associated viruses commonly exist in psyllid populations. It will be interesting to further measure whether additive or competitive effects have an impact on psyllids infected with multiple pathogens.
Insect viral-based expression vectors have been deployed in a wide range of applications; for example, the baculovirus expression vectors system was developed to apply complex molecule production, potential vaccines, and other therapeutic proteins [23]. Because of their being well adapted to insect hosts, ISVs may interfere with the vector transmission of the arbovirus pathogen, the causative agents among humans and animals [61]. ISVs can also be useful to induce different traits in their hosts [37], such as using virus-induced gene silencing (VIGS) to target specific insect RNAs and using engineered viruses to induce host immune response against other pathogens [62,63]. In addition, recombinant ISVs, such as Flaviviridae, can be vector platforms for vaccine development due to their ability to induce immune responses, high stability, and large-scale manufacturing [64,65]. From our studies it is clear that DcFLV can evenly distribute inside psyllids, causing damage to the midgut cells, and shows association with CLas, making it a potential candidate as a biological agent. However, its large genome (~27,000 bp) can limit its usage to perform as an expression vector. DcACV and DcDV may be potential candidates for further investigation, because of a) the most common existence (100%) of DcACV in the field, indicating that it is highly contagious in psyllid populations and b) DcDV’s relatively small DNA genome (~6000 bp) may be easily engineered as an expression platform.
In our HTS analysis, several insect and plant viruses were also assembled and annotated. As in the previous survey [15,38], the Citrus tristeza virus (CTV) seems to commonly exist inside psyllids in four regions explored in this study, but was absent from the grove in Vero Beach, Indian River County. The phenomena suggest that psyllids may easily uptake CTV via phloem-feeding [15], indicating that D. citri also acts as a potential vector of CTV [40]. Based on these findings, the possible interaction between CTV and the psyllid-associated viruses will be an intriguing topic and more studies need to be conducted. Moreover, in the HTS results on the gut virome, we also detected virus-like sequences, known to be associated with Culex mosquito (Culex mononega-like virus 2), earwig (Hubei earwig virus 1), and cabbage looper (Trichoplusia ni TED virus), but no viruses that are associated with insects from the order Hemiptera (Table 3).
In conclusion, we collected D. citri adults from five counties in Florida and dissected the midguts for HTS analysis. The results of D. citri gut virome showed the presence of partial sequences of four known D. citri-associated viruses, and their presence in the guts was further verified by PCR or RT-PCR. The pathogenicity of two viruses was tested and only DcFLV has the ability to harm the insect gut tissue, resulting in an abnormal morphology of the nuclear in shape and structure. The gut organ, which acts as a diversity pool containing various microbiota, plays a critical role and platform for us to investigate the impact of invaders and the inevitable interaction between different pathogens. The study demonstrates initial and basic groundworks of D. citri-specific viruses in the gut organ and provides additional information on the biological roles of these viruses and the potential of biological agents to control the psyllid populations.

Author Contributions

Conceptualization, C.-Y.L., O.B. and A.L.; methodology, C.-Y.L.; validation and formal analysis, C.-Y.L.; writing—original draft preparation, writing—review and editing, C.-Y.L., O.B. and A.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Florida State legislative funding for the UF/IFAS Citrus Initiative.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data will be shared upon request to the corresponding authors.

