A New Endemic Locality of Dermacentor reticulatus in Central–Southern Poland and Its Potential Epidemiological Implications
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Tick Collection and Study Site
2.2. Molecular Analyses
2.3. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nowak-Chmura, M. Fauna of Ticks (Ixodida) of Central Europe; Scientific Publishing House of the Pedagogical University: Krakow, Poland, 2013. (In Polish) [Google Scholar]
- Karbowiak, G. The occurrence of the Dermacentor reticulatus tick-its expansion to new areas and possible causes. Ann. Parasitol. 2014, 60, 37–47. [Google Scholar] [PubMed]
- Dwużnik-Szarek, D.; Mierzejewska, E.J.; Kiewra, D.; Czułowska, A.; Robak, A.; Bajer, A. Update on prevalence of Babesia canis and Rickettsia spp. in adult and juvenile Dermacentor reticulatus ticks in the area of Poland (2016–2018). Sci. Rep. 2022, 12, 5755. [Google Scholar] [CrossRef] [PubMed]
- Kubiak, K.; Sielawa, H.; Dziekońska-Rynko, J.; Kubiak, D.; Rydzewska, M.; Dzika, E. Dermacentor reticulatus ticks (Acari: Ixodidae) distribution in north-eastern Poland: An endemic area of tick-borne diseases. Exp. Appl. Acarol. 2018, 75, 289–298. [Google Scholar] [CrossRef] [PubMed]
- Stańczak, J.; Biernat, B.; Racewicz, M.; Zalewska, M.; Matyjasek, A. Prevalence of different Rickettsia spp. in Ixodes ricinus and Dermacentor reticulatus ticks (Acari: Ixodidae) in north-eastern Poland. Ticks Tick Borne Dis. 2018, 9, 427–434. [Google Scholar] [CrossRef]
- Grochowska, A.; Dunaj-Małyszko, J.; Pancewicz, S.; Czupryna, P.; Milewski, R.; Majewski, P.; Moniuszko-Malinowska, A. Prevalence of Tick-Borne Pathogens in Questing Ixodes ricinus and Dermacentor reticulatus Ticks Collected from Recreational Areas in Northeastern Poland with Analysis of Environmental Factors. Pathogens 2022, 11, 468. [Google Scholar] [CrossRef] [PubMed]
- Buczek, W.; Buczek, A.; Witecka, J.; Asman, M. Prevalence of pathogens in sympatric Ixodes ricinus and Dermacentor reticulatus ticks in Eastern Poland and their potential impact on oral-anal contacts between ticks. Ann. Agric. Environ. Med. 2023, 30, 259–265. [Google Scholar] [CrossRef] [PubMed]
- Zając, Z.; Obregon, D.; Foucault-Simonin, A.; Wu-Chuang, A.; Moutailler, S.; Galon, C.; Kulisz, J.; Woźniak, A.; Bartosik, K.; Cabezas-Cruz, A. Disparate dynamics of pathogen prevalence in Ixodes ricinus and Dermacentor reticulatus ticks occurring sympatrically in diverse habitats. Sci. Rep. 2023, 13, 10645. [Google Scholar] [CrossRef] [PubMed]
- Földvári, G.; Široký, P.; Szekeres, S.; Majoros, G.; Sprong, H. Dermacentor reticulatus: A vector on the rise. Parasit. Vectors 2016, 9, 314. [Google Scholar] [CrossRef]
- Medlock, J.M.; Hansford, K.M.; Vaux, A.G.C.; Cull, B.; Abdullah, S.; Pietzsch, M.E.; Wall, R.; Johnson, N.; Phipps, L.P. Distribution of the tick Dermacentor reticulatus in the United Kingdom. Med. Vet. Entomol. 2017, 31, 281–288. [Google Scholar] [CrossRef]
- Kolomiiets, V.; Rakowska, P.; Rymaszewska, A. New problems of environmental ecology: Ticks and tick-borne pathogens in city parks of Ukraine. Environ. Microbiol. Rep. 2022, 14, 591–594. [Google Scholar] [CrossRef]
- Buczek, W.; Bartosik, K.; Buczek, A. Development of Dermacentor reticulatus ticks in human household conditions. J. Pest Sci. 2024, 97, 1069–1079. [Google Scholar] [CrossRef]
