First Identification and Genotyping of Enterocytozoon bieneusi and Prevalence of Encephalitozoon intestinalis in Patients with Acute Diarrhea in the Republic of Korea
Abstract
:1. Introduction
2. Results
2.1. Prevalence of Enc. intestinalis and Ent. bieneusi
2.2. Sequence Analysis of Enc. intestinalis and Ent. bieneusi Using Small Subunit Ribosomal RNA
2.3. Genotype of Ent. bieneusi
3. Discussion
4. Materials and Methods
4.1. Fecal Sample Collection and DNA Extraction
4.2. PCR Amplification
4.3. Nucleotide Sequencing and Phylogenetic Analysis
4.4. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ghoyounchi, R.; Ahmadpour, E.; Spotin, A.; Mahami-Oskouei, M.; Rezamand, A.; Aminisani, N.; Ghojazadeh, M.; Mikaeili-Galeh, T. Microsporidiosis in Iran: A systematic review and meta-analysis. Asian Pac. J. Trop. Med. 2017, 10, 341–350. [Google Scholar] [CrossRef]
- Anane, S.; Attouchi, H. Microsporidiosis: Epidemiology, clinical data and therapy. Gastroenterol. Clin. Biol. 2010, 34, 450–464. [Google Scholar] [CrossRef]
- Didier, E.S.; Weiss, L.M. Microsporidiosis: Current status. Curr. Opin. Infect. Dis. 2006, 19, 485–492. [Google Scholar] [CrossRef] [Green Version]
- Goertz, D.; Solter, L.; Linde, A. Horizontal and vertical transmission of a Nosema sp. (Microsporidia) from Lymantria dispar (L.) (Lepidoptera: Lymantriidae). J. Invert. Path. 2007, 95, 9–16. [Google Scholar] [CrossRef]
- Becnel, J.; Andreadis, T. Microsporidia in insects. In Microsporidia: Pathogens of Opportunity; Wiley-Blackwell: Hoboken, NJ, USA, 2014; pp. 521–570. [Google Scholar]
- Didier, E.S.; Stovall, M.E.; Green, L.C.; Brindley, P.J.; Sestak, K.; Didier, P.J. Epidemiology of microsporidiosis: Sources and modes of transmission. Vet. Parasitol. 2004, 126, 145–166. [Google Scholar] [CrossRef] [PubMed]
- Mclnnes, E.F.; Stewart, C.G. The pathology of subclinical infection of Encephalitozoon cuniculi in canine dams producing pups with overt encephalitozoonosis. J. S. Afr. Vet. Assoc. 1991, 62, 51–54. [Google Scholar] [CrossRef]
- Han, B.; Takvorian, P.M.; Weiss, L.M. Invasion of host cells by microsporidia. Front. Microbiol. 2020, 11, 172–187. [Google Scholar] [CrossRef] [Green Version]
- Coyle, C.M.; Wittner, M.; Kotler, D.P.; Noyer, C.; Orenstein, J.M.; Tanowitz, H.B.; Weiss, L.M. Prevalence of microsporidiosis due to Enterocytozoon bieneusi and Encephalitozoon (Septata) intestinalis among patients with AIDS-related diarrhea: Determination by polymerase chain reaction to the microsporidian small-subunit rRNA Gene. Clin. Infect. Dis. 1996, 23, 1002–1006. [Google Scholar] [CrossRef]
- Deplazes, P.; Mathis, A.; Weber, R. Epidemiology and zoonotic aspects of microsporidia of mammals and birds. Contrib. Microbiol. 2000, 6, 236–260. [Google Scholar]
- Cisse, O.A.; Ouattara, A.; Thellier, M.; Accoceberry, I.; Biligui, S.; Minta, D.; Doumbo, O.; Desportes-Livage, I.; Thera, M.A.; Danis, M.; et al. Evaluation of an immunofluorescent-antibody test using monoclonal antibodies directed against Enterocytozoon bieneusi and Encephalitozoon intestinalis for diagnosis of intestinal microsporidiosis in Bamako (Mali). J. Clin. Microbiol. 2002, 40, 1715–1718. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aseeja, P.; Shaikh, Y.; Bajpai, A.; Sirsikar, P.; Kalra, S.K. Advancement in our understanding of immune response against Encephalitozoon infection. Parasite Immunol. 2021, 43, e12828. [Google Scholar] [CrossRef] [PubMed]
