Next Article in Journal
Combined Toxic Effects of Lead and Glyphosate on Apis cerana cerana
Previous Article in Journal
Phylogenetic and Comparative Analysis of Cryptochironomus, Demicryptochironomus and Harnischia Inferred from Mitogenomes (Diptera: Chironomidae)
Previous Article in Special Issue
Drosophila melanogaster Limostatin and Its Human Ortholog Promote West Nile Virus Infection
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 15
Issue 9
10.3390/insects15090643
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

BmToll9-1 Is a Positive Regulator of the Immune Response in the Silkworm Bombyx mori

by
Jisheng Liu
*,†,
Weijian Chen
†,
Jinrong Situ
,
Jiaxuan Li
,
Jiahua Chen
,
Minchun Lai
,
Fengyi Huang
and
Baoqi Li
School of Life Sciences, Guangzhou University, Guangzhou 510006, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Insects 2024, 15(9), 643; https://doi.org/10.3390/insects15090643
Submission received: 26 July 2024 / Revised: 21 August 2024 / Accepted: 26 August 2024 / Published: 27 August 2024
(This article belongs to the Collection Insect Immunity: Evolution, Genomics and Physiology)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Insects rely on innate immunity to defend against invading pathogens in nature. BmToll9-1 is a receptor in the immune pathway of silkworms. BmToll9-1 is abundantly present in the midgut tissue of silkworm larvae. Silencing of BmToll9-1 results in smaller larval and cocoon bodies. Concomitantly, the expression of most downstream genes in the immune pathways is reduced. The antibacterial activity of hemolymph is also inhibited. The findings reveal that BmToll9-1 plays a positive role in regulating the development and immune response in silkworm.

Abstract

Toll receptors are involved in the development and innate immunity of insects. BmToll9-1 is an important immune receptor in the Toll pathway. Previous studies have focused on its role as a receptor in immune response. In this study, we aimed to investigate the role of BmToll9-1 as a regulator in the immune response. The expression profiles demonstrated that BmToll9-1 was predominantly expressed in the midgut. RNA interference (RNAi) of BmToll9-1 was found to be effective in the midgut via the injection of dsRNA, which resulted in smaller and lighter larvae and cocoons. Most signaling genes in the Toll pathway and downstream effector genes were downregulated after the RNAi of BmToll9-1. The hemolymph from BmToll9-1-silenced larvae showed decreased antibacterial activity against Escherichia coli, either in growth curve or inhibition zone experiments. The above results indicate that BmToll9-1 might be positively involved in the immune pathway of silkworm. As a positive regulator, BmToll9-1 might function mainly in the gut to maintain microbial homeostasis to regulate the growth of silkworms. Silencing of BmToll9-1 downregulates the signaling genes in the Toll pathway and antimicrobial peptide (AMP) production, resulting in decreased antibacterial activity in the hemolymph.

1. Introduction

The silkworm Bombyx mori, an economically important insect with a long history in China, not only provides silk for textiles but also has significant scientific research value [1]. Insects resist the invasion of exogenous pathogens primarily through their innate immune system [2], which synthesizes and secretes antimicrobial peptides (AMPs), mediated by the Toll and immune deficiency (IMD) signaling pathways [3]. The Toll and IMD signaling pathway are triggered by Gram-positive bacteria and fungi as well as Gram-negative bacteria, respectively [4].
The first Toll receptor was discovered during studies of embryonic development in Drosophila melanogaster [5]. Insect Toll is a type I transmembrane protein that can be divided into three parts: extracellular, transmembrane, and intracellular regions. The extracellular region is rich in leucine-rich repeats (LRRs), which play a role in ligand recognition. The intracellular region contains a conserved Toll/interleukin-1 receptor (TIR) domain, which interacts with downstream molecules such as myeloid differentiation factor 88 (MyD88) [6,7]. MyD88 contains a death domain that forms a complex with Tube and Pelle when Späetzle binds to the extracellular domain of the Toll receptor. This leads to the phosphorylation of Cactus, which interacts with Rel proteins, Dorsal and Dif. Upon phosphorylation, Cactus dissociates from Dorsal and Dif, allowing Rel proteins to translocate from the cytoplasm into the nucleus. As a result, Rel proteins activate AMP genes [8].
A subsequent study found that the number of Toll receptors in insects varies depending on species, receptor subtype, developmental stage, and environmental conditions [3]. For example, there are 9 Toll receptors in D. melanogaster [9,10], 5 Toll receptors in Apis mellifera [11], and 11 Toll receptors in Anopheles gambiae [12]. B. mori, a model organism of Lepidoptera, was found to have 14 Toll-related receptors [8]. The expression profiles of Toll genes in B. mori show that BmToll3-3, BmToll7-2, and BmToll7-3 are enriched in the ovary and midgut. BmToll9-1 has abundant expression in the midgut, while BmToll9-2 has enriched expression in Malpighian tubules and brain [13].
The current research indicates that Toll receptor genes in silkworms are induced by Escherichia coli, Staphylococcus aureus, and Beauveria bassiana [14,15]. The expressions of Toll receptor genes in silkworms were altered upon invasion by exogenous pathogens [14]. BmToll3-2, BmToll3-3, BmToll10-2, and BmToll10-3 were significantly upregulated by fungi and E. coli induction [1]. We previously found that the expression of BmToll9-1 in the midgut was significantly suppressed after the injection of double-stranded RNA (dsRNA) and lipopolysaccharide (LPS) into silkworm larvae [13]. The expression level of BmToll9-1 in the midgut significantly increased when silkworm was infected with E. coli and B. bassiana [14]. We also found that in the silkworm-derived Bm5 cells overexpressing BmToll9-1, RNA interference (RNAi) machinery gene Dicer-2 was upregulated; immune genes in the IMD and Janus kinase/signal transducers and activators of transcription (Jak/Stat) pathway, as well as AMPs genes, were repressed by LPS [16]. In our recent study, oral infection of E. coli and its main cell wall component LPS, as well as S. aureus and its main cell wall component peptidoglycan (PGN), significantly induced the expression of BmToll9-2 [17]. The above results suggest that different Toll receptor genes play different roles in the immune response. Notably, phylogenetic tree analysis revealed that BmToll9-1 and BmToll9-2 are closely related to mammalian Toll-like receptor 3 (TLR3) and TLR4 [18], suggesting that these two receptors are associated with the immune response.
Here, we focused on elucidating the role of the BmToll9-1 receptor in regulating the development and signaling genes in the Toll pathway and downstream AMPs and other effector genes via dsRNA-mediated gene silencing.