- Rubel, F.; Brugger, K.; Pfeffer, M.; Chitimia-Dobler, L.; Didyk, Y.M. Geographical distribution of Dermacentor marginatus and Dermacentor reticulatus in Europe. Ticks Tick Borne Dis. 2016, 7, 224–233. [Google Scholar] [CrossRef] [PubMed]
- Ličková, M.; Fumačová Havlíková, S.; Sláviková, M.; Slovák, M.; Drexler, J.F.; Klempa, B. Dermacentor reticulatus is a vector of tick-borne encephalitis virus. Ticks Tick Borne Dis. 2020, 11, 101414. [Google Scholar] [CrossRef]
- Garcia-Vozmediano, A.; Krawczyk, A.I.; Sprong, H.; Rossi, L.; Ramassa, E.; Tomassone, L. Ticks climb the mountains: Ixodid tick infestation and infection by tick-borne pathogens in the Western Alps. Ticks Tick Borne Dis. 2020, 11, 101489. [Google Scholar] [CrossRef]
- Hvidsten, D.; Frafjord, K.; Gray, J.S.; Henningsson, A.J.; Jenkins, A.; Kristiansen, B.E.; Lager, M.; Rognerud, B.; Slåtsve, A.M.; Stordal, F.; et al. The distribution limit of the common tick, Ixodes ricinus, and some associated pathogens in north-western Europe. Ticks Tick Borne Dis. 2020, 11, 101388. [Google Scholar] [CrossRef]
- Kiewra, D.; Szymanowski, M.; Czułowska, A.; Kolanek, A. The local-scale expansion of Dermacentor reticulatus ticks in Lower Silesia, SW Poland. Ticks Tick Borne Dis. 2021, 12, 101599. [Google Scholar] [CrossRef] [PubMed]
- Zając, Z.; Kulisz, J.; Woźniak, A.; Bartosik, K.; Foucault-Simonin, A.; Moutailler, S.; Cabezas-Cruz, A. Tick Activity, Host Range, and Tick-Borne Pathogen Prevalence in Mountain Habitats of the Western Carpathians, Poland. Pathogens 2023, 12, 1186. [Google Scholar] [CrossRef] [PubMed]
- Gray, J.S.; Dautel, H.; Estrada-Peña, A.; Kahl, O.; Lindgren, E. Effects of climate change on ticks and tick-borne diseases in Europe. Interdiscip. Perspect. Infect. Dis. 2009, 2009, 593232. [Google Scholar] [CrossRef] [PubMed]
- Medlock, J.M.; Hansford, K.M.; Bormane, A.; Derdakova, M.; Estrada-Peña, A.; George, J.-C.; Golovljova, I.; Jaenson, T.G.T.; Jensen, J.-K.; Jensen, P.M.; et al. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe. Parasit. Vectors 2013, 6, 1. [Google Scholar] [CrossRef]
- Mierzejewska, E.J.; Estrada-Peña, A.; Bajer, A. Spread of Dermacentor reticulatus is associated with the loss of forest area. Exp. Appl. Acarol. 2017, 72, 399–413. [Google Scholar] [CrossRef]
- Błaszkiewicz, P. Dermacentor reticulatus as a Vector of Pathogens in Anthropopressure Unaffected Areas in Eastern Poland. Ph.D. Dissertation, Medical University of Lublin, Lublin, Poland, 27 September 2022. (In Polish). [Google Scholar]
- Mierzejewska, E.J.; Estrada-Peña, A.; Alsarraf, M.; Kowalec, M.; Bajer, A. Mapping of Dermacentor reticulatus expansion in Poland in 2012–2014. Ticks Tick Borne Dis. 2016, 7, 94–106. [Google Scholar] [CrossRef]
- Opalińska, P.; Wierzbicka, A.; Asman, M. The PCR and nested PCR detection of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti in Dermacentor reticulatus F. collected in a new location in Poland (Trzciel, Western Poland). Acta Parasitol. 2016, 61, 849–854. [Google Scholar] [CrossRef] [PubMed]
- Kolesiński, M.; Nowak-Kolesińska, A.; Walker, M.; Błasiak, M. Sławków Commune—Study of Conditions and Directions of Spatial Development of the City of Sławków. 2016. Available online: https://bip.slawkow.pl/res/serwisy/pliki/14583591?version=1.0 (accessed on 14 January 2024). (In Polish).
