Molecular Evidence for Flea-Borne Rickettsiosis in Febrile Patients from Madagascar
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Human Blood Sample Collection
4.2. DNA Extraction and Real-Time PCR
4.3. Conventional PCR, Sequencing and Phylogenetic Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A. Sequences Obtained in the Study
#4133, gltA (116 bp) |
TTCAAACCTTTTGTAGTTCTTCTCATCCTATGGCTATTATGCTTGCAGCTGTTGGTTCTCTTTCAGCATTTTATCCTGATTTATTGAATTTTAATGAAACAGACTATGAACTTACC |
#4133, ompB (759 bp): GenBank accession number OL310470 |
#4196, gltA (116 bp) |
TTCAAACATTTTGTAGCTCTTCTCATCCTATGGCTATTATGCTTGCGGCCGTTGGTTCTCTTTCGGCATTTTATCCTGATTTACTGAATTTTAAAGAAGCAGACTACGAACTTACC |
#4196, dksA-xerC (117 bp) |
TAGCATATTAATATCTCAATATTAGCTTTAGTATATTATGTTTATAAGGTTTTTAAAATAAAATAATATATAACTTAAAACTAACGCAAGAAGATTATGAATATTAATATATTTTAT |
#4196, rpmE-tRNAfMet (319 bp): GenBank Accession number OL310471 |
References
- Thu, M.J.; Qiu, Y.; Matsuno, K.; Kajihara, M.; Mori-Kajihara, A.; Omori, R.; Monma, N.; Chiba, K.; Seto, J.; Gokuden, M.; et al. Diversity of spotted fever group rickettsiae and their association with host ticks in Japan. Sci. Rep. 2019, 9, 1500. [Google Scholar] [CrossRef] [Green Version]
- Gillespie, J.J.; Williams, K.; Shukla, M.; Snyder, E.E.; Nordberg, E.K.; Ceraul, S.M.; Dharmanolía, C.; Rainey, D.; Soneja, J.; Shallom, J.M.; et al. Rickettsia phylogenomics: Unwinding the intricacies of obligate intracellular life. PLoS ONE 2008, 3, e2018. [Google Scholar] [CrossRef] [Green Version]
- Jay, R.; Armstrong, P. Clinical characteristics of Rocky Mountain spotted fever in the United States: A literature review. J. Vector Borne Dis. 2020, 57, 114–120. [Google Scholar] [CrossRef] [PubMed]
- Nogueira Angerami, R.; Nunes, E.M.; Mendes Nascimento, E.M.; Ribas Freitas, A.; Kemp, B.; Feltrin, A.F.C.; Pacola, M.R.; Perecin, G.E.C.; Sinkoc, V.; Ribeiro Resende, M.; et al. Clusters of Brazilian spotted fever in São Paulo State, southeastern Brazil. A review of official reports and the scientific literature. Clin. Microbiol. Infect. 2009, 15, 202–204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vanegas, A.; Keller, C.; Krüger, A.; Manchang, T.K.; Hagen, R.M.; Frickmann, H.; Veit, A.; Achukwi, M.D.; Krücken, J.; Poppert, S. Molecular detection of spotted fever group rickettsiae in ticks from Cameroon. Ticks Tick. Borne. Dis. 2018, 9, 1049–1056. [Google Scholar] [CrossRef] [PubMed]
- Rakotonanahary, R.J.L.; Harrison, A.; Maina, A.N.; Jiang, J.; Richards, A.L.; Rajerison, M.; Telfer, S. Molecular and serological evidence of flea-associated typhus group and spotted fever group rickettsial infections in Madagascar. Parasit. Vectors 2017, 10, 125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ehlers, J.; Ganzhorn, J.U.; Silaghi, C.; Krüger, A.; Pothmann, D.; Yedidya Ratovonamana, R.; Veit, A.; Keller, C.; Poppert, S. Tick (Amblyomma chabaudi) infestation of endemic tortoises in southwest Madagascar and investigation of tick-borne pathogens. Ticks Tick. Borne. Dis. 2016, 7, 378–383. [Google Scholar] [CrossRef]
- Roch, N.; Epaulard, O.; Pelloux, I.; Pavese, P.; Brion, J.-P.; Raoult, D.; Maurin, M. African tick bite fever in elderly patients: 8 cases in French tourists returning from South Africa. Clin. Infect. Dis. 2008, 47, e28–e35. [Google Scholar] [CrossRef] [Green Version]
- Znazen, A.; Rolain, J.M.; Hammami, N.; Hammami, A.; Ben Jemaa, M.; Raoult, D. Rickettsia felis infection, Tunisia. Emerg. Infect. Dis. 2006, 12, 138–140. [Google Scholar] [CrossRef]
