A Clinical Case of Scrub Typhus in the United States Forces Korea Patient with Eschar and Genetic Identification of Orientia tsutsugamushi Using Multiplex PCR-Based Next-Generation Sequencing
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. DNA Isolation from Eschar and Nested PCR
4.2. Multiplex PCR-Based Next-Generation Sequencing (NGS)
4.3. Phylogenetic Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ghorbani, R.P.; Ghorbani, A.J.; Jain, M.K.; Walker, D.H. A Case of scrub typhus probably acquired in Africa. Clin. Infect. Dis. 1997, 25, 1473–1474. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maina, A.N.; Farris, C.M.; Odhiambo, A.; Jiang, J.; Laktabai, J.; Armstrong, J.; Holland, T.; Richards, A.L.; O’Meara, W.P. Q fever, scrub typhus, and rickettsial diseases in children, Kenya, 2011–2012. Emerg. Infect. Dis. 2016, 22, 883–886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weitzel, T.; Dittrich, S.; López, J.; Phuklia, W.; Martinez-Valdebenito, C.; Velásquez, K.; Blacksell, S.D.; Paris, D.H.; Abarca, K. Endemic scrub typhus in South America. N. Engl. J. Med. 2016, 375, 954–961. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.-W.; Cho, P.Y.; Moon, S.-U.; Na, B.-K.; Kang, Y.-J.; Sohn, Y.; Youn, S.-K.; Hong, Y.; Kim, T.-S. Current situation of scrub typhus in South Korea from 2001–2013. Parasites Vectors 2015, 8, 1–4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kelly, D.J.; Fuerst, P.A.; Ching, W.; Richards, A.L. Scrub Typhus: The geographic distribution of phenotypic and genotypic variants of Orientia tsutsugamushi. Clin. Infect. Dis. 2009, 48, S203–S230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stover, C.K.; Marana, D.P.; Carter, J.M.; Roe, B.A.; Mardis, E.; Oaks, E.V. The 56-kilodalton major protein antigen of Rickettsia tsutsugamushi: Molecular cloning and sequence analysis of the sta56 gene and precise identification of a strain-specific epitope. Infect. Immun. 1990, 58, 2076–2084. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, J.W.; Jung, S.H.; Ha, D.R.; Park, D.W.; Lee, J.M.; Kim, S.H.; Jeong, H.J.; Kim, N.M.; Gill, B.C.; Lee, J.Y.; et al. Molecular epidemiology of an Orientia tsutsugamushi gene encoding a 56-kDa type-specific antigen in chiggers, small mammals, and patients from the southwest region of Korea. Am. J. Trop. Med. Hyg. 2018, 98, 616–624. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- No, J.S.; Kim, W.-K.; Cho, S.; Lee, S.-H.; Kim, J.-A.; Lee, D.; Song, D.H.; Gu, S.H.; Jeong, S.T.; Wiley, M.R.; et al. Comparison of targeted next-generation sequencing for whole-genome sequencing of Hantaan orthohantavirus in Apodemus agrarius lung tissues. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef]
- Kim, W.-K.; No, J.S.; Lee, D.; Jung, J.; Park, H.; Yi, Y.; Kim, J.-A.; Lee, S.-H.; Kim, Y.; Park, S.; et al. Active targeted surveillance to identify sites of emergence of hantavirus. Clin. Infect. Dis. 2019, 70, 464–473. [Google Scholar] [CrossRef] [PubMed]