Acknowledgments

We would like to thank Kristian A Stevens and Maher Al Rwahnih for the assistance of bioinformatic for the HTS analysis. We also thank the Florida citrus growers in each grove from five counties for allowing us to use their groves for ACP collections.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Jagoueix, S.; Bove, J.M.; Garnier, M. The phloem-limited bacterium of greening disease of citrus is a member of the alpha subdivision of the proteobcteria. Int. J. Syst. Bacteriol. 1994, 44, 379–386. [Google Scholar] [CrossRef] [PubMed]
  2. Dala-Paula, B.M.; Plotto, A.; Bai, J.; Manthey, J.A.; Baldwin, E.A.; Ferrarezi, R.S.; Gloria, M.B.A. Effect of huanglongbing or greening disease on orange juice quality: A review. Front. Plant Sci. 2019, 9, 1976. [Google Scholar] [CrossRef] [PubMed]
  3. McCollum, G.; Hilf, M.; Irey, M.; Luo, W.; Gottwald, T. Susceptibility of sixteen citrus genotypes to ‘Candidatus Liberibacter asiaticus’. Plant Dis. 2016, 100, 1080–1086. [Google Scholar] [CrossRef] [PubMed]
  4. Gottwald, T.R. Current epidemiological understanding of citrus huanglongbing. Ann. Rev. Phytopathol. 2010, 48, 119–139. [Google Scholar] [CrossRef] [PubMed]
  5. Hall, D.G.; Richardson, M.L.; Ammar, E.D.; Halbert, S.E. Asian citrus psyllid, Diaphorina citri, vector of citrus huanglongbing disease. Entomol. Exp. Appl. 2013, 146, 207–223. [Google Scholar] [CrossRef]
  6. Kunta, M.; Sétamou, M.; Skaria, M.; Rascoe, J.E.; Li, W.; Nakhla, M.K.; da Graça, J.V. First report of citrus huanglongbing in Texas. Phytopathology 2012, 102, S4–S66. [Google Scholar]
  7. Kumagai, L.B.; LeVesque, C.S.; Blomquist, C.L.; Madishetty, K.; Guo, Y.; Woods, P.W.; Rooney-Latham, S.; Rascoe, J.; Gallindo, T.; Schnabel, D.; et al. First report of Candidatus Liberibacter asiaticus associated with citrus huanglongbing in California. Plant Dis. 2013, 97, 283. [Google Scholar] [CrossRef]
  8. Oliver, J.E.; Ali, M.E.; Waliullah, S.; Price, J.; Warren, J.; Jacobs, J.; Hoppers, A.; Evans, R.; Dowdy, M.; Curry, S. Huanglongbing, caused by ‘Candidatus Liberibacter asiaticus’, Detected in new locations across Southern and Coastal Georgia. Plant Health Prog. 2020, 21, 31–35. [Google Scholar] [CrossRef]
  9. Blaustein, R.A.; Lorca, G.L.; Teplitski, M. Challenges for managing Candidatus Liberibacter spp. (Huanglongbing disease pathogen): Current control measures and future directions. Phytopathology 2018, 108, 424–435. [Google Scholar] [CrossRef]
  10. Munir, S.; He, P.; Wu, Y.; He, P.; Khan, S.; Huang, M.; Cui, W.; He, P.; He, Y. Huanglongbing control: Perhaps the end of the beginning. Microb. Ecol. 2018, 76, 192–204. [Google Scholar] [CrossRef]
  11. Chen, X.D.; Stelinski, L.L. Rapid detection of insecticide resistance in Diaphorina citri (Hemiptera: Liviidae) populations, using a bottle bioassay. Fla. Entomol. 2017, 100, 124–133. [Google Scholar] [CrossRef] [Green Version]
  12. Chen, X.D.; Gill, T.A.; Pelz-Stelinski, K.S.; Stelinski, L.L. Risk assessment of various insecticides used for management of Asian citrus psyllid, Diaphorina citri in Florida citrus, against honeybee, Apis mellifera. Ecotoxicology 2017, 26, 351–359. [Google Scholar] [CrossRef] [PubMed]