- Siuda, K. Ticks of Poland (Acari: Ixodida). Part II. Systematic and Distribution; The Polish Parasitological Society: Warszawav, Poland, 1993. (In Polish) [Google Scholar]
- Supergan, M.; Karbowiak, G. The estimation scale of endangerment with tick attacks on recreational towns areas. Przegląd Epidemiol. 2009, 63, 67–71. [Google Scholar]
- Guy, E.C.; Stanek, G. Detection of Borrelia burgdorferi in patients with Lyme disease by the polymerase chain reaction. J. Clin. Pathol. 1991, 44, 610–611. [Google Scholar] [CrossRef] [PubMed]
- Massung, R.F.; Slater, K.; Owens, J.H.; Nicholson, W.I.; Mather, T.N.; Solberg, V.B.; Olson, J.G. Nested PCR assay for detection of granulocytic ehrlichiae. J. Clin. Microbiol. 1998, 36, 1090–1095. [Google Scholar] [CrossRef] [PubMed]
- Blaschitz, M.; Narodoslavsky-Gföller, M.; Kanzler, M.; Stanek, G.; Walochnik, J. Babesia species occurring in Austrian Ixodes ricinus ticks. Appl. Environ. Microbiol. 2008, 74, 4841–4846. [Google Scholar] [CrossRef]
- Renesto, P.; Gouvernet, J.; Drancourt, M.; Roux, V.; Raoult, D. Use of rpoB gene analysis for detection and identification of Bartonella species. J. Clin. Microbiol. 2001, 39, 430–437. [Google Scholar] [CrossRef]
- Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef]
- Le, C.T.; Boen, J.R. Health and Numbers: Basic Biostatistical Methods; John Wiley: Chichester, UK, 1995. [Google Scholar]
- Nowak, M. Discover of Dermacentor reticulatus (Acari: Amblyommidae) populations in the Lubuskie Province (Western Poland). Exp. Appl. Acarol. 2011, 54, 191–197. [Google Scholar] [CrossRef]
- Karbowiak, G.; Kiewra, D. New locations of Dermacentor reticulatus ticks in Western Poland. The first evidence of the merge in D. reticulatus occurrence areas? Wiadomości Parazytol. 2010, 56, 333–340. [Google Scholar]
- Kiewra, D.; Czułowska, A. Evidence for an increased distribution range of Dermacentor reticulatus in south-west Poland. Exp. Appl. Acarol. 2013, 59, 501–506. [Google Scholar] [CrossRef] [PubMed]
- Cuber, P.; Solarz, K.; Mosiałek, A.; Jakubiec-Spanier, M.; Spanier, A. The first record and occurrence of the ornate cow tick Dermacentor reticulatus (Fabricius, 1794) in south-western Poland. Ann. Parasitol. 2013, 59, 49–51. [Google Scholar]
- Pawełczyk, O.; Kotela, D.; Asman, M.; Witecka, J.; Wilhelmsson, P.; Bubel, P.; Solarz, K. The first records of canine Babesiosis in dogs from Dermacentor reticulatus -free zone in Poland. Pathogens 2022, 11, 1329. [Google Scholar] [CrossRef]
- Zahler, M.; Gothe, R. Effect of temperature and humidity on longevity of unfed adults and on oviposition of engorged females of Dermacentor reticulatus (Ixodidae). Appl. Parasitol. 1995, 36, 200–211. [Google Scholar] [PubMed]
- Zahler, M.; Gothe, R. Effect of temperature and humidity on egg hatch, moulting and longevity of larvae and nymphs of Dermacentor reticulatus (Ixodidae). Appl. Parasitol. 1995, 36, 53–65. [Google Scholar]
- Meyer-König, A.; Zahler, M.; Gothe, R. Studies on the critical water mass and the rehydration potential of unfed adult Dermacentor marginatus and D. reticulatus ticks (Acari: Ixodidae). Exp. Appl. Acarol. 2001, 25, 505–516. [Google Scholar] [CrossRef]