2. Materials and Methods

2.1. Insect Rearing and Tissue Dissection

The “P50” strain of silkworms used in this study was provided by Guangdong Academy of Agricultural Sciences, Guangzhou, China. After hatching, the larvae were reared on fresh mulberry leaves at 25 ± 1 °C, 75 ± 5% relative humidity, and a photoperiod of 12 L:12 D. The silkworm larvae at the 5th instar were selected for dissection and sampling, including epidermis, fat body, midgut, silk glands, Malpighian tubules, and hemocytes. All samples were immediately transferred to RNase-free tubes and stored at −80 °C.

2.2. RNA Extraction, cDNA Synthesis, and qPCR

Total RNA was extracted from frozen tissue samples using an RNAiso Plus kit (TakaRa, Kusatsu, Japan) according to the instructions. Genomic DNA was removed via DNase digestion, and first-strand complementary DNA (cDNA) was synthesized using a PrimeScript RT Reagent Kit (Perfect Real Time) (TaKaRa).
GoTaq qPCR Master Mix (Promega, Madison, WI, USA) was used for qPCR amplification, using the midgut cDNA of the 5th-instar larvae as a template. The thermal reaction was performed in a CFX Connect Real-Time System (Bio-Rad, Hercules, CA, USA) as follows: 95 °C for 2 min, 40 cycles of 95 °C for 15 s, and 57 °C for 30 s. A dissociation step from 65 °C to 95 °C was added after the thermal cycles. Primers for detecting BmToll9-1, signaling genes, and effector genes are listed in Table 1. Translation initiation factor 4A (BmTIF4A) and translation initiation factor 3 subunit 4 (BmTIF3s4) were used as the reference genes [19]. The normalization of expression levels was performed after geometric averaging of the reference genes. The relative expression levels of target genes were determined with the 2(−ΔΔCT) method [20]. All qPCR reactions were performed using three biological replications. For each biological replication, three technical replications were carried out.

2.3. RNAi Protocol

RNAi was performed as described in our previous report [21]. To produce the template DNA, the T7 RNA polymerase promoter sequence (Table 1) was added to the primers before PCR amplification. The purified PCR fragment was used for dsRNA synthesis with T7 RiboMAX Express RNAi (Promega, Madison, WI, USA). dsRNA for green fluorescent protein (dsGFP) was used as a negative control. dsRNA was diluted to 500 ng/μL, and 10 μL of diluted dsRNA was injected on Day 1 into the 5th-instar larvae. Dissected samples were collected at 6, 12, and 24 h after injection.

2.4. Antibacterial Activity Assays

To investigate whether RNAi of BmToll9-1 affected antibacterial activity, the larval hemolymph was isolated at 24 h after RNAi treatment. The hemolymph was boiled at 100 °C for 5 min, then centrifuged at 4 °C at 10,000 rpm for 10 min, and the supernatant was collected and stored at −20 °C [22].
For the bacterial growth curve experiment, E. coli and S. aureus were cultured in Luria–Bertani (LB) medium at 37 °C under shaking at 200 rpm until OD600 = 0.3. Then, 80 μL of bacterial culture was mixed with 20 μL of heat-treated hemolymph to a final volume of 100 μL in a 96-well plate. The plate was incubated at 37 °C, and the OD600 was measured every hour with an Infinite M Plex microplate reader (Tecan, Männedorf, Switzerland).
For the inhibition zone experiment, the filter paper diffusion method (Kirby–Bauer method) was used to measure the inhibition zone [22]. LB agar medium was melted by heating and then cooled to approximately 50 °C. E. coli and S. aureus (OD600 = 0.3) were added to the medium at a ratio of 1:100 and 1.5:100, respectively, mixed well, and poured into petri dishes. Filter paper discs were placed on the medium, and 20 μL of heat-treated hemolymph was added dropwise. Next, 20 μL of sterile water or Amp (20 ng/μL) was added separately as a negative or positive control. The petri dishes were incubated overnight in a constant-temperature incubator at 37 °C. The diameter of the inhibition zone was observed the next day.

2.5. Data Analysis

Statistical analysis was performed using two-way ANOVA combined with Student’s t-test using SPSS version 26.0. Data were plotted in GraphPad Prism v10.0 and are expressed as mean ± standard deviation of the replicates of three biological replications. Knockdown or inhibition rate were compared using mean values to the control groups and converted to percentage.

3. Results

3.1. The BmToll9-1 Gene Was Effectively Silenced in the Midgut

The expression profile indicated that the BmToll9-1 gene was predominantly expressed in the midgut of the fifth-instar silkworm larvae (Figure 1). On the contrary, the relative expression of the BmToll9-1 gene in the epidermis, fat body, and Malpighian tubules was low. In the silk glands and hemocytes, the expression was extremely low. Therefore, the midgut was analyzed as the tissue in the subsequent RNAi experiment.
To detect the optimal time for RNAi, the relative expression levels in the midgut were examined at 6, 12, and 24 h after dsRNA injection. It was observed that the significantly highest silencing effect was achieved at 24 h after injection of dsBmToll9-1, where the relative expression of the BmToll9-1 gene was 64% lower than in the control (injection of dsGFP) (Figure 2).