  13. Kanga, L.H.; Eason, J.; Haseeb, M.; Qureshi, J.; Stansly, P. Monitoring for insecticide resistance in Asian citrus psyllid (Hemiptera: Psyllidae) populations in Florida. J. Econ. Entomol. 2016, 109, 832–836. [Google Scholar] [CrossRef] [PubMed]
  14. Tiwari, S.; Mann, R.S.; Rogers, M.E.; Stelinski, L.L. Insecticide resistance in field populations of Asian citrus psyllid in Florida. Pest Manag. Sci. 2011, 67, 1258–1268. [Google Scholar] [CrossRef] [PubMed]
  15. Britt, K.; Gebben, S.; Levy, A.; Rwahnih, M.A.; Batuman, O. The detection and surveillance of Asian citrus psyllid (Diaphorina citri)-associated viruses in Florida citrus grove. Front. Plant Sci. 2020, 10, 1687. [Google Scholar] [CrossRef]
  16. Francis, F.; Jacquemyn, H.; Delvigne, F.; Lievens, B. From diverse origins to specific targets: Role of microorganisms in indirect pest biological control. Insects 2020, 11, 533. [Google Scholar] [CrossRef]
  17. Niang, E.H.A.; Bassene, H.; Fenollar, F.; Mediannikov, O. Biological control of mosquito-borne diseases: The potential of Wolbachia-based interventions in an IVM framework. J. Trop. Med. 2018, 2018. [Google Scholar] [CrossRef]
  18. Tanzini, M.; Alves, S.; Setten, A.; Augusto, N. Compatibilidad de agent estensoactivos com Beauveria bassiana y Metarhizium anisopliae. Manejo Integr. Plagas 2001, 59, 15–18. [Google Scholar]
  19. Ignoffo, C.M. Development of a viral insecticide: Concept to commercialization. Exp. Parasitol. 1973, 33, 380–406. [Google Scholar] [CrossRef]
  20. Lacey, L.A.; Grzywacz, D.; Shapiro-Ilan, D.I.; Frutos, R.; Brownbridge, M.; Goettel, M.S. Insect pathogens as biological control agents: Back to the future. J. Invertebr. Pathol. 2015, 132, 1–41. [Google Scholar] [CrossRef]
  21. Sosa-Gómez, D.R.; Morgado, F.S.; Corrê, R.F.T.; Silva, L.A.; Ardisson-Araújo, D.M.P.; Rodrigues, B.M.P.; Oliveira, E.E.; Aguiar, R.W.S.; Ribeiro, B.M. Entomopathogenic viruses in the Neotropics: Current status and recently discovered species. Neotrop. Entomol. 2020, 49, 315–331. [Google Scholar] [PubMed]
  22. Naik, N.G.; Lo, Y.W.; Wu, T.Y.; Lin, C.C.; Kuo, S.C.; Chao, Y.C. Baculovirus as an efficient vector for gene delivery into mosquitoes. Sci. Rep. 2018, 8, 17778. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Tsai, C.H.; Wei, S.C.; Lo, H.R.; Chao, Y.C. Baculovirus as versatile vectors for protein display and biotechnological applications. Curr. Issues Mol. Biol. 2020, 34, 231–255. [Google Scholar]
  24. Arbuthnott, D.; Levin, T.C.; Promislow, D.E. The impacts of Wolbachia and the microbiome on mate choice in Drosophila melanogaster. J. Evol. Biol. 2016, 29, 461–468. [Google Scholar] [CrossRef]
  25. Ben-Yosef, M.; Pasternak, Z.; Jurkevitch, E.; Yuval, B. Symbiotic bacteria enable olive flies (Bactrocera oleae) to exploit intractable sources of nitrogen. J. Evol. Biol. 2014, 27, 2695–2705. [Google Scholar]
  26. Engel, P.; Moran, N.A. The gut microbiota of insects–diversity in structure and function. FEMS Microbiol. Rev. 2013, 37, 699–735. [Google Scholar] [CrossRef] [PubMed]
  27. Engl, T.; Kaltenpoth, M. Influence of microbial symbionts on insect pheromones. Nat. Prod. Rep. 2018, 35, 386–397. [Google Scholar] [PubMed]
  28. Gupta, A.; Nair, S. Dynamics of insect–microbiome interaction influence host and microbial symbiont. Front. Microbiol. 2020, 11. [Google Scholar] [CrossRef]