- Khrouf, F.; Sellami, H.; Elleuch, E.; Hattab, Z.; Ammari, L.; Khalfaoui, M.; Souissi, J.; Harrabi, H.; M’ghirbi, Y.; Tiouiri, H.; et al. Molecular diagnosis of Rickettsia infection in patients from Tunisia. Ticks Tick. Borne. Dis. 2016, 7, 653–656. [Google Scholar] [CrossRef] [PubMed]
- Dupont, H.T.; Brouqui, P.; Faugere, B.; Raoult, D. Prevalence of antibodies to Coxiella burnetii, Rickettsia conorii, and Rickettsia typhi in seven African countries. Clin. Infect. Dis. 1995, 21, 1126–1133. [Google Scholar] [CrossRef] [PubMed]
- Niang, M.; Parola, P.; Tissot-Dupont, H.; Baidi, L.; Brouqui, P.; Raoult, D. Prevalence of antibodies to Rickettsia conorii, Rickettsia africae, Rickettsia typhi and Coxiella burnetii in Mauritania. Eur. J. Epidemiol. 1998, 14, 817–818. [Google Scholar] [CrossRef]
- Doppler, J.F.; Newton, P.N. A systematic review of the untreated mortality of murine typhus. PLoS Negl. Trop. Dis. 2020, 14, e0008641. [Google Scholar] [CrossRef]
- Sothmann, P.; Keller, C.; Krumkamp, R.; Kreuels, B.; Aldrich, C.; Sarpong, N.; Steierberg, S.; Winter, D.; Boahen, K.G.; Owusu-Dabo, E.; et al. Rickettsia felis Infection in Febrile Children, Ghana. Am. J. Trop. Med. Hyg. 2017, 96, 16–0754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mediannikov, O.; Socolovschi, C.; Edouard, S.; Fenollar, F.; Mouffok, N.; Bassene, H.; Diatta, G.; Tall, A.; Niangaly, H.; Doumbo, O.; et al. Common epidemiology of Rickettsia felis infection and malaria, Africa. Emerg. Infect. Dis. 2013, 19, 1775–1783. [Google Scholar] [CrossRef]
- Mourembou, G.; Lekana-Douki, J.B.; Mediannikov, O.; Nzondo, S.M.; Kouna, L.C.; Essone, J.C.B.B.; Fenollar, F.; Raoult, D. Possible role of Rickettsia felis in acute febrile illness among children in Gabon. Emerg. Infect. Dis. 2015, 21, 1808–1815. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maina, A.N.; Knobel, D.L.; Jiang, J.; Halliday, J.; Feikin, D.R.; Cleaveland, S.; Ng’ang’a, Z.; Junghae, M.; Breiman, R.F.; Richards, A.L.; et al. Rickettsia felis infection in febrile patients, western Kenya, 2007–2010. Emerg. Infect. Dis. 2012, 18, 328–331. [Google Scholar] [CrossRef]
- Cherry, C.C.; Denison, A.M.; Kato, C.Y.; Thornton, K.; Paddock, C.D. Diagnosis of spotted fever group rickettsioses in U.S. travelers returning from Africa, 2007–2016. Am. J. Trop. Med. Hyg. 2018, 99, 136–142. [Google Scholar] [CrossRef] [Green Version]
- Tsioutis, C.; Zafeiri, M.; Avramopoulos, A.; Prousali, E.; Miligkos, M.; Karageorgos, S.A. Clinical and laboratory characteristics, epidemiology, and outcomes of murine typhus: A systematic review. Acta Trop. 2017, 166, 16–24. [Google Scholar] [CrossRef]
- Parola, P. Rickettsia felis: From a rare disease in the USA to a common cause of fever in sub-Saharan Africa. Clin. Microbiol. Infect. 2011, 17, 996–1000. [Google Scholar] [CrossRef] [Green Version]
- Keller, C.; Krüger, A.; Schwarz, N.G.; Rakotozandrindrainy, R.; Rakotondrainiarivelo, J.P.; Razafindrabe, T.; Derschum, H.; Silaghi, C.; Pothmann, D.; Veit, A.; et al. High detection rate of Rickettsia africae in Amblyomma variegatum but low prevalence of anti-rickettsial antibodies in healthy pregnant women in Madagascar. Ticks Tick. Borne. Dis. 2016, 7, 60–65. [Google Scholar] [CrossRef]
- Guillebaud, J.; Bernardson, B.; Randriambolamanantsoa, T.H.; Randrianasolo, L.; Randriamampionona, J.L.; Marino, C.A.; Rasolofo, V.; Randrianarivelojosia, M.; Vigan-Womas, I.; Stivaktas, V.; et al. Study on causes of fever in primary healthcare center uncovers pathogens of public health concern in Madagascar. PLoS Negl. Trop. Dis. 2018, 12, e0006642. [Google Scholar] [CrossRef] [PubMed]