3.2. RNAi of BmToll9-1 Gene Affected the Growth of the Silkworm Larvae and Cocoons

After the BmToll9-1 gene was silenced, the larval weight was lighter than in the control (injection with dsGFP). Significant differences in weight were found on Day 1 after injection of dsBmToll9-1, and the biggest differences occurred on Day 3 (Figure 3a). By observing the phenotype, it was found that the BmToll9-1-silenced larvae appeared shorter and smaller (Figure 3b). Similarly, the BmToll9-1-silenced cocoons were smaller in size and thinner in the silk (Figure 3c).

3.3. RNAi of the BmToll9-1 Gene Reduced the Expression of Signaling GENES in the Toll Pathway

Considering that the midgut is a barrier tissue and silencing of BmToll9-1 was achieved in the midgut, midgut samples were collected to detect the expression of the signaling genes in the Toll pathway (Figure 4). Compared with the control group (injection with dsGFP), the signaling genes in the Toll pathway, except BmTube and BmTRAF2, were significantly downregulated in the RNAi group (injection with dsBmToll9-1). BmMyD88, BmPelle, BmCactus, and BmRel were inhibited by 20%, 40%, 21%, and 23%, respectively. BmTollip-v, BmPellino, and BmECSIT were suppressed by 53%, 50%, and 50%, respectively.

3.4. RNAi of the BmToll9-1 Gene Reduced the Expressions of the Downstream Effector Genes

Similarly, midgut samples were used to detect the expressions of 20 effector genes (Figure 5). Compared with those of the control group, most AMP genes were downregulated in the RNAi group. The Attacin gene BmAtt1 was significantly downregulated by 58%. The three Cecropin genes were downregulated, but only BmCecA was significantly downregulated by 85%. The four Gloverin gene expressions were significantly decreased when BmToll9-1 was silenced, with BmGlv1 showing the highest reduction of 76%. Both Moricin and Moricin-like genes BmMor and BmMorLB showed significant 83% and 60% reductions, respectively. The Enbocin gene BmEnb was significantly reduced by 48%. Both Defensin and Lebocin genes BmDef and BmLeb3 were downregulated but not significantly so.
For the other effector genes, lysozyme BmLys and lysozyme-like protein BmLLP3 genes were significantly reduced by 76% and 72%, respectively. Prophenoloxidase BmPPO2 and phenoloxidase inhibitor BmPOI genes were downregulated, but only BmPOI was significantly downregulated by 95%. Nitric oxide synthase BmNOS2 was significantly reduced by 69%, while BmNOS1 was downregulated without significant differences compared with the control.

3.5. RNAi of BmToll9-1 Decreased Antibacterial Activity

To further investigate whether silencing of BmToll9-1 affects the immune response in silkworm larvae, the hemolymph was collected for antibacterial activity assays against the Gram-negative bacterium E. coli and the Gram-positive bacterium S. aureus. The E. coli bacterial growth curve experiment showed that the hemolymph from the BmToll9-1-silenced larvae grew better than the control group, with significant differences between 4 and 8 h (Figure 6a). In the inhibition zone experiment, both ampicillin and dsGFP-injected hemolymph showed antibacterial activity in the E. coli plate, while sterile water and dsBmToll9-1-injected hemolymph displayed no inhibitory effect (Figure 6b). As for S. aureus, the dsBmToll9-1-injected hemolymph showed no significant differences in either bacterial growth (Figure 6c) or inhibition zone (Figure 6d) compared with the dsGFP-injected hemolymph. The above results showed that the hemolymph of the silkworm larvae lost antibacterial activity when BmToll9-1 was silenced, indicating it might act against Gram-negative bacteria.

4. Discussion

It is well known that the Toll signaling pathway plays an important role in the insect immune response [3]. The Toll receptor, an important component of the signaling pathway, transmits signals detected by its extracellular domain to the intracellular compartment, thereby activating the innate immune response of insects. Previous reports have indicated that Toll receptors are involved in the development and innate immunity of insects [6,7].
Previous studies on BmToll9-1 have focused its role as a receptor in the immune response. For example, BmToll9-1 responded differently to different microbial infections [14]. We found that LPS inhibited the expression of BmToll9-1 in larvae [13]. BmToll9-1 could bind to BmSpz2 [23]. BmToll9-1 was later proven to be a pattern recognition receptor (PRR) for LPS that shares conserved features with the mammalian TLR4-MD-2-LPS pathway [18].
In this study, the role of the BmToll9-1 receptor in regulating development and the Toll signaling pathway of the silkworm was investigated for the first time. Even though it was reported that RNAi efficiency is refractory in silkworms and other lepidopteran insects [24], we successfully characterized the BmToll9-1 receptor gene using a dsRNA-mediated RNAi technique.

4.1. BmToll9-1 May Modulate Gut Homeostasis

BmToll9-1 being predominantly expressed in the midgut and weakly expressed in other tissues in the larvae (Figure 1) or pupae [13] suggests that BmToll9-1 mainly functions in the gut of silkworm. The successful RNAi of BmToll9-1 gene in the midgut (Figure 2) resulted in slower growth of the silkworm larvae and pupae (Figure 3). The midgut is the location where digestion occurs after feeding. Thus, the gut epithelium has to cope with an ever-changing intestinal environment to regulate the complex microbial community to achieve immunity and intracellular homeostasis. Silencing of the BmToll9-1 gene might imbalance the intestinal microbial homeostasis, thus affecting food digestion and intake. Studies on the effect of the gut microbiota on development have been conducted in other insects, such as D. melanogaster [25] and Bombus terrestris [26]. The regulatory mechanisms of microbial homeostasis in the insect gut have been identified in several insects, which are related to the key genes in the immune pathways [27]. Our successful silencing of BmToll9-2 inhibited the growth of silkworm larvae [17]. Similar results were observed in our recent study on another receptor in the immune pathways. The RNAi of BmPGRP-L4 gene also slowed the growth of silkworm larvae [21]. Therefore, it is likely that BmToll9-1 is involved in the development of these larvae by regulating gut homeostasis.