  29. Bonning, B.C. The insect virome: Opportunities and challenges. Curr. Issues Mol. Biol. 2019, 34, 1–12. [Google Scholar]
  30. Huang, H.J.; Ye, Z.X.; Wang, X.; Yan, X.T.; Zhang, Y.; He, Y.J.; Qi, Y.H.; Zhang, X.D.; Zhuo, J.C.; Lu, G.; et al. Diversity and infectivity of the RNA virome among different cryptic species of an agriculturally important insect vector: Whitefly Bemisia tabaci. Npj Biofilms Microbiomes 2021, 7. [Google Scholar] [CrossRef]
  31. Muñoz-Benavent, M.; Pérez-Cobas, A.E.; García-Ferris, C.; Moya, A.; Latorre, A. Insects’ potential: Understanding the functional role of their gut microbiome. J. Pharm. Biomed. 2021, 194, 113787. [Google Scholar]
  32. Ng, T.F.F.; Willner, D.L.; Lim, Y.W.; Schmieder, R.; Chau, B.; Nilsson, C.; Anthony, S.; Ruan, Y.; Rohwer, F.; Breitbart, M. Broad surveys of DNA viral diversity obtained through viral metagenomics of mosquitoes. PLoS ONE 2011, 6, e20579. [Google Scholar]
  33. Kuo, Y.W.; Matsumura, E.E.; Nigg, J.C.; Chen, Q.; Henry, E.; Nouri, S.; Godfrey, K.E.; Falk, B.W. ACP are full of viruses. Can we use them against HLB? Citrograph 2020, 11, 52–56. [Google Scholar]
  34. Marutani-Hert, M.; Hunter, W.B.; Katsar, C.S.; Sinisterra, X.H.; Hall, D.G.; Powell, C.A. Reovirus-like sequences isolated from adult Asian citrus psyllid, (Hemiptera: Psyllidae: Diaphorina citri). Fla. Entomol. 2009, 92, 314–320. [Google Scholar] [CrossRef]
  35. Nouri, S.; Salem, N.; Falk, B.W. Complete genome sequence of Diaphorina citri-associated C virus, a novel putative RNA virus of the Asian citrus psyllid, Diaphorina citri. Genome Announc. 2016, 4, e00639-16. [Google Scholar]
  36. Nouri, S.; Salem, N.; Nigg, J.C.; Falk, B.W. Diversity array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 2016, 90, 2434–2445. [Google Scholar]
  37. Nouri, S.; Matsumura, E.E.; Kuo, Y.W.; Falk, B.W. Insect-specific viruses: From discovery to potential translational applications. Curr. Opin. Virol. 2018, 33, 33–41. [Google Scholar]
  38. Britt, K.; Stevens, K.; Gebben, S.; Levy, A.; Al Rwahnih, M.; Batuman, O. Partial genome sequence of a novel Reo-like virus detected in Asian citrus psyllid (Diaphorina citri) populations from Florida citrus groves. Microbiol. Resour. Announc. 2021, 10, e00563-21. [Google Scholar]
  39. Britt, K.; Gebben, S.; Levy, A.; Achor, D.; Sieburth, P.; Stevens, K.; Al Rwahnih, M.; Batuman, O. Analysis of Citrus tristeza virus incidences within Asian citrus psyllid (Diaphorina citri) populations in Florida via high-throughput sequencing. Insects 2022, 13, 275. [Google Scholar]
  40. Wu, F.; Huang, M.; Fox, E.G.P.; Huang, J.; Cen, Y.; Deng, X.; Xu, M. Preliminary report on the acquisition, persistence, and potential transmission of Citrus tristeza virus by Diaphorina citri. Insect 2021, 12, 735. [Google Scholar] [CrossRef]
  41. Ammar, E.D.; Shatters Jr, R.G.; Hall, D.G. Localization of Candidatus Liberibacter asiaticus, associated with citrus huanglongbing disease, in its psyllid vector using fluorescence in situ hybridization. J. Phytopathol. 2011, 159, 726–734. [Google Scholar] [CrossRef]