- Scandura, M.; Iacolina, L.; Apollonio, M. Genetic diversity in the European wild boar Sus scrofa: Phylogeography, population structure and wild x domestic hybridization. Mammal Rev. 2011, 41, 125–137. [Google Scholar] [CrossRef]
- Andersen, L.W.; Harms, V.; Caniglia, R.; Kluth, G.; Madsen, A.B.; Jędrzejewska, B.; Kluth, G.; Madsen, A.B.; Nowak, C.; Pertoldi, C.; et al. Long-distance dispersal of a wolf, Canis lupus, in northwestern Europe. Mammal Rev. 2015, 60, 163–168. [Google Scholar] [CrossRef]
- Wymazał, A.; Nowak, S.; Mysłajek, R.W.; Bajer, A.; Welc-Falęciak, R.; Szewczyk, M.; Kwiatkowska, I.; Stępniak, K.M.; Figura, M.; Kloch, A. Tick-borne infections in wolves from an expanding population in Eastern Europe. Ticks Tick Borne Dis. 2024, 15, 102272. [Google Scholar] [CrossRef]
- Mysterud, A.; Qviller, L.; Meisingset, E.L.; Viljugrein, H. Parasite load and seasonal migration in red deer. Oecologia 2016, 180, 401–407. [Google Scholar] [CrossRef]
- Mierzejewska, E.J.; Pawełczyk, A.; Radkowski, M.; Welc-Falęciak, R.; Bajer, A. Pathogens vectored by the tick, Dermacentor reticulatus, in endemic regions and zones of expansion in Poland. Parasit. Vectors 2015, 8, 490. [Google Scholar] [CrossRef] [PubMed]
- Zając, V.; Wójcik-Fatla, A.; Sawczyn, A.; Cisak, E.; Sroka, J.; Kloc, A.; Zając, Z.; Buczek, A.; Dutkiewicz, J.; Bartosik, K. Prevalence of infections and co-infections with 6 pathogens in Dermacentor reticulatus ticks collected in eastern Poland. Ann. Agric. Environ. Med. 2017, 24, 26–32. [Google Scholar] [CrossRef]
- Grochowska, A.; Dunaj, J.; Pancewicz, S.; Czupryna, P.; Majewski, P.; Wondim, M.; Tryniszewska, E. Detection of Borrelia burgdorferi s.l., Anaplasma phagocytophilum and Babesia spp. in Dermacentor reticulatus ticks found within the city of Białystok, Poland-first data. Exp. Appl. Acarol. 2021, 85, 63–73. [Google Scholar] [CrossRef]
- Dunaj, J.; Trzeszczkowski, A.; Moniuszko-Malinowska, A.; Rutkowski, K.; Pancewicz, S. Assessment of tick-borne pathogens presence in Dermacentor reticulatus ticks in north-eastern Poland. Adv. Med. Sci. 2021, 66, 113–118. [Google Scholar] [CrossRef] [PubMed]
- Wójcik-Fatla, A.; Cisak, E.; Zając, V.; Sroka, J.; Sawczyn, A.; Dutkiewicz, J. Study on tick-borne rickettsiae in eastern Poland. I. Prevalence in Dermacentor reticulatus (Acari: Amblyommidae). Ann. Agric. Environ. Med. 2013, 20, 276–279. [Google Scholar]
- Zając, Z.; Kulisz, A.; Woźniak, A.; Obregón, D.; Foucault-Simonin, A.; Bartosik, K.; Moutailler, S.; Cabezas-Cruz, A. Spatial Distribution and Pathogen Profile of Dermacentor reticulatus Ticks in Southeastern Poland: A Genetic and Environmental Analysis. Transbound. Emerg. Dis. 2024, 2024, 5458278. [Google Scholar] [CrossRef]
- Balážová, A.; Földvári, G.; Bilbija, B.; Nosková, E.; Široký, P. High Prevalence and Low Diversity of Rickettsia in Dermacentor reticulatus Ticks, Central Europe. Emerg. Infect. Dis. 2022, 28, 893–895. [Google Scholar] [CrossRef]
- Pawełczyk, A.; Bednarska, M.; Hamera, A.; Religa, E.; Poryszewska, M.; Mierzejewska, E.J.; Welc-Falęciak, R. Long-term study of Borrelia and Babesia prevalence and co-infection in Ixodes ricinus and Dermacentor recticulatus ticks removed from humans in Poland, 2016–2019. Parasit. Vectors 2021, 14, 348. [Google Scholar] [CrossRef]