4.2. BmToll9-1 Is Positively Involved in the Toll Pathway

In the Toll pathway, Toll, MyD88, Tube, Pelle, Cactus, and Rel are involved in signal transduction in the cytoplasm [9]. Intercellular components such as Tollip, Pellino, TNF receptor-associated factor-2 (TRAF2), and ECSIT appear to be involved in this process [8]. The successful RNAi of the BmToll9-1 gene resulted in significant reductions in the above signaling genes in the Toll pathway, except Tube and TRAF2 (Figure 4). These results suggest that BmToll9-1 is positively related to the downstream signaling genes in the Toll pathway.
The regulation of the Toll genes in the signaling pathways has been extensively studied in insects, such as D. melanogaster [28] and Aedes aegypti [29]. We found that in the silkworm-derived Bm5 cells overexpressing the BmToll9-1, the signaling genes in the IMD and Jak/Stat pathways were repressed by LPS [16]. In the Chinese oak silkworm Antheraea pernyi, the Toll pathway genes are positively associated. The Toll gene was induced by fungus Nosema pernyi and Gram-positive bacterium Enterococcus pernyi. Additionally, the MyD88, Cactus, and Rel genes were induced by the two above pathogens [30]. The Toll gene was induced when honey bees were infected by pathogens, and the expression of its adapter protein MyD88 was upregulated [11,31]. Infection of Laodelphax striatellus with rice stripe virus directly activated the Toll pathway, and the expressions of Tube, MyD88, and Dorsal genes were upregulated in viruliferous planthoppers [32].

4.3. BmToll9-1 Positively Regulates the Immune Effectors

In this study, when BmToll9-1 gene was silenced, most of the AMPs and other immune effectors were down-regulated (Figure 5). At the same time, hemolymph from BmToll9-1-silenced larvae showed decreased antibacterial activity against E. coli, either in growth curve or inhibition zone experiments (Figure 6). These results suggest that BmToll9-1 is positively related to the production of AMPs.
Because LPS is the main cell wall component of E. coli and BmToll9-1 is the PRR for LPS [18], it is reasonable that the decreased antibacterial activity was effective against E. coli but not S. aureus. The involvement of AMPs regulation was reported in the silkworms extensively. For example, we found that in the silkworm-derived Bm5 cells overexpressing BmToll9-1, AMPs genes were repressed by LPS [16]. BmToll9-1 interacted with BmSpz2 and activated the expression of AMPs [23]. Our recent publication indicates that BmPGRP-L4 negatively regulated the AMPs production [22]. BmPGRP-S5 functioned as a negative regulator of the AMPs pathway [33]. Starvation activated AMP genes expression via the insulin-like signaling pathway [34]. Serpin-4 negatively regulated prophenoloxidase activation and AMPs synthesis [35]. Scavenger receptor C regulated AMP expression by activating Toll signaling [36]. In addition, the overexpression of DmToll1 and DmToll9 in D. melanogaster significantly induced the expression of downstream AMPs [37,38].

5. Conclusions

Our study shows that BmToll9-1 might play a role as a positive regulator in the immune response of the Toll signaling pathway. BmToll9-1 might function mainly in the gut of the silkworm to maintain microbial homeostasis. Silencing of BmToll9-1 might interfere with this balance and affect the growth of the larvae. Additionally, the reduction in BmToll9-1 expression downregulates the signaling genes of the Toll pathway and most of the AMP production, leading to decreased antibacterial activity in the hemolymph.

Author Contributions

Conceptualization, J.L. (Jisheng Liu); methodology, J.L. (Jisheng Liu), W.C., J.S., J.L. (Jiaxuan Li), J.C., M.L. and F.H.; validation, J.L. (Jisheng Liu), W.C., J.S., J.L. (Jiaxuan Li), J.C., M.L., F.H. and B.L.; investigation, J.L. (Jisheng Liu), W.C., J.S., J.L. (Jiaxuan Li), J.C., M.L., F.H. and B.L.; data curation, J.L. (Jisheng Liu), W.C., J.S., J.L. (Jiaxuan Li), J.C., M.L., F.H. and B.L.; writing—original draft preparation, J.L. (Jisheng Liu) and W.C.; writing—review and editing, J.L. (Jisheng Liu) and W.C.; visualization, J.L. (Jisheng Liu); supervision, J.L. (Jisheng Liu); project administration, J.L. (Jisheng Liu); funding acquisition, J.L. (Jisheng Liu). All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (31501898), Science and Technology Program of Guangzhou (202102010465), Featured Innovation Project of Universities in Guangdong Province (2019KTSCX133), Natural Science Foundation of Guangdong Province (2017A030313152), and Pearl River S&T Nova Program of Guangzhou (201710010094).

Data Availability Statement

The raw data supporting the conclusions of this article will be made available from the corresponding author upon reasonable request.