  42. Ghanim, M.; Fattah-Hosseini, S.; Levy, A.; Cilia, M. Morphological abnormalities and cell death in the Asian citrus psyllid (Diaphorina citri) midgut associated with Candidatus Liberibacter asiaticus. Sci. Rep. 2016, 6. [Google Scholar] [CrossRef] [PubMed]
  43. Ghanim, M.; Achor, D.; Ghosh, S.; Kontsedalov, S.; Lebedev, G.; Levy, A. ‘Candidatus Liberibacter asiaticus’ accumulates inside endoplasmic reticulum associated vacuoles in the gut cells of Diaphorina citri. Sci. Rep. 2017, 7, 16945. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Lin, C.Y.; Achor, D.; Levy, A. Intracellular life cycle of ‘Candidatus Liberibacter asiaticus’ inside psyllid gut cells. Phytopathology 2022, 112, 145–153. [Google Scholar] [CrossRef]
  45. Rashidi, M.; Lin, C.Y.; Britt, K.; Batuman, O.; Al Rwahnih, M.; Achor, D.; Levy, A. Diaphorina citri flavi-like virus localization, transmission, and association with Candidatus Liberibacter asiaticus in its psyllid host. Virology 2022, 567, 47–56. [Google Scholar] [PubMed]
  46. Al Rwahnih, M.; Rowhani, A.; Westrick, N.; Stevens, K.; Diaz-Lara, A.; Trouillas, F.P.; Preece, J.; Kallsen, C.; Farrar, K.; Golino, D. Discovery of viruses and virus-like pathogens in pistachio using high-throughput sequencing. Plant Dis. 2018, 102, 1419–1425. [Google Scholar]
  47. Hong, C.; Manimaran, S.; Shen, Y.; Perez-Rogers, J.F.; Byrd, A.L.; Castro-Nallar, E.; Crandall, K.A.; Johnson, W.E. PathoScope 2.0: A complete computational framework for strain identification in environmental or clinical sequencing samples. Microbiome 2014, 2, 33. [Google Scholar]
  48. Tatusova, T.A.; Madden, T.L. BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 1999, 174, 247–250. [Google Scholar]
  49. Harper, S.J.; Cowell, S.J. The past and present status of Citrus tristeza virus in Florida. J. Citrus Pathol. 2016, 3. [Google Scholar] [CrossRef]
  50. van Lenteren, J.C.; Bolckmans, K.; Köhl, J.; Ravensberg, W.J.; Urbaneja, A. Biological control using invertebrates and microorganisms: Plenty of new opportunities. BioControl 2018, 63, 39–59. [Google Scholar]
  51. Hajek, A.E.; Gardescu, S.; Delalibera Jr., I. Summary of classical biological control introductions of entomopathogens and nematodes for insect control. BioControl 2021, 66, 167–180. [Google Scholar] [CrossRef]
  52. Deka, B.; Baruah, C.; Babu, A. Entomopathogenic microorganisms: Their role in insect pest management. Egypt. J. Biol. Pest Control. 2021, 31, 121. [Google Scholar] [CrossRef]
  53. Carvalho, V.L.; Long, M.T. Perspectives on new vaccines against Arboviruses using insect-specific viruses as platforms. Vaccines 2021, 9, 263. [Google Scholar] [CrossRef] [PubMed]
  54. Patterson, E.I.; Villinger, J.; Muthoni, J.N.; Dobel-Ober, L.; Hughes, G.L. Exploiting insect-specific viruses as a novel strategy to control vector-borne disease. Curr. Opin. Insect Sci. 2020, 39, 50–56. [Google Scholar] [CrossRef]
  55. Roundy, C.M.; Azar, S.R.; Rossi, S.L.; Weaver, S.C.; Vasilakis, N. Insect-specific viruses: A historical overview and recent developments. Adv. Virus Res. 2017, 98, 119–146. [Google Scholar]
  56. Sarkar, P.; Ghanim, M. Unravelling the pathogenesis and molecular interactions of Liberibacter phytopathogens with their psyllid vectors. Agronomy 2020, 10, 1132. [Google Scholar] [CrossRef]