- Boone, I.; Henning, K.; Hilbert, A.; Neubauer, H.; von Kalckreuth, V.; Dekker, D.M.; Schwarz, N.G.; Pak, G.D.; Krüger, A.; Hagen, R.M.; et al. Are brucellosis, Q fever and melioidosis potential causes of febrile illness in Madagascar? Acta Trop. 2017, 172, 255–262. [Google Scholar] [CrossRef] [PubMed]
- Roux, V.; Raoult, D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmp (ompB). Int. J. Syst. Evol. Microbiol. 2000, 50, 1449–1455. [Google Scholar] [CrossRef] [Green Version]
- Fournier, P.; Zhu, Y.; Ogata, H.; Raoult, D. Use of highly variable intergenic spacer sequences for multispacer typing of Rickettsia conorii strains use of highly variable intergenic spacer sequences for multispacer typing of Rickettsia conorii Strains. J. Clin. Microbiol. 2004, 42, 5757–5766. [Google Scholar] [CrossRef] [Green Version]
- Henry, K.M.; Jiang, J.; Rozmajzl, P.J.; Azad, A.F.; Macaluso, K.R.; Richards, A.L. Development of quantitative real-time PCR assays to detect Rickettsia typhi and Rickettsia felis, the causative agents of murine typhus and flea-borne spotted fever. Mol. Cell. Probes 2007, 21, 17–23. [Google Scholar] [CrossRef]
- Andrianaivoarimanana, V.; Kreppel, K.; Elissa, N.; Duplantier, J.M.; Carniel, E.; Rajerison, M.; Jambou, R. Understanding the persistence of Plague Foci in Madagascar. PLoS Negl. Trop. Dis. 2013, 7, 1853–1857. [Google Scholar] [CrossRef] [Green Version]
- Goodman, S.M.; Andriniaina, H.R.R.; Soarimalala, V.; Beaucournu, J.C. The fleas of endemic and introduced small mammals in central highland forests of Madagascar: Faunistics, species diversity, and absence of host specificity. J. Med. Entomol. 2015, 52, 1135–1143. [Google Scholar] [CrossRef]
- Walter, G.; Botelho-Nevers, E.; Socolovschi, C.; Raoult, D.; Parola, P. Murine typhus in returned travelers: A report of thirty-two cases. Am. J. Trop. Med. Hyg. 2012, 86, 1049–1053. [Google Scholar] [CrossRef] [Green Version]
- Znazen, A.; Sellami, H.; Elleuch, E.; Hattab, Z.; Ben Sassi, L.; Khrouf, F.; Dammak, H.; Letaief, A.; Ben Jemaa, M.; Hammami, A. Comparison of two quantitative real time PCR assays for Rickettsia detection in patients from Tunisia. PLoS Negl. Trop. Dis. 2015, 9, e0003487. [Google Scholar] [CrossRef] [Green Version]
- Rauch, J.; Eisermann, P.; Noack, B.; Mehlhoop, U.; Muntau, B.; Schäfer, J.; Tappe, D. Typhus group Rickettsiosis, Germany, 2010–2017—Volume 24, Number 7–July 2018—Emerging Infectious Diseases journal—CDC. Emerg. Infect. Dis. 2018, 24, 1213–1220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paris, D.H.; Dumler, J.S. State of the art of diagnosis of rickettsial diseases: The use of blood specimens for diagnosis of scrub typhus, spotted fever group rickettsiosis, and murine typhus. Curr. Opin. Infect. Dis. 2016, 29, 433. [Google Scholar] [CrossRef] [Green Version]
- Robinson, M.T.; Satjanadumrong, J.; Hughes, T.; Stenos, J.; Blacksell, S.D. Diagnosis of spotted fever group Rickettsia infections: The Asian perspective. Epidemiol. Infect. 2019, 147, e286. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mourembou, G.; Fenollar, F.; Socolovschi, C.; Lemamy, G.J.; Nzoughe, H.; Kouna, L.C.; Toure-Ndouo, F.; Million, M.; Mbiguino, A.N.; Lekana-Douki, J.B.; et al. Molecular detection of fastidious and common Bacteria as well as plasmodium spp. in Febrile and Afebrile children in Franceville, Gabon. Am. J. Trop. Med. Hyg. 2015, 92, 926–932. [Google Scholar] [CrossRef] [Green Version]
- Park, S.E.; Pak, G.D.; Aaby, P.; Adu-Sarkodie, Y.; Ali, M.; Aseffa, A.; Biggs, H.M.; Bjerregaard-Andersen, M.; Breiman, R.F.; Crump, J.A.; et al. The relationship between invasive nontyphoidal salmonella disease, other bacterial bloodstream infections, and Malaria in sub-Saharan Africa. Clin. Infect. Dis. 2016, 62, s23–s31. [Google Scholar] [CrossRef] [Green Version]