- Yi, K.S.; Chong, Y.; Covington, S.C.; Donahue, B.J.; Rothen, R.L.; Rodriguez, J.; Arthur, J.D. Scrub typhus in Korea: Importance of early clinical diagnosis in this newly recognized endemic area. Mil. Med. 1993, 158, 269–273. [Google Scholar] [CrossRef] [PubMed]
- O’Guinn, M.L.; Klein, T.A.; Lee, J.S.; Richards, A.L.; Kim, H.-C.; Ha, S.J.; Shim, S.H.; Baek, L.J.; Song, K.-J.; Chong, S.-T.; et al. Serological surveillance of scrub typhus, murine typhus, and leptospirosis in small mammals captured at firing points 10 and 60, Gyeonggi Province, Republic of Korea, 2001–2005. Vector-Borne Zoonotic Dis. 2010, 10, 125–133. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, H.C.; Lee, I.Y.; Chong, S.T.; Richards, A.L.; Gu, S.H.; Song, J.-W.; Lee, J.S.; Klein, T.A. Serosurveillance of scrub typhus in small mammals collected from military training sites near the DMZ, northern Gyeonggi-do, Korea, and analysis of the relative abundance of chiggers from mammals examined. Korean J. Parasitol. 2010, 48, 237–243. [Google Scholar] [CrossRef] [PubMed]
- Enatsu, T.; Urakami, H.; Tamura, A. Phylogenetic analysis of Orientia tsutsugamushi strains based on the sequence homologies of 56-kDa type-specific antigen genes. FEMS Microbiol. Lett. 1999, 180, 163–169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Date | Onset/Clinical Visit | Antibiotics | Eschar | Rash | Symptoms | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Chills | Fever | Sweats | Headache | Nausea/Vomiting | Diarrhea | Body Aches | Malaise | |||||
12 November 2018 | Eschar | No | Yes | No | No | N/D * | No | No | No | No | No | No |
14 November 2018 | Onset | No | Yes | No | No | N/D | Yes | Yes | No | No | No | Yes |
15 November 2018 | Continued | No | Yes | No | Yes | N/D | Yes | Yes | No | No | Yes | Yes |
16 November 2018 | Cp Humphreys Clinic | No | Yes | No | No | 98.1 °F | Yes | Yes | No | No | Yes | Yes |
19 November 2018 | Cp Humphreys Clinic | No | Yes | Yes | Yes | 98.3 °F | Yes | Yes | loss of appetite | No | Yes | Yes |
21 November 2018 | St Mary’s Hospital | Doxycycline ** | Yes | Yes | Yes | 97.9 °F | Yes | Yes | No | No | Yes | Yes |
25 November 2018 | St Mary’s Hospital | Doxycycline | Yes | Yes | No | N/D | No | No | No | No | Yes | Yes |
26 November 2018 | St Mary’s Hospital | Doxycycline | Yes | Yes | No | N/D | No | No | No | No | Yes | Yes |
Name | Position | Sequence (5′→3′) | Reference | Name | Position | Sequence (5′→3′) | Reference |
---|---|---|---|---|---|---|---|
56kDa-01F | 1–20 | CTAGAAGTTATAGCGCACAC | Boryong (AM494475) | 56kDa-01R | 281–300 | GATCTGAGTATGGTTGTTGG | Boryong (AM494475) |
56kDa-02F | 251–270 | GTAACTAGGTCAGCATAGAG | 56kDa-02R | 531–550 | GCAAGCTCAAGCTACAGCGC | ||
56kDa-03F | 501–520 | GCCTAACAGCTGCTGCTGCT | 56kDa-03R | 781–800 | AAATTATTCAGATATATAGT | ||
56kDa-04F | 751–770 | ACCAGCTATATCAGCAAATG | 56kDa-04R | 1031–1050 | AAGAATTGTGCTGGTATTGA | ||
56kDa-05F | 1007–1020 | CCAGGATTATTAGGATCCTT | 56kDa-05R | 1281–1300 | CGCTGAGGTTGAAGTAGGTA | ||
56kDa-06F | 1251–1270 | TTATCTCACCTTTAGAATCT | 56kDa-06R | 1531–1550 | CGTTTTCAGCTAGTGCGATA | ||
56kDa-07F | 1501–1520 | ACACTCTAATCCTACTTCAT | 56kDa-07R | 1577–1599 | ATGAAAAAAATTATGTTAATTGC | ||
56kDa-08F | 1–20 | CTAGAAGTTATAGCGTACAG | Young-worl (AF430141) | 56kDa-08R | 131–150 | GCATCAGGGGCGCTTGGTGT | Young-worl (AF430141) |
56kDa-09F | 101–120 | ACATACACACCCTCAGCAGC | 56kDa-09R | 231–250 | AACTGAATCATTCTCAATAT | ||
56kDa-10F | 201–220 | TATGAGCTAACCCTGCACCA | 56kDa-10R | 331–350 | GTAGCTGCAAGAAGGRCGAT | ||
56kDa-11F | 301–320 | AAACTCTGTTTCTTTGCTTW | 56kDa-11R | 431–450 | TTGAAGCGTCATGCAGGATT | ||
56kDa-12F | 401–420 | TGAGCAGCTAATTTMTCCAT | 56kDa-12R | 631–650 | YTTTTGAKGGGTATATTRGT | ||
56kDa-13F | 601–620 | GACAAAATTCAACTGTATCT | 56kDa-13R | 731–750 | CCTAATRSTGCTTTGCCTAA | ||
56kDa-14F | 701–720 | ATCTGTTCGACAGATGCACT | 56kDa-14R | 831–850 | AATAAACCTAGCGATCCTCC | ||
56kDa-15F | 801–820 | TATCACTTAATACTTTGACA | 56kDa-15R | 931–950 | ATCCTGCTGGAAATCCACCG | ||
56kDa-16F | 901–920 | CGCAAAATCTGCAGGCTGAT | 56kDa-16R | 1031–1050 | AATTGTGCTGGTATTGACTA | ||
56kDa-17F | 1001–1020 | CCATTAGGATTATTAGGATC | 56kDa-17R | 1131–1150 | TTGCGGTTGATATTCCTAAC | ||
56kDa-18F | 1101–1120 | GATTTGCAGCTTGCGCTTGC | 56kDa-18R | 1231–1250 | ATTCTGGAGGTGGGACAGAT | ||
56kDa-19F | 1201–1220 | AAGTTTAAACCGCTTACGTA | 56kDa-19R | 1331–1350 | CCATGGCTTAGAGCAGAGCT | ||
56kDa-20F | 1301–1320 | GCGCTTATATTTCTAAGGTA | 56kDa-20R | 1431–1450 | TGCTCGCTTGGATCAAGCTG | ||
56kDa-21F | 1401–1420 | TGTACCACCAAATGGCATCG | 56kDa-21R | 1531–1550 | GATGAAGGAGGATTAGAGTG | ||
56kDa-22F | 1501–1520 | CCGACAACTCCAACTTTAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cho, S.; Allison, J.C.; Park, K.; No, J.S.; Lee, S.-H.; Park, K.; Kim, J.; Klein, T.A.; Kim, H.-C.; Kim, W.-K.; et al. A Clinical Case of Scrub Typhus in the United States Forces Korea Patient with Eschar and Genetic Identification of Orientia tsutsugamushi Using Multiplex PCR-Based Next-Generation Sequencing. Pathogens 2021, 10, 424. https://doi.org/10.3390/pathogens10040424
Cho S, Allison JC, Park K, No JS, Lee S-H, Park K, Kim J, Klein TA, Kim H-C, Kim W-K, et al. A Clinical Case of Scrub Typhus in the United States Forces Korea Patient with Eschar and Genetic Identification of Orientia tsutsugamushi Using Multiplex PCR-Based Next-Generation Sequencing. Pathogens. 2021; 10(4):424. https://doi.org/10.3390/pathogens10040424
Chicago/Turabian StyleCho, Seungchan, Jon C. Allison, Kkothanahreum Park, Jin Sun No, Seung-Ho Lee, Kyungmin Park, Jongwoo Kim, Terry A. Klein, Heung-Chul Kim, Won-Keun Kim, and et al. 2021. "A Clinical Case of Scrub Typhus in the United States Forces Korea Patient with Eschar and Genetic Identification of Orientia tsutsugamushi Using Multiplex PCR-Based Next-Generation Sequencing" Pathogens 10, no. 4: 424. https://doi.org/10.3390/pathogens10040424