Acknowledgments

We thank Qingrong Li for providing the silkworm culture.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Cheng, T.; Zhang, Y.; Liu, C.; Xu, P.; Gao, Z.; Xia, Q.; Xiang, Z. Identification and Analysis of Toll-Related Genes in the Domesticated Silkworm, Bombyx mori. Dev. Comp. Immunol. 2008, 32, 464–475. [Google Scholar] [CrossRef] [PubMed]
  2. Merkling, S.H.; van Rij, R.P. Beyond RNAi: Antiviral Defense Strategies in Drosophila and Mosquito. J. Insect Physiol. 2013, 59, 159–170. [Google Scholar] [CrossRef] [PubMed]
  3. Chintapalli, R.T.V.; Hillyer, J.F. Hemolymph Circulation in Insect Flight Appendages: Physiology of the Wing Heart and Circulatory Flow in the Wings of the Mosquito, Anopheles gambiae. J. Exp. Biol. 2016, 219, 3945–3951. [Google Scholar] [CrossRef]
  4. Kim, M.S.; Byun, M.; Oh, B.H. Crystal Structure of Peptidoglycan Recognition Protein LB from Drosophila melanogaster. Nat. Immunol. 2003, 4, 787–793. [Google Scholar] [CrossRef] [PubMed]
  5. Hashimoto, C.; Hudson, K.L.; Anderson, K.V. The Toll Gene of Drosophila, Required for Dorsal-Ventral Embryonic Polarity, Appears to Encode a Transmembrane Protein. Cell 1988, 52, 269–279. [Google Scholar] [CrossRef]
  6. Nüsslein-Volhard, C.; Lohs-Schardin, M.; Sander, K.; Cremer, C. A Dorso-Ventral Shift of Embryonic Primordia in a New Maternal-Effect Mutant of Drosophila. Nature 1980, 283, 474–476. [Google Scholar] [CrossRef]
  7. Gay, N.J.; Keith, F.J. Drosophila Toll and IL-1 Receptor. Nature 1991, 351, 355–356. [Google Scholar] [CrossRef]
  8. Tanaka, H.; Ishibashi, J.; Fujita, K.; Nakajima, Y.; Sagisaka, A.; Tomimoto, K.; Suzuki, N.; Yoshiyama, M.; Kaneko, Y.; Iwasaki, T. A Genome-Wide Analysis of Genes and Gene Families Involved in Innate Immunity of Bombyx mori. Insect Biochem. Mol. Biol. 2008, 38, 1087–1110. [Google Scholar] [CrossRef]
  9. Valanne, S.; Wang, J.; Rämet, M. The Drosophila Toll Signaling Pathway. J. Immunol. 2011, 186, 649–656. [Google Scholar] [CrossRef]
  10. Nonaka, S.; Kawamura, K.; Hori, A.; Salim, E.; Fukushima, K.; Nakanishi, Y.; Kuraishi, T. Characterization of Spz5 as a Novel Ligand for Drosophila Toll-1 Receptor. Biochem. Biophys. Res. Commun. 2018, 506, 510–515. [Google Scholar] [CrossRef]
  11. Aronstein, K.; Saldivar, E. Characterization of a Honey Bee Toll Related Receptor Gene Am18w and Its Potential Involvement in Antimicrobial Immune Defense. Apidologie 2005, 36, 3–14. [Google Scholar] [CrossRef]
  12. Christophides, G.K.; Zdobnov, E.; Barillas-Mury, C.; Birney, E.; Blandin, S.; Blass, C.; Brey, P.T.; Collins, F.H.; Danielli, A.; Dimopoulos, G.; et al. Immunity-Related Genes and Gene Families in Anopheles gambiae. Science 2002, 298, 159–165. [Google Scholar] [CrossRef]
  13. Liu, J.; Smagghe, G.; Swevers, L. Transcriptional Response of BmToll9-1 and RNAi Machinery Genes to Exogenous dsRNA in the Midgut of Bombyx mori. J. Insect Physiol. 2013, 59, 646–654. [Google Scholar] [CrossRef] [PubMed]
  14. Wu, S.; Zhang, X.; Chen, X.; Cao, P.; Beerntsen, B.T.; Ling, E. BmToll9, an Arthropod Conservative Toll, Is Likely Involved in the Local Gut Immune Response in the Silkworm, Bombyx mori. Dev. Comp. Immunol. 2010, 34, 93–96. [Google Scholar] [CrossRef]
  15. Wu, S.; Zhang, X.; He, Y.; Shuai, J.; Chen, X.; Ling, E. Expression of Antimicrobial Peptide Genes in Bombyx mori Gut Modulated by Oral Bacterial Infection and Development. Dev. Comp. Immunol. 2010, 34, 1191–1198. [Google Scholar] [CrossRef] [PubMed]
  16. Liu, J.; Kolliopoulou, A.; Smagghe, G.; Swevers, L. Modulation of the Transcriptional Response of Innate Immune and RNAi Genes upon Exposure to dsRNA and LPS in Silkmoth-Derived Bm5 Cells Overexpressing BmToll9-1 Receptor. J. Insect Physiol. 2014, 66, 10–19. [Google Scholar] [CrossRef]
  17. Liu, J.; Yang, W.; Liao, W.; Huang, Y.; Chen, W.; Bu, X.; Huang, S.; Jiang, W.; Swevers, L. Immunological Function of Bombyx Toll9-2 in the Silkworm (Bombyx mori) Larval Midgut: Activation by Escherichia coli/Lipopolysaccharide and Regulation of Growth. Arch. Insect Biochem. Physiol. 2024, 116, e22130. [Google Scholar] [CrossRef] [PubMed]
  18. Zhang, R.; Li, X.; Zhang, J.; Li, Y.; Wang, Y.; Song, Y.; Ren, F.; Yi, H.; Deng, X.; Zhong, Y.; et al. Toll9 from Bombyx mori Functions as a Pattern Recognition Receptor That Shares Features with Toll-like Receptor 4 from Mammals. Proc. Natl. Acad. Sci. USA 2021, 118, e2103021118. [Google Scholar] [CrossRef]
  19. Wang, G.; Xia, Q.; Cheng, D.; Duan, J.; Zhao, P.; Chen, J.; Zhu, L. Reference Genes Identified in the Silkworm Bombyx mori during Metamorphism Based on Oligonucleotide Microarray and Confirmed by qRT-PCR. Insect Sci. 2008, 15, 405–413. [Google Scholar] [CrossRef]
  20. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  21. Liang, Y.; Wang, T.; Yang, W.; Chen, Z.; Li, Q.; Swevers, L.; Liu, J. Silencing of the Immune Gene BmPGRP-L4 in the Midgut Affects the Growth of Silkworm (Bombyx mori) Larvae. Insect Mol. Biol. 2023, 32, 340–351. [Google Scholar] [CrossRef] [PubMed]
  22. Yang, W.; Lin, Y.; He, Y.; Li, Q.; Chen, W.; Lin, Q.; Swevers, L.; Liu, J. BmPGPR-L4 Is a Negative Regulator of the Humoral Immune Response in the Silkworm Bombyx mori. Arch. Insect Biochem. Physiol. 2024, 115, e22093. [Google Scholar] [CrossRef]
  23. Yu, B.; Sang, Q.; Pan, G.; Li, C.; Zhou, Z. A Toll-Spätzle Pathway in the Immune Response of Bombyx mori. Insects 2020, 11, 586. [Google Scholar] [CrossRef]
  24. Terenius, O.; Papanicolaou, A.; Garbutt, J.S.; Eleftherianos, I.; Huvenne, H.; Kanginakudru, S.; Albrechtsen, M.; An, C.; Aymeric, J.-L.; Barthel, A.; et al. RNA Interference in Lepidoptera: An Overview of Successful and Unsuccessful Studies and Implications for Experimental Design. J. Insect Physiol. 2011, 57, 231–245. [Google Scholar] [CrossRef] [PubMed]
  25. Qiao, H.; Keesey, I.W.; Hansson, B.S.; Knaden, M. Gut Microbiota Affects Development and Olfactory Behavior in Drosophila melanogaster. J. Exp. Biol. 2019, 222, jeb.192500. [Google Scholar] [CrossRef] [PubMed]
  26. Guo, B.; Tang, J.; Ding, G.; Mashilingi, S.K.; Huang, J.; An, J. Gut Microbiota Is a Potential Factor in Shaping Phenotypic Variation in Larvae and Adults of Female Bumble Bees. Front. Microbiol. 2023, 14, 1117077. [Google Scholar] [CrossRef] [PubMed]
  27. Bai, S.; Yao, Z.; Raza, M.F.; Cai, Z.; Zhang, H. Regulatory Mechanisms of Microbial Homeostasis in Insect Gut. Insect Sci. 2021, 28, 286–301. [Google Scholar] [CrossRef] [PubMed]
  28. Belvin, M.P.; Anderson, K.V. A Conserved Signaling Pathway: The Drosophila Toll-Dorsal Pathway. Annu. Rev. Cell Dev. Biol. 1996, 12, 393–416. [Google Scholar] [CrossRef]
  29. Shin, S.W.; Bian, G.; Raikhel, A.S. A Toll Receptor and a Cytokine, Toll5A and Spz1C, Are Involved in Toll Antifungal Immune Signaling in the Mosquito Aedes aegypti. J. Biol. Chem. 2006, 281, 39388–39395. [Google Scholar] [CrossRef]
  30. Sun, Y.; Jiang, Y.; Wang, Y.; Li, X.; Yang, R.S.; Yu, Z.; Qin, L. The Toll Signaling Pathway in the Chinese Oak Silkworm, Antheraea pernyi: Innate Immune Responses to Different Microorganisms. PLoS ONE 2016, 11, e0160200. [Google Scholar] [CrossRef]
  31. Aronstein, K.; Murray, K.D.; Saldivar, E. Transcriptional Responses in Honey Bee Larvae Infected with Chalkbrood Fungus. BMC Genom. 2010, 11, 391. [Google Scholar] [CrossRef]
  32. He, Y.J.; Lu, G.; Qi, Y.; Zhang, Y.; Zhang, X.; Huang, H.; Zhuo, J.; Sun, Z.; Yan, F.; Chen, J.; et al. Activation of Toll Immune Pathway in an Insect Vector Induced by a Plant Virus. Front. Immunol. 2021, 11, 613957. [Google Scholar] [CrossRef] [PubMed]
  33. Chen, K.; Zhou, L.; Chen, F.; Peng, Y.; Lu, Z. Peptidoglycan Recognition Protein-S5 Functions as a Negative Regulator of the Antimicrobial Peptide Pathway in the Silkworm, Bombyx mori. Dev. Comp. Immunol. 2016, 61, 126–135. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, J.; Yang, W.; Xu, J.; Yang, W.; Li, Q.; Zhong, Y.; Cao, Y.; Yu, X.; Deng, X. Regulation of Antimicrobial Peptide Genes via Insulin-like Signaling Pathway in the Silkworm Bombyx mori. Insect Biochem. Mol. Biol. 2018, 103, 12–21. [Google Scholar] [CrossRef] [PubMed]
  35. Qie, X.; Yan, X.; Wang, W.; Liu, Y.; Zhang, L.; Hao, C.; Lu, Z.; Ma, L. Serpin-4 Negatively Regulates Prophenoloxidase Activation and Antimicrobial Peptide Synthesis in the Silkworm, Bombyx mori. Int. J. Mol. Sci. 2023, 25, 313. [Google Scholar] [CrossRef]
  36. Zhang, K.; Shen, L.; Wang, X.; Yang, H.; Zhang, X.; Pan, G.; Li, C.; Ji, H.; Abbas, M.N.; Li, C.; et al. Scavenger Receptor C Regulates Antimicrobial Peptide Expression by Activating Toll Signaling in Silkworm, Bombyx mori. Int. J. Biol. Macromol. 2021, 191, 396–404. [Google Scholar] [CrossRef]
  37. Ooi, J.Y.; Yagi, Y.; Hu, X.; Ip, Y.T. The Drosophila Toll-9 Activates a Constitutive Antimicrobial Defense. EMBO Rep. 2002, 3, 82–87. [Google Scholar] [CrossRef]
  38. Bettencourt, R.; Tanji, T.; Yagi, Y.; Ip, Y.T. Toll and Toll-9 in Drosophila Innate Immune Response. J. Endotoxin Res. 2004, 10, 261–268. [Google Scholar] [CrossRef]
Insects 15 00643 g001
Figure 1. The relative expression of BmToll9-1 in different tissues of 5th-instar silkworm larvae. The epidermis, fat body, midgut, silk glands, Malpighian tubules, and hemocytes were collected at 24, 48, and 72 h. The relative expression was calculated in all the tissues. Data are represented as means ± standard deviation of three biological replications. For each biological replication, there were three technical replications.
Figure 1. The relative expression of BmToll9-1 in different tissues of 5th-instar silkworm larvae. The epidermis, fat body, midgut, silk glands, Malpighian tubules, and hemocytes were collected at 24, 48, and 72 h. The relative expression was calculated in all the tissues. Data are represented as means ± standard deviation of three biological replications. For each biological replication, there were three technical replications.
Insects 15 00643 g001
Insects 15 00643 g002
Figure 2. RNAi of BmToll9-1 gene via dsRNA injection. dsBmToll9-1 was injected to the 5th-instar larvae, and dsGFP served as the control. The relative expression of BmToll9-1 was detected at 6, 12, and 24 h after dsRNA injection. The relative expression was calculated compared with that of the control. Data are represented as means ± standard deviation of three biological replications. For each biological replication, there were three technical replications. Asterisks indicate significant differences in dsGFP injection groups: * p < 0.05, *** p < 0.001.
Figure 2. RNAi of BmToll9-1 gene via dsRNA injection. dsBmToll9-1 was injected to the 5th-instar larvae, and dsGFP served as the control. The relative expression of BmToll9-1 was detected at 6, 12, and 24 h after dsRNA injection. The relative expression was calculated compared with that of the control. Data are represented as means ± standard deviation of three biological replications. For each biological replication, there were three technical replications. Asterisks indicate significant differences in dsGFP injection groups: * p < 0.05, *** p < 0.001.
Insects 15 00643 g002
Insects 15 00643 g003
Figure 3. Phenotype observation and weight determination after RNAi of BmToll9-1. (a) The average weight of silkworm larvae on different days after dsRNA injection. (b) The appearance of silkworm larvae at D2 after injection of dsRNA. (c) The appearance of silkworm cocoons at D11 after injection of dsRNA. Asterisks indicate significant differences compared with dsGFP injection groups: *** p < 0.001.
Figure 3. Phenotype observation and weight determination after RNAi of BmToll9-1. (a) The average weight of silkworm larvae on different days after dsRNA injection. (b) The appearance of silkworm larvae at D2 after injection of dsRNA. (c) The appearance of silkworm cocoons at D11 after injection of dsRNA. Asterisks indicate significant differences compared with dsGFP injection groups: *** p < 0.001.
Insects 15 00643 g003
Insects 15 00643 g004
Figure 4. The relative expression of the signaling genes in the Toll pathway after RNAi of BmToll9-1. Larvae of the 5th instar were injected with dsBmToll9-1, and dsGFP served as the control. The relative expression was calculated compared with the control. Data are represented as means ± standard deviation of three biological replications. For each biological replication, there were three technical replications. Asterisks indicate significant differences compared with dsGFP injection groups: * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 4. The relative expression of the signaling genes in the Toll pathway after RNAi of BmToll9-1. Larvae of the 5th instar were injected with dsBmToll9-1, and dsGFP served as the control. The relative expression was calculated compared with the control. Data are represented as means ± standard deviation of three biological replications. For each biological replication, there were three technical replications. Asterisks indicate significant differences compared with dsGFP injection groups: * p < 0.05, ** p < 0.01, *** p < 0.001.
Insects 15 00643 g004
Insects 15 00643 g005
Figure 5. The relative expression of the effector genes after RNAi of BmToll9-1. Larvae of the 5th instar were injected with dsBmToll9-1, and dsGFP served as the control. The relative expression was calculated compared with that of the control. Data are presented as means ± standard deviation of three biological replications. For each biological replication, there were three technical replications. Asterisks indicate significant differences compared with dsGFP injection groups: * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 5. The relative expression of the effector genes after RNAi of BmToll9-1. Larvae of the 5th instar were injected with dsBmToll9-1, and dsGFP served as the control. The relative expression was calculated compared with that of the control. Data are presented as means ± standard deviation of three biological replications. For each biological replication, there were three technical replications. Asterisks indicate significant differences compared with dsGFP injection groups: * p < 0.05, ** p < 0.01, *** p < 0.001.
Insects 15 00643 g005
Insects 15 00643 g006
Figure 6. Antibacterial activity assays of B. mori hemolymph against E. coli and S. aureus after RNAi of BmToll9-1. Hemolymph was collected at 24 h after dsRNA injection. (a,c) Bacterial growth curve experiment. (b,d) Inhibition zone experiment. dsBmToll9-1: hemolymph from larvae injected with dsBmToll9-1; dsGFP: hemolymph from larvae injected with dsGFP; H2O: sterile water; antibiotic: ampicillin. Asterisks indicate significant differences compared with dsGFP injection groups: * p < 0.05, ** p < 0.01.
Figure 6. Antibacterial activity assays of B. mori hemolymph against E. coli and S. aureus after RNAi of BmToll9-1. Hemolymph was collected at 24 h after dsRNA injection. (a,c) Bacterial growth curve experiment. (b,d) Inhibition zone experiment. dsBmToll9-1: hemolymph from larvae injected with dsBmToll9-1; dsGFP: hemolymph from larvae injected with dsGFP; H2O: sterile water; antibiotic: ampicillin. Asterisks indicate significant differences compared with dsGFP injection groups: * p < 0.05, ** p < 0.01.
Insects 15 00643 g006
Table 1. Primers used in this study.
Table 1. Primers used in this study.
GeneAccession NumberPrimer Sequence (5′-3′)
Primer for qPCR
BmToll9-1PP496203F: CGCAGACCGTTGAGTACATG
R: CCAGACTGTCGTACCTTGGT
BmTIF4ADQ443290F: TTCGTACTGGCTCTTCTCGT
R: CAAAGTTGATAGCAATTCCCT
BmTIF3s4DQ443238F: ACTTCAAGTTCAGGGCAGAT
R: TTAATTGTTTTGTGGAGGCT
Signaling
BmMyD88XM_028186400F: AACGGTCACGACTCGAACTC
R: TCTGCCCAGATTCTTCATCC
BmTubeXM_028173146F: GGCAGAAAGTTATGGCTTGG
R: ATCCTCAAATGCTCGCTGTT
BmPelleXM_028182154F: ACATCAAGCCGGCTAACATC
R: ACCGTGAGACCTTCAGATGC
BmCactusXM_028180230F: ACAGTCGTGCGTACATTTGG
R: CAGCCTCTCCCTATCGTCAA
BmRelXM_028175224F: TCGAATACATCCCGGACTTC
R: TGGAAGGTCCTTTCTTGCTC
BmTollip-vXM_028186930F: TGCTACTTCTGACGGTGTGG
R: AGGGCCACTTTGTGGTACTG
BmPellinoXM_028184930F: AGAGTCGCTCAGCACAACAA
R: CAATGTGGCTCCACACAGAT
BmTRAF2XM_028172769F: TCGCTCCTATGGGCATAACT
R: CCGCATGTTGTGATTACTGG
BmECSITXM_028171307F: ATGCCGCCTTAGCTAGAATG
R: GCCTTTGGGCAGTACGTCTA
Effector
BmAttacin1
(BmAtt1)		NM_001043541F: CAGTGAACTCGGATGGAACC
R: GGCGCTGAGTACGTTCTTGT
BmCecropinA
(BmCecA)		NM_001043997F: CCGTCATAGGGCAAGCGAAA
R: AGCAATGACTGTGGTATGTCAA
BmCecropinD
(BmCecD)		NM_001043368F: CTCCCGGCAACTTCTTCAA
R: TTTGCCAGGGTGTCGACT
BmCecropinE
(BmCecE)		XM_028187757F: CGGAACCGAGATGGAAGATT
R: TGGTCCAGCCTTGATTATCC
BmDefensin
(BmDef)		AB_367525
F: GTTAAGTGCGGCGTTGACTG
R: TGACAGGGAAAGTGGAAGGG
BmGloverin1
(BmGlv1)		AB_289654F: GCTGGGATAGAAGCATCAGC
R: ACATCAGGCCTTCTGTGACC
BmGloverin2
(BmGlv2)		NM_001044218F: GGCTTACGGTACCAGGGTTT
R: TGGCTTGTGCATTCTTGTTC
BmGloverin3
(BmGlv3)		NM_001099842F: GGCCAACAAGAACGCACAAG
R: ATCAAGATCCCACACACCGG
BmGloverin4
(BmGlv4)		AB_289657F: GCAGATCTGGAATGACAGCA
R: GTGACCGAATTCCTTCGAGA
BmMoricin
(BmMor)		AB_006915F: TGTGGCAATGTCTCTGGTGT
R: CTGGCGATATTGATGGCTCT
BmMoricin-like
(BmMorLB)		HQ204039F: TCACTACATCTTCATACGCGAC
R: TAGTTTATGTATTGGTTGTAGT
BmLebocin3
(BmLeb3)		NM_001126260F: CTCGATCCAAACCGAAGGTA
R: CGGCTGGTCAAGTCCAGTAT
BmEnbocin
(BmEnb)		FJ373019F: ACCTCGCACAACTAGTTCGG
R: CCAACAGAACAAACCCACTCG
BmLysozyme
(BmLys)		NM_001043983F: TAACGGCTCGAAGGACTACG
R: GAGGTCGGAGCACTTAACGT
Lysozyme-like protein
(BmLLP3)		XM_012696687F: GTTTAATCGAGCAGGGCAGC
R: CACCCTTGCGACCTTCTTTG
BmPhenoloxidase inhibitor
(BmPOI)		XR_001139981F: GGATACGTGACTGGAAATGCA
R: GTCATAATCCACGGGTTTGTCC
Prophenoloxidase 1
(BmPPO1)		AF_178462F: AGTGGGAAGCCATTCTCCTT
R: GCCAGGTTTCACTCCTTGAG
Prophenoloxidase 2
(BmPPO2)		XM_028180711F: CCATTCTTCTACCGCTGGCA
R: CGGGTTCTCGAGCTCAGATC
Nitric oxide synthase1
(BmNOS1)		XM_012689821F: TCATCACCACTAGCGCATCC
R: CCTTGTCCGTTCTGTGTCCT
Nitric oxide synthase2
(BmNOS2)		XM_012690766F: ACAACAGACGCCACATCCAT
R: AAATTCGGGTAAGCGCTCGA
Primer for dsRNA synthesis
T7-BmToll9-1 F: TAATACGACTCACTATAGG
ACTATAGGCACAGGTCGGGT
R: TAATACGACTCACTATAGG
TCGTTGTCCCATTCGCTGAT
T7-GFP F: TAATACGACTCACTATAGG
TACGGCGTGCAGTGCT
R: TAATACGACTCACTATAGG
TGATCGCGCTTCTCG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, J.; Chen, W.; Situ, J.; Li, J.; Chen, J.; Lai, M.; Huang, F.; Li, B. BmToll9-1 Is a Positive Regulator of the Immune Response in the Silkworm Bombyx mori. Insects 2024, 15, 643. https://doi.org/10.3390/insects15090643

AMA Style

Liu J, Chen W, Situ J, Li J, Chen J, Lai M, Huang F, Li B. BmToll9-1 Is a Positive Regulator of the Immune Response in the Silkworm Bombyx mori. Insects. 2024; 15(9):643. https://doi.org/10.3390/insects15090643

Chicago/Turabian Style

Liu, Jisheng, Weijian Chen, Jinrong Situ, Jiaxuan Li, Jiahua Chen, Minchun Lai, Fengyi Huang, and Baoqi Li. 2024. "BmToll9-1 Is a Positive Regulator of the Immune Response in the Silkworm Bombyx mori" Insects 15, no. 9: 643. https://doi.org/10.3390/insects15090643

APA Style

Liu, J., Chen, W., Situ, J., Li, J., Chen, J., Lai, M., Huang, F., & Li, B. (2024). BmToll9-1 Is a Positive Regulator of the Immune Response in the Silkworm Bombyx mori. Insects, 15(9), 643. https://doi.org/10.3390/insects15090643

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop