A C-Type Lectin, RfCTL27, Activates the Immune Defense in the Red Palm Weevil Rhynchophorus ferrugineus (A.G. Olivier, 1791) (Coleoptera: Curculionidae: Dryophthorinae) by the Recognition of Gram-Negative Bacteria

Simple Summary

Red palm weevil (RPW), Rhynchophorus ferrugineus (Olivier), is an invasive and highly destructive insect pest that poses a significant threat to palm trees. Currently, employing the biological agents are the important alternative method to fight against the infestation and alleviate the pesticide resistance of this pest. However, the control effect is unsatisfactory. It has been well known that the innate immunity plays the vital role for the protection of insect pests upon the attack of pathogens. In this research, we aimed to investigate the role of a C-type lectin, RfCTL27, in the immune response of RPWs. RT-qPCR showed that Escherichia coli induced a significant increase in the expression of RfCTL27 in the gut and fat body. After RfCTL27 was silenced, the expression level of antimicrobial peptide (AMP) genes in the gut and fat body was significantly decreased. Therefore, our findings indicate that RfCTL27 is involved in both systemic and gut local immunity by controlling the expression of AMP genes upon the exposure of Gram-negative bacteria.

Abstract

Red palm weevil, Rhynchophorus ferrugineus (Olivier), is a palm tree insect pest that causes significant damage in the many countries from the Indian sub-continent and southeast Asia into date palm-growing countries of Africa, the Middle East, and the Mediterranean Basin. This study is aimed at determining the role of a C-type lectin, RfCTL27, in the immune defense of RPW larvae. RfCTL27 is a secreted protein that possesses a QPD motif, being integral for the discrimination of Gram-negative bacteria. The abundance of RfCTL27 transcripts in the gut and fat body was significantly higher than that in other tissues. Six hours after injection of Escherichia coli, the expression level of RfCTL27 in the gut of RPW larvae was significantly elevated compared with other groups. At 12 h after injection of E. coli, the expression of RfCTL27 in fat body was dramatically induced in contrast with other treatments. More interestingly, the ability of RPW larvae to clear the pathogenic bacteria in the body cavity and gut was markedly impaired by the silencing of RfCTL27. Additionally, the expression levels of two antimicrobial peptide genes, RfCecropin in the gut and RfDefensin in fat body of RPW larvae, were significantly decreased. Taken together, these data suggested that RfCTL27 can recognize the Gram-negative bacterium and activate the expression of antimicrobial peptides to remove the invaded bacterial pathogens. This study provides a new scientific basis for improving the control efficiency of pathogenic microorganisms against red palm weevils in production practice.

1. Introduction

Red palm weevil (RPW), Rhynchophorus ferrugineus Olivier (Coleoptera: Curculionidae), is an alien destructive insect pest that seriously attacks palm trees and crops, such as sugarcane, and it has caused huge economic loss [1]. Currently, the primary strategy for controlling this pest is through the use of chemical pesticides. Unfortunately, increasing evidence has shown that R. ferrugineus has strong resistance to a variety of commonly used pesticides [2,3]. In the perspective of sustainable development, it is emergent to invent a novel alternative management strategy to fight against this pest. To date, certain biological agents, such as the entomopathogenic fungus Beauveria bassiana (Bals.-Criv.) Vuill. and bacterium Serratia marcescens J have been intensively found to have insecticidal activity against RPW larvae by bioassays in laboratory [4,5]. However, the control efficiency of these biological agents on R. ferrugineus in field is still out of our expectation [6]. It is well known that the innate immunity plays the vital role for the protection of insect pests upon the attack of pathogens. In this context, the elucidation of mechanisms by how insect pests activate their innate immunity to fight against the invaded pathogens is of great importance to improve the control efficiency of biological agents. The issuing of RPW genomic data [7] and the intensive usage of RNA-seq [5,8] advanced the identification of immunity-related genes of R. ferrugineus. Although some pattern recognition receptors (PRRs) have been determined by RNA silencing [9], the mechanisms underlying how the immune system of R. ferrugineus works upon the challenge of pathogens are still far from well known.

C-type lectins (CTLs) belong to a superfamily of proteins that are characterized by the presence of one or more C-type lectin-like domains (CTLDs, also known as carbohydrate-recognition domains, CRDs). These domains have the unique ability to recognize a variety of ligands and play a pivotal role in regulating animal immunity and maintaining homeostasis [10]. The CRD can specifically bind to galactose in the bacterial cell wall to recognize pathogens and activate immune responses in Tribolium castaneum [11]. Similar results have been reported in Drosophila melanogaster [12] and Manduca sexta [13]. These molecules can bind to carbohydrates in a Ca²⁺-dependent manner through conserved motifs, including EPN (Glu-Pro-Asn) and QPD (Gln-Pro-Asp), within the CTLD [13,14]. According to their structure, CTLs are usually classified into three families: the CTL-S family (single CRD), immulectin with dual-CRDs (the IML family), and the CTL-X family (many CRDs with other functional domains) [10]. It has been well verified that CTLs can function as PRRs to mediate animal immune responses, such as opsonization, nodule formation, encapsulation, melanization, and the production of antimicrobial peptides [10,15]. In this study, we combined RT-qPCR, RNAi, and the bioassays on the clearing ability of the invading pathogenic bacterium to validate the function of a CTL gene, RfCTL27, in the immune response of R. ferrugineus.

2. Materials and Methods

2.1. Red Palm Weevil Rearing and Breeding

Red palm weevil adults were bred in the incubator, and the parameters were set to a temperature of 27 ± 1 °C, photoperiod of 12L: 12D, and relative humidity of 75 ± 5%. Red palm weevil adults were bred in plastic boxes (7 cm in diameter, 10 cm high) and fed with fresh sugarcane chips, which were changed every 3 to 4 days. Female adults laid eggs in sugarcane chips. Then, the sugarcane chips were carefully dissected, and the eggs were collected with a brush and transferred to the Petri dish. Freshly hatched larvae were fed with fresh sugarcane chips. For this pest, the infestation of palm trees was mainly from the larval stage. Therefore, the healthy 4th instar larvae of RPW were selected for uncovering their immunity to the exposure of pathogenic microbes.

2.2. Sequence Characterization of RfCTL27

A C-type lectin (RfCTL27) was identified in the genome of the red palm weevil and validated by gene cloning. The Open Reading Frames (ORFs) finding tool (https://www.ncbi.nlm.nih.gov/orffinder/, accessed on 19 May 2023) and ExPASy-Translate tool (https://web.expasy.org/translate/, accessed on 19 May 2023) were used to predict the open reading frame and the encoded amino acid sequence of RfCTL27. To determine the presence of functional motifs and conservative active sites, we conducted multiple sequence alignments of RfCTL27 using MEGA-X and ClustalX 2.0. Then, we employed PhyloSuite 1.22 and IQtree software to construct phylogenetic trees of RfCTL27 and other insect homologous proteins using the maximum likelihood method. Finally, FiguresTree 1.4.4 software was used to beautify the trees.

2.3. Analysis of RfCTL27 Expression in Different Tissues of the RPW Larvae

The 4th instar larvae of the RPW were dissected to obtain the head, cuticle, fat body, foregut, mid- and hindgut, and hemolymph. Three biological replicates were taken from each tissue, each containing three RPW 4th instar larvae. Then, total RNA was extracted from the above different tissues using Eastep^® Super Total RNA Extraction-LS1041. The concentration of total RNA was detected by NanoDrop 2000. RT-qPCR reverse transcription kit X0402 was used to prepare the template of cDNA. The reaction system was as follows: 4 μL 5× FasKing-RT SuperMix, 1 μg total RNA, and added RNase-free water to 20 μL. Primers for RT-qPCR were designed using Primer 3.0.

RT-qPCR was performed with Taq Pro Universal SYBR qPCR Master MixQ712-02. The RT-qPCRs were conducted with the following protocol: denaturation at 96 °C for 10 min, followed by 40 cycles of denaturation at 96 °C for 15 s, and annealing at 59 °C for 1 min. The RT-qPCR reaction system is shown in

Table 1. The composition of RT-qPCR reaction system.

Reagent	Dosage
SYBR mix	10 μL
Forward primer	0.4 μL
Reverse primer	0.4 μL
cDNA	1 μL
ddH2O	8.2 μL
Total	20 μL

. Rfβ-Actin was used as an internal control in the experiment. The RT-qPCR data were calculated by 2^−ΔΔCt method.

2.4. Expression of RfCTL27 in the Gut and Fat Body of RPW Larvae Challenge with Pathogenic Microbes

To determine whether RfCTL27 was involved in the immune response of RPW larvae against pathogenic microbe infection, the Gram-negative bacterium Escherichia coli E and Gram-positive bacterium Staphylococcus aureus Rosenbach were used to challenge RPW larvae by abdominal injection. E. coli and S. aureus were cultured overnight at 37 °C with OD₆₀₀ = 0.65 in Luria–Bertani (LB) medium (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl, and pH 7.2). To prepare the bacterial suspension for challenging RPW larvae, 1 mL of bacterial solution was centrifuged at 5000× g for 8 min at 4 °C, and the supernatant was discarded. Then, the cell pellet was washed with 1 mL of sterilized PBS three times. Finally, the cell pellet was resuspended in PBS to make bacterial suspension with OD₆₀₀ = 1.60. To challenge the RPW 4th instar larvae, 1 μL of bacterial suspension was injected into the body cavity. Totals of 6, 12, and 24 h after infection, the gut and fat body of these treated larvae were collected for total RNA extraction. Three biological replicates were set in each treatment, and each replicate contained four RPW larvae. RT-qPCR was employed to determine the expression level of RfCTL27, as described in Section 2.3.

2.5. The Impact of RfCTL27 Knockdown on RPW Larvae Immune Response and the Count of Gut eGFP-Labeled E. coli Colonies

Double-strand RNA (dsRNA) primers (

Table 2. The primers were used for RT-qPCR and RNAi.

Primers	Sequences (5′-3′)
RT-qPCR
Rfβ-Actin F	CCAAGGGAGCCAAGCAATT
Rfβ-Actin R	CGCTGATGCCCCTATGTATGT
RfCTL27 F	ATCAACGGATGGTTCTGGTC
RfCTL27 R	ACGAAGGGTTTCAGATGGT
RfAttacin F	TGGTTCTGGTGCCCAAGTGA
RfAttacin R	GCCATAACGATTCTTGTTGGAGTA
RfCecropin F	CAGAAGCTGGTTGGTTGAAGA
RfCecropin R	GCAACACCGACATAACCCTGA
RfColeopericin F	TCGTGGTTTCTACCATGTTCACT
RfColeopericin R	TCAGCTAAAACCTGATCTTGGA
RfDefensin F	TTCGCCAAACTTATCCTCGTG
RfDefensin R	GGGTGCTTCGTTATCAACTTCC
RNAi
RfdsCTL27 F	taatacgactcactatagggACCTGGAAGTCGACTGGTTG
RfdsCTL27 R	taatacgactcactatagggAGTTCCTCGCTATCTTCGCA
RfdseGFP F	taatacgactcactatagggCAGTGCTTCAGCCGCTAC
RfdseGFP R	taatacgactcactatagggGTTCACCTGCCGTTCTTGA

) were designed using the E-RNAi (https://www.dkfz.de/signaling/e-rnai3/, accessed on 3 August 2023). RfCTL27 and eGFP dsRNA were synthesized using MEGAscript^® Kit. eGFP dsRNA was used as a control. For gene silencing, 1 μL of dsRNA (1000 ng/μL) was injected into the fourth–fifth intersegmental membrane of the RPW 4th instar larvae. Three biological replicates were set, each containing four insects. Then 48 h of dsRNA injection, the gut and fat body were dissected.

To assess whether the silencing of RfCTL27 impacts both systemic and gut-localized immunity in RPW, we used enhanced green fluorescent protein (eGFP)-labeled E. coli as the pathogen and attacked RPW larvae by abdomen injection and oral feeding. The eGFP-labeled E. coli was prepared for the following treatments according to the method described in Section 2.4. The 4th instar larvae of RPWs injected with dsRNA were fed for 45 h. Then, 1 μL of suspensions containing eGFP-labeled E. coli was injected into the body cavity of RPW larvae. A total of 3 h later, 100 μL hemolymph was extracted in a laminar flow cabinet. The hemolymph was placed in a sterile EP tube containing 3 μL alpha-phenylthiourea (PTU) solution (5 mmol/L) and diluted 1000 times in sterile PBS gradient. A total of 150 μL of hemolymph was distributed on LB solid agar plates that were fortified with ampicillin. The plates were placed upside down in a 37 °C incubator for 12 h, and then the colony-forming units (CFUs) of eGFP-labeled E. coli were observed under a microscope. The CFUs were carefully counted to ensure accuracy. For feeding treatments, we selected healthy 4th instar larvae for our study. These larvae were starved for 12 h after injecting dsRfCTL27 and then fed with fresh sugarcane slices containing 1 mL of eGFP-labeled E. coli suspension. A total of 24 h later, the guts were taken out and ground into homogenate in 1 mL sterile PBS. The homogenate was diluted 1000 times, 100 μL of the gut homogenate was poured on LB mediums containing ampicillin. The counting method was the same as above. Three biological replicates were set in each treatment, and each replicate contained four RPW larvae. In addition, 45 h after RfCTL27 silencing, the expression levels of the four antimicrobial peptide genes RfColeoptericin, RfCecropin, RfDefensin, and RfAttacin were analyzed after injection of E. coli.

2.6. Data Analysis and Processing

The RNAi efficiency and other experiments were detected by t-test. One-way analysis of variance (ANOVA) was used to detect the expression of RfCTL27 in different tissues and the effect of bacterial injection on the expression level of RfCTL27. GraphPad Prism 8.0.1 software was employed to data analysis and drawing. The data in the figures are expressed in the form of mean ± SD.

3. Results

3.1. Sequence Characteristics of RfCTL27

The RfCTL27 encoded a polypeptide, which is 217 residues long. The full length of RfCTL27 was 1007 bp and ORF was 654 bp. RfCTL27 contained two conserved functional domains, a carbohydrate recognition domain (CRD, 41–199 amino acids) and a signal peptide (1–17 amino acids), indicating that it belongs to the CTL-S family (Figure 1a). The binding specificity of RfCTL27 mainly depends on the structural characteristics of CRDs. More interestingly, the Gln-Pro-Asp (QPD) motif was detected in RfCTL27, suggesting that it may recognize the pathogenic microorganisms, such as E. coli, by specifically binding mannose and galactose in their cell wall. Ca²⁺ binding sites were obtained by sequence alignment between RfCTL27 and Rat MBP. The conserved Cysteine residues and two Ca²⁺ binding sites were discovered in CRD of RfCTL27 (Figure 1a,b) and calcium ions were required for the binding activity of RfCTL27. Phylogenetic analysis showed that RfCTL27 clustered with DmCTL-S4, DmCTL-S3, DmCTL-S2, and TcCTL-S2 (Figure 1c). This suggests that RfCTL27 is an orthologous protein in these species, indicating a shared evolutionary origin. Therefore, RfCTL27 may have the same immune recognition function as CTL of Drosophila melanogaster Meigen and Tribolium castaneum (Herbst).

3.2. Expression Profiles of RfCTL27 in the Tissues of RPW Larvae

RT-qPCR assays showed that RfCTL27 presented with significantly different expression levels in multiple tissues of RPW larvae, such as the head, cuticle, foregut, mid- and hindgut, fat body, and hemolymph (ANOVA: F_5,18 = 4.24, p < 0.05). Notably, the expression level of RfCTL27 was significantly higher in the gut and fat body than in the head, cuticle, and hemolymph (Figure 2), implying that RfCTL27 might play some important roles in the local and systemic immunity of RPW larvae.

3.3. Expression Patterns of RfCTL27 upon Pathogen Challenge in RPW Larvae

After 6 h of E. coli injection, the expression level of RfCTL27 in the gut of RPW larvae was significantly higher than that in other groups, i.e., 12 h and 24 h after E. coli challenge (ANOVA: F_2,6 = 9.71, p = 0.013, Figure 3a). In fat body, the expression level of RfCTL27 was significantly elevated at 12 h after the infection of E. coli in contrast with the phosphate-buffered saline (PBS) and S. aureus group (ANOVA: F_2,6 = 43.36, p = 0.029, Figure 3b). Furthermore, the expression level of RfCTL27 in fat body at 12 h after the challenge of E. coli was significantly higher than that of two other timepoints (ANOVA: F_2,6 = 30.67, p = 0.043, Figure 3b). However, the injection of S. aureus into the hemocoel of RPW larvae did not increase the expression level of RfCTL27 in fat body (ANOVA: F_2,6 = 1.46, p = 0.31, Figure 3b). Totally, these results suggest that E. coli infection can affect the expression level of RfCTL27 in the gut of RPWs, and RfCTL27 in the fat body of RPWs may be involved in mediating the systemic immune response of the insect against Gram-negative bacteria.

3.4. Effect of RfCTL27 Silencing on the Immunocompetence of RPW Larvae and Expression of Antimicrobial Peptide Genes in the Gut and Fat Body

After 48 h of dsRNA delivery into the body cavity of RPW larvae, the expression levels of RfCTL27 in the gut and fat body were significantly reduced. The expression level in the gut was significantly dropped by 96.20% (t-test: t = 7.12, p < 0.01), while that in the fat body was significantly dropped by 74.40% (t-test: t = 6.05, p < 0.01) (Figure 4). Moreover, a significant decrease in the relative expression level of the antimicrobial peptide Rfcecropin was detected in the gut of RPW larvae (t-test: t = 3.31, p < 0.05, Figure 5a). More interestingly, the number of eGFP-labeled E. coli colonies (CFU) was 12,500.00 ± 1946.79 in the gut of the fourth instar larvae of the RPW after RNAi interference with RfCTL27, while that of the control group was 7233.33 ± 550.76 (Figure 6). The number of the dsRfCTL27 group was significantly higher than that of the dseGFP group (t-test: t = 4.51, p < 0.05), indicating that RfCTL27 silencing significantly impaired the ability of the gut to eliminate the invaded pathogenic bacteria by oral feeding. These results suggested that RPW gut immunocompetence was compromised by the knockdown of RfCTL27 to reduce the expression level of RfCecropin.

3.5. The Effect of RfCTL27 Knockdown on the Ability of RPW Larvae to Clear to the Invaded E. coli in Hemolymph

In the group of RfCTL27 silencing, 16,146.67 ± 515.88 eGFP-labeled E. coli colonies (CFU) were recovered from the hemolymph of RPW larvae, but that of the control group was 7953.33 ± 853.31 (Figure 7). Statistical analysis revealed that the number of eGFP-labeled E. coli colonies in RfCTL27-silenced insects was significantly greater than that of controls (t-test: t = 14.23, p < 0.05). In fat body, the relative expression level of RfDefensin was also significantly decreased compared with the control group (t-test: t = 3.51, p < 0.05, Figure 5b), suggesting that the systemic immunity of this pest was impaired by RfCTL27 silencing.

4. Discussion

Many studies have indicated an increase in R. ferrugineus immune resistance under the influence of infection with various microorganisms [1,8]. However, the mechanisms underlying how the immune system of RPWs detects and discriminates the invaded microbes have been mostly elusive. In invertebrates, CTLs have been shown to recognize bacteria and mediate immune responses [16,17]. Here, we found that RfCTL27 encodes a polypeptide of 217 amino acids with two conserved functional domains, a CRD (41–199 amino acids) and a signal peptide (1–17 amino acids). The three-dimensional structure of RfCTL27 is a canonical fold, consisting of α-helices, β-sheets, and loops. This fold is stabilized by two pairs of disulfide bonds between Cys (71) and Cys (198), as well as Cys (171) and Cys (190). RT-qPCR analysis showed that the expression levels of RfCTL27 in the gut and fat body of RPW larvae were significantly higher than that in other tissues. For insects, fat body and gut are the important immune organs, which are involved in the systemic and local immunity, respectively [18,19]. Consequently, the higher expression level of RfCTL27 in these two tissues strongly suggest that RfCTL27 might have vital immune functions. More specifically, our data indicated that the challenge of Gram-negative bacterium E. coli dramatically enhanced the expression of RfCTL27 in the fat body and gut of RPW larvae compared with other treatments. The conservative functional domain, a QPD motif, was found in RfCTL27, which can specifically bind to galactose-type carbohydrates, peptidoglycan and lipopolysaccharide on the surface of bacterial wall [10,20,21,22,23,24]. Collectively, these results show that RfCTL27 acts as a PRR to participate in the immune responses of this pest by the discrimination of Gram-negative bacterium.

After RfCTL27 was silenced, we find that the ability of RPW larvae gut and hemolymph to clear eGFP-labeled E. coli was significantly reduced through biological experiments. Furthermore, we found that the silencing of RfCTL27 led to a significant dropping in the expression level of two antimicrobial peptide genes, RfCecropin in the gut and RfDefensin in the fat body of RPW larvae. The antimicrobial peptides are the pivotal effectors for animals to clear the non-self objects including pathogenic bacteria and virus. Two antimicrobial peptides, Defensin and Cecropin, were identified in Anopheles gambiae, and Defensin was found to have antibacterial activity against E. coli [25,26,27]. In Drosophila melanogaster, the antimicrobial peptide Cecropin had stronger bactericidal activity against Gram-negative bacterium E. coli compared to Gram-positive bacterium S. aureus [28]. Consequently, these data evidently indicated that RfCTL27 was concerned with the activation of AMP genes in this pest. The homeostasis of intestinal microbiota largely determines the healthy status of animal hosts [10,19]. CTLs modulate gut microbiome homeostasis by coating the bacterial surface to counteract AMP activity bacteria [29]. More specifically, the CTL24 protein prevents the continuous elimination of gut commensal bacteria, maintaining homeostasis by reducing LysC-mediated muropeptide release and AlfB1’s bacterial activity in shrimp [30]. In the current study, our results implied that RfCTL27 could regulate gut immunity by the modulation of AMP expression. However, the mechanisms of how RfCTL27 mediates the production of antimicrobial peptides and intestinal homeostasis are still unclear. In conclusion, our findings indicate that RfCTL27 is related to the systemic and gut local immunity by regulating the expression of AMP genes under the exposure of Gram-negative bacteria.