- Civen, R.; Ngo, V. Murine Typhus: An unrecognized suburban Vectorborne disease. Clin. Infect. Dis. 2008, 46, 913–918. [Google Scholar] [CrossRef] [Green Version]
- Okabayashi, T.; Hasebe, F.; Samui, K.L.; Mweene, A.S.; Pandey, S.G.; Yanase, T.; Muramatsu, Y.; Ueno, H.; Morita, C. Short report: Prevalence of antibodies against spotted fever, murine typhus, and Q fever rickettsiae in humans living in Zambia. Am. J. Trop. Med. Hyg. 1999, 61, 70–72. [Google Scholar] [CrossRef] [PubMed]
- Angelakis, E.; Botelho, E.; Socolovschi, C.; Sobas, C.R.; Piketty, C.; Parola, P.; Raoult, D. Murine typhus as a cause of fever in travelers from tunisia and Mediterranean areas. J. Travel Med. 2010, 17, 310–315. [Google Scholar] [CrossRef]
- Azad, A.F.; Radulovic, S.; Higgins, J.A.; Noden, B.H.; Troyer, J.M. Flea-borne Rickettsioses: Ecologic Considerations. Emerg. Infect. Dis. 1997, 3, 319–327. [Google Scholar] [CrossRef] [Green Version]
- Von Kalckreuth, V.; Konings, F.; Aaby, P.; Adu-Sarkodie, Y.; Ali, M.; Aseffa, A.; Baker, S.; Breiman, R.F.; Bjerregaard-Andersen, M.; Clemens, J.D.; et al. The typhoid fever surveillance in Africa program (TSAP): Clinical, diagnostic, and epidemiological methodologies. Clin. Infect. Dis. 2016, 62, s9–s16. [Google Scholar] [CrossRef] [Green Version]
- Hagen, R.M.; Frickmann, H.; Ehlers, J.; Krüger, A.; Margos, G.; Hizo-Teufel, C.; Fingerle, V.; Rakotozandrindrainy, R.; von Kalckreuth, V.; Im, J.; et al. Presence of Borrelia spp. DNA in ticks, but absence of Borrelia spp. and of Leptospira spp. DNA in blood of fever patients in Madagascar. Acta Trop. 2018, 177, 127–134. [Google Scholar] [CrossRef]
- Mediannikov, O.; Diatta, G.; Fenollar, F.; Sokhna, C.; Trape, J.F.; Raoult, D. Tick-borne rickettsioses, neglected emerging diseases in rural Senegal. PLoS Negl. Trop. Dis. 2010, 4, e821. [Google Scholar] [CrossRef] [Green Version]
- Mediannikov, O.; Fenollar, F. Looking in ticks for human bacterial pathogens. Microb. Pathog. 2014, 77, 142–148. [Google Scholar] [CrossRef]
ID | Age | Sex | Residence | Body Temp. | Rash | Cough | gltA Ct | gltA Seq. | R. felis ompB Ct | Rick. ompB seq. |
---|---|---|---|---|---|---|---|---|---|---|
4133 | 38 y. | f | Manarintsoa Isotry (Antananarivo) | 40.0 | - | + | 37.3 | R. typhi (100%) | neg. | R. typhi (100%) |
4196 | 1 y. 5 m | m | Antohomadinika Sud (Antananarivo) | 39.4 | - | + | 35.2 | R. felis (100%) | 39.2 | NP 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Keller, C.; Rakotozandrindrainy, R.; von Kalckreuth, V.; Heriniaina, J.N.; Schwarz, N.G.; Pak, G.D.; Im, J.; Espinoza, L.M.C.; Hagen, R.M.; Frickmann, H.; et al. Molecular Evidence for Flea-Borne Rickettsiosis in Febrile Patients from Madagascar. Pathogens 2021, 10, 1482. https://doi.org/10.3390/pathogens10111482
Keller C, Rakotozandrindrainy R, von Kalckreuth V, Heriniaina JN, Schwarz NG, Pak GD, Im J, Espinoza LMC, Hagen RM, Frickmann H, et al. Molecular Evidence for Flea-Borne Rickettsiosis in Febrile Patients from Madagascar. Pathogens. 2021; 10(11):1482. https://doi.org/10.3390/pathogens10111482
Chicago/Turabian StyleKeller, Christian, Raphaël Rakotozandrindrainy, Vera von Kalckreuth, Jean Noël Heriniaina, Norbert Georg Schwarz, Gi Deok Pak, Justin Im, Ligia Maria Cruz Espinoza, Ralf Matthias Hagen, Hagen Frickmann, and et al. 2021. "Molecular Evidence for Flea-Borne Rickettsiosis in Febrile Patients from Madagascar" Pathogens 10, no. 11: 1482. https://doi.org/10.3390/pathogens10111482