- Mathis, A.; Weber, R.; Deplazes, P. Zoonotic potential of the microsporidia. Clin. Microbiol. Rev. 2005, 18, 423–445. [Google Scholar] [CrossRef] [Green Version]
- Enriquez, F.J.; Taren, D.; Cruz-López, A.; Muramoto, M.; Palting, J.D.; Cruz, P. Prevalence of intestinal encephalitozoonosis in Mexico. Clin. Infect. Dis. 1998, 25, 1227–1229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qiu, L.; Xia, W.; Li, W.; Ping, J.; Ding, S.; Liu, H. The prevalence of microsporidia in China: A systematic review and meta-analysis. Sci. Rep. 2019, 9, 3174. [Google Scholar] [CrossRef] [PubMed]
- Gool, T.V.; Vetter, J.C.; Weinmayr, B.; Dam, A.V.; Derouin, F.; Dankert, J. High seroprevalence of Encephalitozoon species in immunocompetent subjects. J. Infect. Dis. 1997, 175, 1020–1024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oyegue-Liabagui, S.L.; Ndjangangoye, N.K.; Kouna, L.C.; Lekolo, G.M.; Mounioko, F.; Kwedi Nolna, S.K.; Lekana-Douki, J.B. Molecular prevalence of intestinal parasites infections in children with diarrhea in Franceville, southeast of Gabon. BMC Infect. Dis. 2020, 20, 350. [Google Scholar] [CrossRef]
- Halánová, M.; Valenčáková, A.; Jarčuška, P.; Halán, M.; Danišová, O.; Babinská, I.; Dedinská, K.; Čisláková, L. Screening of opportunistic Encephalitozoon intestinalis and Enterocytozoon bieneusi in immunocompromised patients in Slovakia. Cent. Eur. J. Public Health 2019, 27, 330–334. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.J.; Yoon, S.J.; Cheun, H.I.; Kim, J.H.; Sim, S.B.; Yu, J.R. Detection of Encephalitozoon spp. from human diarrheal stool and farm soil samples in Korea. J. Korean Med. Sci. 2015, 30, 227–232. [Google Scholar] [CrossRef] [PubMed]
- Amer, S.; Kim, S.Y.; Han, J.I.; Na, K.J. Prevalence and genotypes of Enterocytozoon bieneusi in wildlife in Korea: A public health concern. Parasites Vectors 2019, 12, 160. [Google Scholar] [CrossRef]
- Hwang, S.W.; Shin, S.U.; Kim, S.H.; Ryu, J.H.; Choi, K.S. Zoonotic potential of Enterocytozoon bieneusi in pre-weaned Korean native calves. Parasites Vectors 2020, 13, 300. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H. Prevalence and molecular characteristics of Enterocytozoon bieneusi in cattle in Korea. Parasitol. Res. 2007, 101, 391–396. [Google Scholar] [CrossRef]
- Jeong, D.K.; Won, G.Y.; Park, B.K.; Hur, J.; You, J.Y.; Kang, S.J.; Oh, I.G.; Lee, Y.S.; Stein, B.D.; Lee, J.H. Occurrence and genotypic characteristics of Enterocytozoon bieneusi in pigs with diarrhea. Parasitol. Res. 2007, 102, 123–128. [Google Scholar] [CrossRef]
- Lobo, M.L.; Xiao, L.; Antunes, F.; Matos, O. Microsporidia as emerging pathogens and the implication for public health: A 10-year study on HIV-positive and -negative patients. Int. J. Parasitol. 2012, 42, 197–205. [Google Scholar] [CrossRef] [PubMed]
- Kotler, D.P.; Orenstein, J.M. Clinical syndromes associated with microsporidiosis. Adv. Parasitol. 1998, 40, 321–349. [Google Scholar] [CrossRef]
- Liu, H.; Jiang, Z.; Yuan, Z.; Yin, J.; Wang, Z.; Yu, B.; Zhou, D.; Shen, Y.; Cao, J. Infection by and genotype characteristics of Enterocytozoon bieneusi in HIV/AIDS patients from Guangxi Zhuang autonomous region, China. BMC Infect. Dis. 2017, 17, 684. [Google Scholar] [CrossRef] [PubMed]
- Matos, O.; Lobo, M.L.; Xiao, L. Epidemiology of Enterocytozoon bieneusi infection in humans. J. Parasitol. Res. 2012, 2012, 981424. [Google Scholar] [CrossRef] [Green Version]
- Henriques-Gil, N.; Haro, M.; Izquierdo, F.; Fenoy, S.; Águila, C. Phylogenetic approach to the variability of the Microsporidian Enterocytozoon bieneusi and its implications for inter- and intrahost transmission. Appl. Environ. Microbiol. 2010, 76, 3333–3342. [Google Scholar] [CrossRef] [Green Version]
- Santín, M.; Fayer, R. Enterocytozoon bieneusi genotype nomenclature based on the internal transcribed spacer sequence: A consensus. J. Eukaryot. Microbiol. 2009, 56, 34–38. [Google Scholar] [CrossRef]
- Lee, S.H.; Oem, J.K.; Lee, S.M.; Son, K.D.; Jo, S.D.; Kwak, D.M. Molecular detection of Enterocytozoon bieneusi from bats in South Korea. Med. Mycol. 2018, 56, 1033–1037. [Google Scholar] [CrossRef]
- Lee, H.S.; Seo, M.G.; Lee, S.H.; Oem, J.K.; Kim, S.H.; Jeong, H.S.; Kim, Y.K.; Jheong, W.H.; Kwon, O.D.; Kwak, D.M. Distribution and genotypic analysis of Enterocytozoon bieneusi from wild boars in Korea. Med. Mycol. 2021, 59, 934–938. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H. Molecular detection of Enterocytozoon bieneusi and identification of a potentially human-pathogenic genotype in milk. Appl. Environ. Microbiol. 2008, 74, 1664–1666. [Google Scholar] [CrossRef] [Green Version]
- Shen, Y.; Gong, B.; Liu, X.; Wu, Y.; Yang, F.; Xu, J.; Zhang, X.; Cao, J.; Liu, A. First identification and genotyping of Enterocytozoon bieneusi in humans in Myanmar. BMC Microbiol. 2020, 20, 10. [Google Scholar] [CrossRef] [Green Version]
- Zhao, W.; Zhang, W.; Yang, F.; Zhang, L.; Wang, R.; Cao, J.; Shen, Y.; Liu, A. Enterocytozoon bieneusi in dairy cattle in the northeast of China: Genetic diversity of ITS gene and evaluation of zoonotic transmission potential. J. Eukaryot. Microbiol. 2015, 62, 553–560. [Google Scholar] [CrossRef] [PubMed]
- Sulaiman, I.M.; Fayer, R.; Lal, A.A.; Trout, J.M.; Schaefer, F.W.; Xiao, L. Molecular characterization of microsporidia indicates that wild mammals harbor host-adapted Enterocytozoon spp. as well as human-pathogenic Enterocytozoon bieneusi. Appl. Environ. Microbiol. 2003, 69, 4495–4501. [Google Scholar] [CrossRef] [Green Version]
- Jacques, B.; Emmanuelle, B.D.; Sylvestre, B.; Alessandra, C.; Xavier, S.; Madeleine, O.N.; Chantal, N.; Maryvonne, K.; Isabelle, A.; Marc, T. New highly divergent rRNA sequence among biodiverse genotypes of Enterocytozoon bieneusi strains isolated from humans in Gabon and Cameroon. J. Clin. Microbiol. 2007, 45, 2580–2589. [Google Scholar]
- Li, N.; Xiao, L.; Wang, L.; Zhao, S.; Zhao, X.; Duan, L.; Guo, M.; Liu, L.; Feng, Y. Molecular Surveillance of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi by Genotyping and Subtyping Parasites in Wastewater. PLoS Negl. Trop. Dis. 2012, 6, e1809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thellier, M.; Breton, J. Enterocytozoon bieneusi in human and animals, focus on laboratory identification and molecular epidemiology. Parasite 2008, 15, 349–358. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karim, M.R.; Dong, H.; Li, T.; Yu, F.; Li, D.; Zhang, L.; Li, J.; Wang, R.; Li, S.; Li, X.; et al. Predomination and new genotypes of Enterocytozoon bieneusi in captive nonhuman primates in zoos in China: High genetic diversity and zoonotic significance. PLoS ONE 2015, 10, e0117991. [Google Scholar] [CrossRef]
- Zhang, Y.; Koehler, A.V.; Wang, T.; Gasser, R.B. Enterocytozoon bieneusi of animals—With an ‘Australian twist’. Adv. Parasitol. 2021, 111, 1–73. [Google Scholar] [PubMed]
- Lesnianska, K.; Perec-Matysiak, A. Wildlife as an environmental reservoir of Enterocytozoon bieneusi (Microsporidia) analyses of data based on molecular methods. Ann. Parasitol. 2017, 63, 265–281. [Google Scholar]
- Pepper, I.L.; Gerba, C.P.; Gentry, T.J. Environmental Microbiology, 3rd ed.; Elsevier: Amsterdam, The Netherlands, 2015; pp. 509–550. [Google Scholar]
- Lee, S.H.; Joung, M.G.; Yoon, S.J.; Choi, K.J.; Park, W.Y.; Yu, J.R. Multiplex PCR detection of waterborne intestinal Protozoa: Microsporidia, Cyclospora, and Cryptosporidium. Korean J. Parasitol. 2010, 48, 297–301. [Google Scholar] [CrossRef] [PubMed]
- Zang, M.; Li, J.; Tang, C.; Ding, S.; Huang, W.; Qin, Q.; Liu, H. Prevalence and phylogenetic analysis of Microsporidium Enterocytozoon bieneusi in diarrheal patients. Pathogens 2021, 10, 128. [Google Scholar] [CrossRef] [PubMed]
Protozoa Parasite | Total | Enc. intestinalis (%) | Ent. bieneusi (%) |
---|---|---|---|
Number of Samples | 1241 | 24 (2.0%) | 1 (0.1%) |
Sex | Total | Enc. intestinalis (%) | Ent. bieneusi (%) |
Male | 648 | 12 (1.9%) | 1 (0.2%) |
Female | 593 | 12 (2.0%) | − |
Age Group (Years) | Total | Enc. intestinalis (%) | Ent. bieneusi (%) |
0–9 | 281 | 3 (1.1%) | − |
10–19 | 86 | 3 (3.5%) | 1 (1.2%) |
20–29 | 43 | 2 (4.7%) | − |
30–39 | 46 | 3 (6.5%) | − |
40–49 | 77 | 2 (2.6%) | − |
50–59 | 144 | 1 (0.7%) | − |
60–69 | 202 | 5 (2.5%) | − |
≥70 | 362 | 5 (1.4%) | − |
Total | 1241 | 24 (2.0%) | 1 (0.1%) |
Species | Primer | Sequence (5′→3′) | Diagnostic Size | |
---|---|---|---|---|
Microsporidia spp. | 1st | Mic A | GGAGCCTGAGAGATGGCT | 644 bp |
Mic E | AACGGCCATGCACCAC | |||
2nd | Mic C | GGTGCCAGCAGCCGCGG | 420 bp | |
Mic D | GCACAATCCACTCCT | |||
Ent. bieneusi | 1st | EBITS3 | GGTCATAGGGATGAAGAG | 435 bp |
EBITS4 | TTCGAGTTCTTTCGCGCTC | |||
2nd | EBITS1 | GCTCTGAATATCTATGGCT | 390 bp | |
EBITS2.4 | ATCGCCGACGGATCCAAGTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kwon, J.-Y.; Seo, J.-Y.; Kim, T.-Y.; Lee, H.-I.; Ju, J.-W. First Identification and Genotyping of Enterocytozoon bieneusi and Prevalence of Encephalitozoon intestinalis in Patients with Acute Diarrhea in the Republic of Korea. Pathogens 2021, 10, 1424. https://doi.org/10.3390/pathogens10111424
Kwon J-Y, Seo J-Y, Kim T-Y, Lee H-I, Ju J-W. First Identification and Genotyping of Enterocytozoon bieneusi and Prevalence of Encephalitozoon intestinalis in Patients with Acute Diarrhea in the Republic of Korea. Pathogens. 2021; 10(11):1424. https://doi.org/10.3390/pathogens10111424
Chicago/Turabian StyleKwon, Ji-Young, Ji-Ye Seo, Tae-Yun Kim, Hee-Il Lee, and Jung-Won Ju. 2021. "First Identification and Genotyping of Enterocytozoon bieneusi and Prevalence of Encephalitozoon intestinalis in Patients with Acute Diarrhea in the Republic of Korea" Pathogens 10, no. 11: 1424. https://doi.org/10.3390/pathogens10111424