- Asman, M.; Solarz, K.; Szilman, E.; Szilman, P.; Sikora, B.; Jakubas-Zawalska, J. The occurrence of three tick-borne pathogens in Ixodes ricinus ticks collected from the area of the Kraków-Częstochowa Upland (Southern Poland). Acarologia 2018, 58, 967–975. [Google Scholar] [CrossRef]
- Asman, M.; Pindel, Ł.; Solarz, K. The risks of occupational exposure to spirochaetes Borrelia and Babesia sp. in ticks (Acari: Ixodida) collected from recreational areas of Silesian area of Zywiecki Landscape Park. In Arthropods. Threat to Human and Animals Health; Buczek, A., Błaszak, C., Eds.; Koliber: Lublin, Poland, 2014; pp. 140–153. (In Polish) [Google Scholar]
- Asman, M.; Witecka, J.; Solarz, K.; Zwonik, A.; Szilman, P. Occurrence of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti in Ixodes ricinus ticks collected from selected areas of Opolskie Province in south-west Poland. Ann. Agric. Environ. Med. 2019, 26, 544–547. [Google Scholar] [CrossRef]
- Strzelczyk, J.K.; Gaździcka, J.; Cuber, P.; Asman, M.; Trapp, G.; Gołąbek, K.; Zalewska-Ziob, M.; Nowak-Chmura, M.; Siuda, K.; Wiczkowski, A.; et al. Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from southern Poland. Acta Parasitol. 2015, 60, 666–674. [Google Scholar] [CrossRef]
- Krause, P.J.; Telford, S.R., 3rd; Spielman, A.; Sikand, V.; Ryan, R.; Diane Christianson, R.N.; Burke, G.; Brassard, P.; Pollack, R.; Peck, J.; et al. Concurrent Lyme disease and babesiosis. Evidence for increased severity and duration of illness. JAMA 1996, 275, 1657–1660. [Google Scholar] [CrossRef] [PubMed]
- Djokic, V.; Akoolo, L.; Primus, S.; Schlachter, S.; Kelly, K.; Bhanot, P.; Parveen, N. Protozoan Parasite Babesia microti Subverts Adaptive Immunity and Enhances Lyme Disease Severity. Front. Microbiol. 2019, 10, 1596. [Google Scholar] [CrossRef] [PubMed]
- Sawczyn-Domańska, A.; Zwoliński, J.; Kloc, A.; Wójcik-Fatla, A. Prevalence of Borrelia, Neoehrlichia mikurensis and Babesia in ticks collected from vegetation in eastern Poland. Exp. Appl. Acarol. 2023, 90, 409–428. [Google Scholar] [CrossRef] [PubMed]
- Stańczak, J.; Gabre, R.M.; Kruminis-Łozowska, W.; Racewicz, M.; Kubica-Biernat, B. Ixodes ricinus as a vector of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti in urban and suburban forests. Ann. Agric. Environ. Med. 2004, 11, 109–114. [Google Scholar] [PubMed]
- Skotarczak, B.; Wodecka, B.; Cichocka, A. Coexistence DNA of Borrelia burgdorferi sensu lato and Babesia microti in Ixodes ricinus ticks from north-western Poland. Ann. Agric. Environ. Med. 2002, 9, 25–28. [Google Scholar] [PubMed]
- Grochowska, A.; Milewski, R.; Pancewicz, S.; Dunaj, J.; Czupryna, P.; Milewska, A.J.; Róg-Makal, M.; Grygorczuk, S.; Moniuszko-Malinowska, A. Comparison of tick-borne pathogen prevalence in Ixodes ricinus ticks collected in urban areas of Europe. Sci. Rep. 2020, 10, 6975. [Google Scholar] [CrossRef] [PubMed]
- Dyczko, D.; Kiewra, D.; Kolanek, A.; Błażej, P. The influence of local environmental factors in southwestern Poland on the abundance of Ixodes ricinus and prevalence of infection with Borrelia burgdorferi s.l. and B. miyamotoi. Parasitol. Res. 2022, 121, 1575–1585. [Google Scholar] [CrossRef] [PubMed]