  57. Hobson-Peters, J.; Harrison, J.J.; Watterson, D.; Hazlewood, J.E.; Vet, L.J.; Newton, N.D.; Warrilow, D.; Colmant, A.M.; Taylor, C.; Huang, B.; et al. A recombinant platform for flavivirus vaccines and diagnostics using chimeras of a new insect-specific virus. Sci. Transl. Med. 2019, 11, eaax7888. [Google Scholar] [CrossRef]
  58. Szewczyk, B.; Hoyos-Carvajal, L.; Paluszek, M.; Skrzecz, I.; De Souza, M.L. Baculoviruses-re-emerging biopesticides. Biotechnol. Adv. 2006, 24, 143–160. [Google Scholar] [CrossRef] [Green Version]
  59. Gray, S.M.; Cilia, M.; Ghanim, M. Circulative, “nonpropagative” virus transmission: An orchestra of virus, insect and plant derived instruments. Adv. Virus Res. 2014, 89, 141–199. [Google Scholar]
  60. Liu, S.; Sivakumar, S.; Sparks, W.O.; Miller, W.A.; Bonning, B.C. A peptide that binds the pea aphid gut impedes entry of Pea enation mosaic virus into the aphid hemocoel. Virology 2010, 401, 107–116. [Google Scholar] [CrossRef]
  61. Vasilakis, N.; Tesh, R.B. Insect-specific viruses and their potential impact on arbovirus transmission. Curr. Opin. Virol. 2015, 15, 69–74. [Google Scholar] [CrossRef] [PubMed]
  62. Airs, P.M.; Bartholomay, L.C. RNA interference for mosquito and mosquito-borne disease control. Insect 2017, 8, 4. [Google Scholar] [CrossRef] [PubMed]
  63. Adelman, Z.N.; Blair, C.D.; Carlson, J.O.; Beaty, B.J.; Olson, K.E. Sindbis virus-induced silencing of dengue viruses in mosquitoes. Insect Mol. Biol. 2001, 10, 265–273. [Google Scholar] [CrossRef] [PubMed]
  64. Travieso, T.; Li, J.; Mahesh, S.; Mello, J.D.F.R.E.; Blasi, M. The use of viral vectors in vaccine development. Vaccines 2022, 7. [Google Scholar] [CrossRef] [PubMed]
  65. Cicero, J.M.; Fisher, T.W.; Brown, J.K. Localization of ‘Candidatus Liberibacter solanacearum’ and evidence for surface appendages in the potato psyllid vector. Phytopathology 2016, 106, 142–154. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Insects 14 00166 g001 550
Figure 1. The percentage of viral sequence reads found in the HTS analysis of psyllid guts from each citrus production region in Florida. The composite sample represents the sequences that matched to known insect or plant virus species or unknown viruses.
Figure 1. The percentage of viral sequence reads found in the HTS analysis of psyllid guts from each citrus production region in Florida. The composite sample represents the sequences that matched to known insect or plant virus species or unknown viruses.
Insects 14 00166 g001
Insects 14 00166 g002 550
Figure 2. Microscopic analysis of morphological abnormalities of nuclei in gut cells dissected from healthy, DcACV- and DcFLV-infected D. citri adults. (A) Light micrograph of dissected healthy gut showed normal morphology under color and black/white modes. Light micrographs of the dissected guts from DcACV- (B) and DcFLV-infected (C) guts showed dark or brown portions. The magnification photographs of dissected guts from healthy (D) and DcACV-infected (E) showed normal nuclei shapes and structures. The magnification image of the dissected gut from DcFLV-infected gut (F) showed that cell nuclei were irregular in shape and vacant in structure. Percentage of nuclei abnormalities (NA) of each three dissected guts (healthy, DcACV-, DcFLV-infected) is labeled at the bottom.