- Lim, P.L.; Chavatte, J.M.; Vasoo, S.; Yang, J. Imported Human Babesiosis, Singapore, 2018. Emerg. Infect. Dis. 2020, 26, 826–828. [Google Scholar] [CrossRef]
- Kik, M.; Nijhof, A.M.; Balk, J.A.; Jongejan, F. Babesia sp. EU1 infection in a forest reindeer, The Netherlands. Emerg. Infect. Dis. 2011, 17, 936–938. [Google Scholar] [CrossRef]
- Cassini, R.; Bonoli, C.; Montarsi, F.; Tessarin, C.; Marcer, F.; Galuppi, R. Detection of Babesia EU1 in Ixodes ricinus ticks in northern Italy. Vet. Parasitol. 2010, 171, 151–154. [Google Scholar] [CrossRef] [PubMed]
- Bartosik, K.; Buczek, A.; Borzęcki, A.; Kulina, D. Study of the non-parasitic stage in Ixodes ricinus after co-feeding with Dermacentor reticulatus in three infestations. Ann. Agric. Environ. Med. 2017, 24, 90–95. [Google Scholar] [CrossRef] [PubMed]
- States, S.L.; Huang, C.I.; Davis, S.; Tufts, D.M.; Diuk-Wasser, M.A. Co-feeding transmission facilitates strain coexistence in Borrelia burgdorferi, the Lyme disease agent. Epidemics 2017, 19, 33–42. [Google Scholar] [CrossRef] [PubMed]
Pathogen (Gene Detected) | Primer | Sequence (5′-3′) | Size of Amplification Product [bp] | PCR Conditions [°C/s] | No. of Cycles | Reference | ||
---|---|---|---|---|---|---|---|---|
Denaturation | Annealing | Extension | ||||||
Anaplasma phagocytophilum (16S rRNA) | ge3a | CACATGCAAGTCGAACGGATTATTC | 932 | 94/30 | 55/30 | 72/60 | 40 | [29] |
ge10r | TTCCGTTAAGAAGGATCTAATCTCC | |||||||
ge9f | AACGGATTATTCTTTATAG CTTGCT | 546 | 94/30 | 55/30 | 72/60 | 30 | ||
ge2 | GGCAGTATTAAAAGCAGCTCCAGG | |||||||
Bartonella spp. (rpoB) | 1400F | CGCATTGGCTTACTTCGTATG | 825 | 94/30 | 53/30 | 72/45 | 35 | [31] |
2300R | GTAGACTGATTAGAACGCTG | |||||||
Rickettsia spp. (gltA) | RpCS.877p | GGGGGCCTGCTCACGGCGG | 381 | 95/20 | 48/30 | 60/120 | 35 | [32] |
RpCS.1258n | ATTGCAAAAAGTACAGTGAACA | |||||||
Babesia spp. (18S rRNA) | Babfor | GACTAGGGATTGGAGGTC | 620 | 94/60 | 53/45 | 72/90 | 35 | [30] |
Babrev | GAATAATTCACCGGATCACTC |
Tick Species | Meadow Habitat N (%) | Ecotone Habitat N (%) | Total | ||||
---|---|---|---|---|---|---|---|
F | M | A | F | M | A | ||
Dermacentor reticulatus | 16 (88.9) | 14 (93.3) | 30 (90.9) | 9 (52.9) | 9 (60.0) | 18 (56.3) | 48 (100) |
Ixodes ricinus | 2 (11.1) | 1 (6.7) | 3 (9.1) | 8 (47.1) | 6 (40.0) | 14 (43.7) | 17 (100) |
Total * | 18 (100) | 15 (100) | 33 (100) | 17 (100) | 15 (100) | 32 (100) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Asman, M.; Bartosik, K.; Jakubas-Zawalska, J.; Świętek, A.; Witecka, J. A New Endemic Locality of Dermacentor reticulatus in Central–Southern Poland and Its Potential Epidemiological Implications. Insects 2024, 15, 580. https://doi.org/10.3390/insects15080580
Asman M, Bartosik K, Jakubas-Zawalska J, Świętek A, Witecka J. A New Endemic Locality of Dermacentor reticulatus in Central–Southern Poland and Its Potential Epidemiological Implications. Insects. 2024; 15(8):580. https://doi.org/10.3390/insects15080580
Chicago/Turabian StyleAsman, Marek, Katarzyna Bartosik, Justyna Jakubas-Zawalska, Agata Świętek, and Joanna Witecka. 2024. "A New Endemic Locality of Dermacentor reticulatus in Central–Southern Poland and Its Potential Epidemiological Implications" Insects 15, no. 8: 580. https://doi.org/10.3390/insects15080580