Figure 2. Microscopic analysis of morphological abnormalities of nuclei in gut cells dissected from healthy, DcACV- and DcFLV-infected D. citri adults. (A) Light micrograph of dissected healthy gut showed normal morphology under color and black/white modes. Light micrographs of the dissected guts from DcACV- (B) and DcFLV-infected (C) guts showed dark or brown portions. The magnification photographs of dissected guts from healthy (D) and DcACV-infected (E) showed normal nuclei shapes and structures. The magnification image of the dissected gut from DcFLV-infected gut (F) showed that cell nuclei were irregular in shape and vacant in structure. Percentage of nuclei abnormalities (NA) of each three dissected guts (healthy, DcACV-, DcFLV-infected) is labeled at the bottom.
Insects 14 00166 g002
Table
Table 1. List of detection primers and probes specific to D. citri-associated virus, and CTV used in the detection and quantification assays.
Table 1. List of detection primers and probes specific to D. citri-associated virus, and CTV used in the detection and quantification assays.
Virus 1PrimersLength of AmpliconTm (°C)Accession NumberReference
DcACVF-5′ GCCGCACGAAACTAGTGATAAACGCA 3′473 bp50KX235518.1[15]
R-5′ GGATCGGTGGTGCACGAGTATGTAAGTA 3′
DcCLVF-5′ ATTTAGGGCCATGTGCAAAG 3′
R-3′ CCAACACACCGAGCATACAC 3′		526 bp62MZ484733.1
DcDVF-5′ AGTCGGTGAGACTGATATCTTCGAGACC 3′1068 bp60KX165268
R-5′ GTTTAGTTCGCTTGTCGGTTACACAGG 3′
DcFLVF-5′ AGGCGAGTACTCCCATCGGATACATT 3′1391 bp58KX267823.1
R-5′ GAGGGCCGCTAAGTCTGTAGGACATATT 3′
DcPLVF-5′ TAGGTGAACGTGATAATCCTGGTAT 3′698 bp62KT698837.1
R-5′ CAGAACGTCTGTTATGAATCGGAC 3′
DcRVF-5′ TTTTCCCAGGTACATCGA 3′900 bp50KT698831.1[36]
R-5′ ACCATTCAGCCAGTCCTA 3′
CTVF-5′ ACCGGAGCTGGCTTGACTGAT 3′113 bp60MZ670758.1[49]
R-5′ CCAAGCTGCCTGACATTAGTAA 3′
Probe: 6-Fam/AGAGTGTGCTGTGTACATACAAGCTAAAGA
1 DcACV, Diaphorina citri-associated C virus; DcCLV, Diaphorina citri Cimodo-like virus; DcDV, Diaphorina citri densovirus; DcFLV, Diaphorina citri flavi-like virus; DcPLV, Diaphorina citri Picorna-like virus; DcRV, Diaphorina citri reovirus; CTV, Citrus tristeza virus.
Table
Table 2. Statistics for D. citri RNA-seq assemblies from five regions in Florida.
Table 2. Statistics for D. citri RNA-seq assemblies from five regions in Florida.
CountyRegionNo. of Read SequencesMegabasesNo. of ContigsBLASTN Virus ContigsKnown Viruses Detected
OrangeWinter Garden16,748,063125646,34411517
CollierImmokalee26,004,558195022,6702112
PolkLake Alfred20,340,968152649,6515819
Indian RiverVero Beach18,793,456141054,646814
PolkLake Wales12,836,29796332,7659917
Table
Table 3. Insect specific virus and Citrus tristeza virus sequences from D. citri gut RNA-seq in five Florida regions identified by alignment against NCBI database.
Table 3. Insect specific virus and Citrus tristeza virus sequences from D. citri gut RNA-seq in five Florida regions identified by alignment against NCBI database.
Virus NameRegion 1Reference Accession NumberLongest Contig Length (bp)Identity (%)Coverage (%)
Diaphorina citri associated C virusWG, LA, LW, VB, IKKX235518.1-19.1237698.5–99.999–100
Diaphorina citri densovirusLA, LW, VBYP_009256210.1-11.167934.6–85.521–88
Diaphorina citri flavi-like virusLW, IKKX267823.12770995.2–10099–100
Diaphorina citri reovirusIKKT698830.1-36.1426694.3–98.888–100
Shuangao insect virus 7WG, LA, VBYP_009179392.113633.026
Wuhan insect virus 19WG, LWYP_009342322.1413437.1–41.874–98
Culex mononega-like virus 2WG, LWASA47292.1207944.8–46.743–81
Photinus pyralis orthomyxo-like virus 2LA, LW, VBAVR52573.171025.1–32.532–91
Liberibacter phage SGCA5-1LAKX879601.13602299.5100
Wolbachia phage WOLAKX522565.16565390.5100
Trichoplusia ni TED virusVBYP_009507248.1108446.795
Hubei earwig virus 1LWAPG77904.175852.458
Lampyris noctiluca errantivirus 1LWQBP37036.1109649.687
Citrus tristeza virusWG, LA, LW, VB, IKMK018120.121929389.1–10089–100
1 WG, Winter Garden; LA, Lake Alfred; LW, Lake Wales; VB, Vero Beach; IK, Immokalee. 2 Reference accession number: MK779711.1; KC517492.1; FJ525434.1; MF595989.1; KR263170.1; EU937520.1; MH279618.1; KU589213.1; HQ662670.1; GQ338588.1; KP268361.1; MN580434.1; AF260651.1; Y18420.1; JX266713.1; FM955925.1; AY65290.1; DQ272579.1; HM573451.
Table
Table 4. The Florida regional presence of D. citri−associated viruses, Citrus tristeza virus (CTV) and Candidatus Liberibacter asiaticus (CLas) in composite psyllid gut samples.
Table 4. The Florida regional presence of D. citri−associated viruses, Citrus tristeza virus (CTV) and Candidatus Liberibacter asiaticus (CLas) in composite psyllid gut samples.
RegionDcACVDcCLVDcDVDcFLVDcPLVDcRVCTVCLas
Winter GardenV 1/+ 2X/+X/−X/−X/−X/−V/++
Lake AlfredV/+X/−X/−X/−X/−X/−V/++
Lake WalesV/+X/−V/+V/+X/−X/−V/++
Vero BeachV/+X/−V/+X/−X/−X/−X/−+
ImmokaleeV/+X/−X/−V/+X/−V/+V/++
Avg. Percentage100%20%40%40%0%20%80%100%
1 V: Viral contigs were detected and annotated with BLASTn; X: No viral contigs were detected. 2 +: Signals were detected by RT−PCR or qRT−PCR; −: No signals were detected. Abbreviations: DcACV: Diaphorina citri associated C virus; DcCLV: Diaphorina citri Cimodo−like virus; DcDV: Diaphorina citri densovirus; DcFLV: Diaphorina citri flavi−like virus; DcPLV: Diaphorina citri Picorna−like virus; DcRV: Diaphorina citri reovirus; CTV: Citrus tristeza virus; CLas: Candidatus Liberibacter asiaticus. WG, Winter Garden; LA, Lake Alfred; LW, Lake Wales; VB, Vero Beach; IK, Immokalee.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lin, C.-Y.; Batuman, O.; Levy, A. Identifying the Gut Virome of Diaphorina citri from Florida Groves. Insects 2023, 14, 166. https://doi.org/10.3390/insects14020166

AMA Style

Lin C-Y, Batuman O, Levy A. Identifying the Gut Virome of Diaphorina citri from Florida Groves. Insects. 2023; 14(2):166. https://doi.org/10.3390/insects14020166

Chicago/Turabian Style

Lin, Chun-Yi, Ozgur Batuman, and Amit Levy. 2023. "Identifying the Gut Virome of Diaphorina citri from Florida Groves" Insects 14, no. 2: 166. https://doi.org/10.3390/insects14020166

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop