Next Article in Journal
Antibiotic Susceptibility of Bartonella Grown in Different Culture Conditions
Next Article in Special Issue
Rickettsia lusitaniae in Ornithodoros Porcinus Ticks, Zambia
Previous Article in Journal
Genetic Listeria monocytogenes Types in the Pork Processing Plant Environment: From Occasional Introduction to Plausible Persistence in Harborage Sites
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 10
Issue 6
10.3390/pathogens10060714
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Occurrence and Genetic Diversity of Babesia caballi and Theileria equi in Chilean Thoroughbred Racing Horses

by
Reinaldo Torres
1,
Claudio Hurtado
1,
Sandra Pérez-Macchi
2,
Pedro Bittencourt
3,
Carla Freschi
4,
Victoria Valente Califre de Mello
5,
Rosangela Zacarias Machado
5,
Marcos Rogério André
5 and
Ananda Müller
1,3,*
1
Instituto de Ciencias Clinicas Veterinarias, Facultad de Ciencias Veterinarias, Universidad Austral de Chile, Valdivia 5090000, Chile
2
Departamento de Patologia Clinica Veterinaria, Facultad de Ciencias Veterinarias, Universidad Nacional de Asunción, San Lorenzo 1114, Paraguay
3
Biomedical Sciences Department, Ross University School of Veterinary Medicine, Basseterre, Saint Kitts and Nevis
4
IMUNODOT Diagnostico, Jaboticabal 14887-042, SP, Brazil
5
Departamento de Patologia, Reproducao e Saude Unica, Faculdade de Ciencias Agrarias e Veterinarias, Universidade Estadual Paulista, (FCAV/UNESP), Jaboticabal 14884-900, SP, Brazil
*
Author to whom correspondence should be addressed.
Pathogens 2021, 10(6), 714; https://doi.org/10.3390/pathogens10060714
Submission received: 9 May 2021 / Revised: 2 June 2021 / Accepted: 4 June 2021 / Published: 7 June 2021
(This article belongs to the Special Issue Advances in the Epidemiological Surveillance of Tick-Borne Pathogens)
Browse Figures
Versions Notes

Abstract

:
This study aimed to serologically and molecularly survey Babesia caballi and Theileria equi in thoroughbred horses from racecourses in Chile. Additionally, the genetic diversity of the positive samples was assessed. A total of 286 thoroughbred horses from the Santiago and Valparaíso racecourses had their serum samples submitted to an ELISA for B. caballi and T. equi, and 457 samples (from the Santiago, Valparaíso, and Concepción racecourses) were tested with nested PCRs for the B. caballi 48 KDa rhoptry protein (RAP-1) and T. equi 18S rRNA genes. Selected RAP-1 and 18S positive products were sequenced to perform phylogenetic and haplotype analyses. An overall seroprevalence of 35.6% was observed for these Chilean racecourses: 23.7% for T. equi, 8.4% for B. caballi, and 3.5% for both agents. Overall, a 53.6% occurrence by nPCR was detected for the three Chilean racecourses: 44.2% for T. equi, 5.4% for B. caballi, and 3.9% for both agents. Phylogenetic analysis of T. equi and B. caballi showed genetic proximity with sequences previously detected in other countries. Haplotype analysis revealed a low diversity among the Chilean sequences, which may have originated from those reported in Brazil, Israel, or Cuba. Babesia caballi and T. equi were detected for the first time in Chilean thoroughbred horses.

1. Introduction

Equine babesiosis and theileriosis, together known as equine piroplasmosis (EP), are two tick-borne diseases caused by the protozoans Babesia caballi and Theileria equi (Apicomplexa: Piroplasmida) [1], which belong to the Babesiidae and Theileriidae families, respectively [2]. EP has high morbidity and mortality rates and is, therefore, a serious concern in the equine industry [3]. Babesia caballi and T. equi are transmitted by ticks (biological vectors), and frequently co-infect horses [4,5,6,7]. Although transmission via the placenta from pregnant mares to fetuses has been described, this route is of little epidemiological significance for EP, and is considered rare, especially for B. caballi [8,9,10,11]. Additionally, B. caballi and T. equi can be transmitted mechanically or iatrogenically via contaminated needles and syringes, blood transfusions, and surgical instruments [9].
Both B. caballi and T. equi infections can be subclinical to severe acute diseases, and symptoms are often variable and non-specific in horses [5,12]. In general, infection with T. equi causes a more severe clinical disease than infection with B. caballi [13]. Although acute, sub-acute, and chronic forms of EP have been described, the most common condition in horses is the carrier state [12,14]. While chronically infected animals present with vague clinical signs, such as reduced exercise tolerance, carriers have extremely low or undetectable circulating parasites [15], carriers have no clinical signs [14], and act as reservoirs to the pathogen; therefore, diagnosing, controlling, and eradicating the disease can be very challenging [5,6,7]. More severe symptoms include systemic inflammatory response syndrome, increased vascular permeability, and disseminated intravascular coagulation, resulting in ischemia, anoxia, and multi-organ systemic dysfunction [6,7]. Hematological abnormalities caused by intravascular and extravascular hemolysis, microvascular stasis, and alterations in coagulation [5,6,7,12,16] are also common. Many horses become anemic, with a lower packed cell volume (PCV), hemoglobin and erythrocytes counts [5,6,7,12,17].
Serological tests are used as an indirect diagnostic method to detect antibodies raised against EP agents. The World Organization for Animal Health (OIE) recommends the use of immunofluorescence antibody tests (IFA) and complement-enzyme linked immunosorbent assays (ELISA) for diagnosing the disease [4,7,18]. However, serological assays have limited sensitivity and specificity; therefore, current diagnostic methods are based on molecular techniques, such as Polymerase Chain Reaction (PCR). PCR helps identify asymptomatic carriers, because it can detect parasitemias as low as 0.000006% and 0.017% for B. caballi and T. equi, respectively [4,6,19].
The global EP prevalence is consistent with the distribution of tick vectors and can vary widely among populations and geographical regions [15]. EP is endemic across almost all of Latin America, including the Caribbean countries, Central America, and South America, with the exception of the southern regions of Chile and Argentina [6,20,21,22,23,24]. The serological prevalence of B. caballi and T. equi in the Americas ranges from 5.5 to 69.2% and 14 to 88.5%, respectively [4,24,25,26,27,28,29,30], while the molecular prevalence of B. caballi and T. equi ranges from 4.4 to 60% and 24.4 to 85.7%, respectively [21,22,23,24,29].
Subclinical EP is present in Chile [31]; however, limited information on infection prevalence is available, even though the reporting of cases is mandatory. Most reports on piroplasmosis in Chile have relied on serosurveys, and have shown prevalence rates from 0 to 96% for T. equi and 0 to 2% for B. caballi [20,32,33,34]. Additionally, T. equi (19%) and B. caballi (1.2%) have been molecularly detected in 77 horses in the Metropolitan region [35].
The first Chilean racecourse was built in 1870, and today there are five in total, serving a population of 1600 horses. At present, there is no information regarding the circulation of B. caballi or T. equi DNA in Chilean racehorses [36]. We investigated the serological and molecular occurrence of these pathogens, and analyzed their phylogenetic and haplotype characteristics, in thoroughbred horses from racecourses in Concepción, Santiago, and Valparaíso.

2. Results

2.1. ELISA Assessment of the Serological Occurrence of Piroplasmids

According to the ELISA results, 102 out of 286 (35.6% [95% CI: 30.6–40.6%]) horses from Chilean racecourses were seropositive. From those, 8.3% [95% CI: 5.4–12.2%] were positive for B. caballi, 23.7% [95% CI: 18.9–29.1%] for T. equi, and 3.5% [95% CI: 5.6–1.5%] for both. In Santiago and Valparaíso, 19 out of 150 (12.6% [95% CI: 7.8–19%]) and 5 out of 136 (3.6%, 95% [CI: 1.2–8.3%]) of the horses were seropositive for B. caballi, and 63 out of 150 (42%, 95% [CI: 34–50%]) and 5 out of 136 (3.6%, 95% [CI: 1.2–8.3%]) for T. equi, respectively (Table 1).

2.2. Nested PCR Assay Assessment of the Molecular Occurrence of Piroplasmids

All 457 tested DNA samples (mean (×) and standard deviation (SD) of DNA concentration = 26.5 ± 16.5 ng/µL; mean and SD 260/280 ratio = 1.87 ± 0.4) were positive for the ACTB reference gene, and there was no amplification of negative controls. According to the nPCR assays, 245 out of 457 (53.6%, 95% [CI: 49.6–56.6%]) horses were positive for piroplasmids. Of these, 202 out of 457 (44.2%, 95% [CI: 39.5–48.8%]) were positive for T. equi, 25 out 457 (5.4%, 95% [CI: 3.5–7.9]) for B. caballi, and 18 out of 457 (3.9%, 95% [CI: 2.3–6.1%]) were positive for both EP agents (T. equi + B. caballi). The nPCR analysis showed that in Concepción, Santiago, and Valparaíso, 126 out of 167 (75.4%, 95% [CI: 68.2–81.7%]), 32 out of 151 (21.1%, 95% [CI: 15.1–27.1%]), and 44 out of 139 (31.6%, 95% [CI: 24.0–40.1%]) of the horses were positive for T. equi, respectively; 21 out of 167 (12.5%, 95% [CI: 7.9–18.6%]), 0 out 151 (0%), and 4 out 139 (2.8%, 95% [0.8–7.2%]) were positive for B. caballi, respectively; and 17 out of 167 (10.1%, 95% [6.0–15.8%]), 0 out 151 (0%), and 1 out of 139 (0.7%, 95% [CI: 0.02–3.9%]) were positive for both agents, respectively (Table 1).

2.3. Phylogenetic and Haplotype Analyses

Out of the 202 positive samples for T. equi that were tested by targeting the complete 18S rRNA gene (1600 bp) [37], 10 amplicons that had good band quality in agarose gel were selected and submitted for sequencing (gene bank accession numbers: MT463604-MT463613) and maximum likelihood analyses (ML). These sequences, when analyzed by BLASTn (using default parameters), showed a shared identity ranging from 99% to 100% with T. equi sequences previously detected from equids in Israel (MN611352.1), Brazil (MG052898.1), Turkey (MG569905.1), and the Philippines (KX900447.1). Among the 25 positive samples for B. caballi, only one sample (MT521699) could be sequenced using the 48 KDa rhoptry protein gene protocol [38], and submitted for Bayesian analyses. The BLASTn analyses (using default parameters) revealed that this sequence shared 99% to 100% identity with B. caballi amplified from equine blood samples from the Philippines (KX900447.1), Egypt (KR811095.1), Mongolia (AB703053.1), and Cuba (KY111765.2). All sequences amplified in the present study showed query coverage ranging from 99% to 100%, and an E-value of 0.
While the maximum likelihood analysis of T. equi showed four clusters in the phylogenetic tree, the T. equi sequences (n = 10) detected in this study were all positioned in cluster #3 (Figure 1). The Chilean sequences formed a cluster with each other and with sequences found in Israel, Brazil, and Cuba (Figure 1). Bayesian analysis of B. caballi formed six clusters, and the sequence detected in this study was closely positioned to sequences previously detected in horses from Egypt and Mongolia (cluster #2) (Figure 2).
Out of 35 T. equi 18S rRNA sequences used for the haplotype analysis (10 from horses in this study and 25 from horses worldwide), 17 different haplotypes were detected, with a haplotype diversity of 0.934 ± 0.021 and a nucleotide diversity of 0.02186 ± 0.00196 (Table 2). Four haplotypes were detected in horses from this study, which originated from those previously detected in Brazil and Israel (haplotype #4), separated from them by a few mutational events. Haplotypes #6, #16, and #17 from Chile originated from the same haplotype, also from Chile (#1). Out of the four T. equi haplotypes detected in Chile, two were exclusive to this country, and the other two have also been previously found in Brazil, Cuba, and Israel (Figure 3).
On the other hand, 17 B. caballi sequences (one from this study) were used for haplotype analysis, resulting in 14 different haplotypes, showing a haplotype diversity of 0.971 ± 0.032 and a nucleotide diversity of 0.21122 ± 0.082 (Table 2). The only B. caballi haplotype detected in Chile (#2) has also previously been found in Egypt and Mongolia (Figure 4). The haplotype from Chile originated from one previously detected in Cuba (haplotype #3), after one mutational event.

3. Discussion

While, in South America, B. caballi and T. equi DNA has been detected in horses from Brazil [28,29] and Venezuela [24], B. caballi and T. equi have only been molecularly reported in Chile in one study with a small sample of horses (n = 77) from the Metropolitan region [34]. To the best of our knowledge, this is the first molecular survey of B. caballi and T. equi in racehorses from Chile, as well the first assessment of piroplasmid haplotypes in horses from this country.
The overall molecular occurrence for EP agents obtained in thoroughbred horses from Chilean racecourses (B. caballi [5.4%], T. equi [44.2%], co-infection [3.9%]) was lower than previously described in South America (B. caballi [23.5%], T. equi [84.3%], co-infection [22%]) [40,41]. As a global trend [9], T. equi is more prevalent than B. caballi, whereas co-infection is less frequent. The higher prevalence of T. equi when compared to B. caballi is in accordance with the findings of other authors [42,43,44], which can be attributed to the lifelong persistence of T. equi infection, compared with the effective elimination of B. caballi [6,45].
Interestingly, the Club Hípico de Concepción had a higher molecular prevalence of these agents (B. caballi [12.5%], T. equi [75.4%], co-infection [10.1%]) than the other two Chilean racecourses. This racecourse showed a similar occurrence of EP to that found in research in Cuba (B. caballi [25%], T. equi [73%], co-infection [20%]) (Díaz-Sánchez et al., 2018), Mongolia (B. caballi [1%], T. equi [92.7%], co-infection [1.2%]) [46], and Spain (B. caballi [29.4%], T. equi [66%], co-infection [22.6%]) [47]. The higher occurrence of equine piroplasmids in the Club Hípico de Concepción might be related to an infection cluster caused by the management of horses (favoring transmission) and their origin (favoring the introduction of asymptomatic carriers), resulting in high numbers of asymptomatic animals [48]. It is recommended that this racecourse investigate its management of horses, the presence of ectoparasites, contaminated fomites, and environmental conditions.
The overall seroprevalence of B. caballi (8.4%), T. equi (23.7%), and co-exposure (3.5%) found in this research was higher than that in a previous study from Chilean racecourses (B. caballi [0%], T. equi [1.2–43.9%], co-infection [0%]) [49], but lower than those described in Pakistan (B. caballi [21.6%] and T. equi [41.2%]) [50], Spain (B. caballi [11.4%) and T. equi [50.3%]) [51], Italy (B. caballi [12.4%] and T. equi [17.9%]) [52], France (B. caballi [12.9%] and T. equi [50.0%]) [53], Trinidad and Tobago (B. caballi [68.8%] and T. equi [33.3%]) [25], Brazil (B. caballi [69.2%] and T. equi [78.3%]) [54], and Costa Rica (B. caballi [69.9%] and T. equi (88.5%]).
Variations in worldwide prevalences are associated with infection status, sampling differences, the distribution of vectors, and the tests used to evaluate infection (serological methods vs. conventional PCR vs. real-time PCR) [23,55,56,57]. Moreover, worldwide serological prevalence might underestimate a novel species of Theileria, detected in horses from the USA. The recently described piroplasmid T. haneyi [58] is undetectable using current surveillance tools that target EMA-1 of the immunodominant EMA superfamily, such as the ELISA used in our study. Here, we used EMA-1 ELISA; however, previous serosurveys in thoroughbred horses from Chile have been based on Agar Gel Immunodiffusion Assay (AGID), complement fixation test (CFT), and indirect immunofluorescence antibody test (IFA) [20,32,33,35], which make specific comparisons between prevalence rates difficult.
We observed a higher seroprevalence at the Club Hípico de Santiago racecourse (B. caballi [12.6%] and T. equi [42.0%] and co-exposure [6.0%]) compared to the Valparaíso Sporting Club (B. caballi [3.6%] and T. equi [3.7%] and co-exposure [0.7%]); however, PCR testing showed higher prevalences of infection in Valparaíso Sporting Club. Higher exposure to piroplasmids detected by the ELISA at the Club Hípico de Santiago racecourse could be due to the higher density of horses in that racetrack when compared to Valparaiso [59,60]; however, this finding might also reflect the different stages of the disease (infection vs. exposure), measured via different tests (namely, PCR and ELISA) [23,49,55,56].
We did not observe any relationship between serology and positive PCRs, reflecting the different stages of the EP disease and the characteristics of each methodology. PCR is the best technique for diagnosing animals during acute infections, when there are no detectable levels of antibodies. It is sensitive to the detection of the DNA of the parasite in early stages of the infection, being also able to detect carrier animals [9]. On the other hand, ELISA will detect antibodies, and is therefore a good test for chronic infections [7,9,23,28,55,56].
Preliminary studies of the 18S rRNA gene allowed for the detection of five T. equi groups, named A to E [9,61], of which four were detected in this work [9,37]. All T. equi samples from Chile belonged to a single group based on 18S rRNA gene sequences, and were assigned to Group A from Bhoora et al. (2009) [37]. In contrast, previous studies have shown higher genetic diversity within 18S rRNA sequences from T. equi in horses from Brazil [29], Jordan [62], South Africa [37], and Switzerland. A low diversity within T. equi sequences from Chile could be related to the history of horses’ arrival in the country, and the equid business movement trends [63]. Consistent with the above, although Chile has one of the most prestigious racecourses in Latin America [60], it is a minor participant in the global equine industry, and engages in less movement of horses [64], which in turn might have contributed to the low T. equi genetic diversity observed in the present study. Moreover, although Ixodidae ticks are present in Chile [65], we did not find ticks parasitizing the horses sampled in this study.
The B. caballi phylogenetic analysis divided the sequences into four genotypes, in agreement with previous studies [55,66]. Even though the Chilean sequence belonged to the same group as sequences from Cuba, Egypt, and Mongolia, further studies are needed to determine the genetic variations between B. caballi isolates from Chile.
Herein, both T. equi and B. caballi haplotypes presented genetic proximity with sequences previously detected in other countries. Interestingly, the sequences detected in Chile might have originated from those reported in Brazil, Israel, or Cuba. Indeed, they were separated from each other by a few mutational events, which might indicate a close epidemiological link among isolates [67]. These findings also pointed out that the genetic diversity of equine piroplasmids is not geographically delimited [55]. Finally, the haplotype analysis of our sequences with others around the world showed a high level of genetic diversity in B. caballi (Hd: 0.971 ± 0.032) and T. equi (Hd: 0.934 ± 0.02) haplotypes, which have been observed worldwide [7,68,69]. This can be explained by the biphasic modes of piroplasmid reproduction (sexual and asexual), and the intensity of transmission, influenced principally in our country by mechanical or iatrogenic transmission via contaminated needles and syringes, blood transfusion, and surgical instruments [9]. Furthermore, comparison of 18S rDNA sequences classified as T. equi from multiple locations worldwide indicates greater genetic diversity than expected within a single species. This suggests that multiple taxa are likely to be involved, including additional, so far undescribed and novel species, as was the case for T. haneyi [58].

4. Materials and Methods

4.1. Animals and Areas of Study

This study was approved by the Universidad Austral de Chile (UACh) bioethics committee under UACh 238/2015. To accurately determine the occurrence of B. caballi and T. equi at the Concepción, Santiago, and Valparaíso racecourses, the required sample size was estimated according to Thrusfield (2007) [70]. The estimated prevalence was 10%, based on a preliminary study in Chile carried out by Vargas et al. (2004), with a precision of 5% and a 95% confidence interval. The minimal sample required was 139 horses from each racecourse. Each owner signed a consent form before the horses’ blood samples were taken.
Over 12 months (February 2015 to February 2016), 457 thoroughbred horses had their blood sampled by a veterinary team. One hundred and fifty-one horses came from the “Club Hípico de Santiago” racecourse (Santiago City, Central Chile: 33°27′00″ S, 70°40′00″ W), 139 horses from the “Valparaíso Sporting Club” (Viña del Mar City, Central Chile: 33°0′0″ S, 71°31′0″ W), and 167 from “Club Hípico de Concepción” racecourse (Concepción City, South-Central Chile: 36° 50′00″ S, 73°03′00″ W) (Figure 5).
Blood samples (10 mL) were aseptically taken from all 457 horses via jugular venipuncture, regardless of age, gender, health, and reproductive status, and were placed into EDTA tubes for molecular analyses and serum tubes for Competitive Enzyme-Linked Immunosorbent Assay (ELISA). Samples were kept in a refrigerator box (4 °C) during transport to the UACh Veterinary Clinical Pathology Laboratory. The serum was separated, and serum and whole blood EDTA were stored at –20 °C until serological and molecular analyses were performed.

4.2. ELISA for Babesia caballi and Theileria equi

A total of 150 and 136 thoroughbred horses from Santiago and Valparaíso racecourses, respectively, had their serum samples submitted for ELISA. Horses from the Concepción racecourse were not tested using ELISA as serum samples were not available. Detection of antibodies against B. caballi and T. equi by ELISA was performed using recombinant proteins RAP-1 and EMA-1, respectively, according to the manufacturer’s instructions [28,29,30].
OD values were read at 405 nm using an ELISA reader (Dynex Technologies, Chantilly, VA, USA). Serum samples of previously positive and negative horses were used as controls for the ELISA assays [71]. For the sera tested by ELISA, the immunological activity of each serum, the cutoff values, and the ELISA levels (EL) were calculated as described by Machado et al. (2012) [71]. The immunological activity of each serum was calculated by determining the sample to positive serum ratio (S/P), considering positive and negative sera as a reference, using the following equation: S/P = (mean sample absorbance − mean absorbance of negative serum reference)/(mean absorbance of positive reference serum − mean absorbance of negative serum reference). Cutoff values (0.334 and 0.327 for T. equi and B. caballi, respectively) were 2.5 times the mean absorbance value of the negative controls. The readings above the cutoff value were considered positive, according to Machado et al. [72].

4.3. DNA Extraction/Purification

DNA extraction and purification from 200 µL of each horse’s blood sample were performed using an “E.Z.N.A. Tissue DNA Kit” (E.Z.N.A. Omega BioTek®, Norcross, GA, USA), according to the manufacturer’s instructions, to obtain 50 µL of purified DNA. DNA concentration and purity were determined (NanoDrop ND-1000 spectrophotometer; Thermo Scientific©, Waltham, MA, USA). The absorbance ratio (OD260 nm/OD280 nm) provided an estimate of sample purity, accepting a ratio of 1.8 ± 0.2 as "pure". DNA was stored at −20 °C before performing the PCR assays.

4.4. Nested (n) PCR Assays

4.4.1. Endogenous Gene

A PCR for the Equus caballus endogenous gene beta-actin protein (ACTB) [73] was performed to check the integrity of the DNA template obtained from blood, as previously described [74] (Table 1).

4.4.2. Piroplasmids PCR DNA Controls

The positive control for B. caballi was generated by gBlock® (Integrated DNA Technologies©, Coralville, IA, USA), using sequences obtained from the GenBank genetic database from different B. caballi RAP-1 gene sequences (KR811095.1, AB017700.1, AF092736.1, KR811097.1, EU669865.1, KR811096.1, KX900447.1, KX900446.1, AB703050.1, KY111765.2). Theileria equi genomic DNA was obtained from a naturally infected horses from Brazil [29]. Nuclease-free water (Thermo Scientific©, Waltham, MA, USA) was used as a negative control in all PCR reactions.

4.4.3. Nested PCR for Babesia caballi

All 457 samples were tested by the previously described [38] nested (n)PCR for the 48 KDa rhoptry protein gene (RAP-1), specifically for B. caballi. While external BC48F1 and BC48R3 primers (530 bp) were used for the first amplification reaction, internal primers BC48F11 and BC48R31 (430 bp) were used in the second reaction PCR (Table 3). The reaction mixture was composed of 12.5 μL Gotaq® Green Master Mix (Promega®, Madison, WI, USA), 200 nM of each primer (BC48F1 and BC48R3), and 5 µL of DNA template, brought to a total volume of 25 µL with nuclease-free water (Thermo Scientific©, Waltham, MA, USA). For the preliminary round of amplification, the thermal cycling protocol was as follows: initial denaturation at 94 °C for 5 min, 30 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 5 min. The same conditions were used for the second round of amplification, except for the set of primers (BC48F11 and BC48R31), using 5 µL of the DNA product from the primary reaction as a DNA template for the nested cPCR for B. caballi.

4.4.4. Nested PCR for Theileria equi

All 457 samples were tested via the previously described nested nPCR protocol [23] to amplify a partial region of the T. equi 18S rRNA gene. A set of external primers (BallF and BallR (814 bp)) and internal primers (BeqF1 and BeqR1 (709 bp)) were used (Table 3). The reaction mixture was composed of 12.5 μL of Gotaq® Green Master Mix (Promega®, Madison, WI, USA), 300 nM of each primer (BallF and BallR), and 5 µL of DNA template, brought to a total volume of 25 µL with nuclease-free water (Thermo Scientific©, Waltham, MA, USA). For the primary round of amplification, the thermal cycling protocol was as follows: initial denaturation at 94 °C for 5 min, 30 cycles at 94 °C for 30 s, 57 °C for 30 s and 72 °C for 1 min, with a final extension at 72 °C for 5 min. The same conditions were used for the second round of amplification, except the set of primers (BeqF1 and BeqR1), using 5 µL of the DNA product from the primary reaction as a DNA template for the nested cPCR of T. equi.
All the PCR reactions were performed in a T100 TM Thermal Cycler (Bio-Rad, Hercules, CA, USA). The PCR products were separated via electrophoresis on a 2% agarose gel (LE Agarose Seakem®, Lonza, Morristown, NJ, USA) stained with SYBR© Safe DNA gel stain (Thermo Scientific©, Waltham, MA, USA). DNA extraction/purification, cPCR amplification, and electrophoresis were performed in three separate rooms to avoid cross-contamination. The primers used in this study are shown in Table 3.

4.4.5. Molecular Characterization of the Babesia caballi and Theileria equi Agents

Selected positive B. caballi samples presenting strong band intensity in the RAP-1 gene were submitted for sequencing. Additionally, B. caballi and T. equi positive samples with strong band intensity were further tested by targeting the complete 18S rRNA gene (1600 bp), as previously described by Bhoora et al. (2009) [37], for sequencing and molecular characterization (Table 3). Primers NBabesia1F and 18SRev-TB were used in a primary PCR to amplify a fragment of ~1600 bp. The reaction mixture was composed of 12.5 µL Gotaq® Green Master Mix (Promega®, Madison, WI, USA), 200 nM of each primer, and 5 µL of template DNA, brought to a total volume of 25 µL with nuclease-free water (Thermo Scientific©, Waltham, MA, USA). The thermal cycling protocol was as follows: 94 °C for 2 min, followed by 40 cycles at 94 °C for 30 s, 60 °C for 45 s, and 72 °C for 1 min. Amplification was completed with a final extension of 72 °C for 7 min.
Three nested PCRs were subsequently performed. The primers NBabesia1F and BT18S3R were used to amplify an 800 bp PCR product at the 5´-end of the gene. The amplification program was the same as that employed for the first PCR, except that an annealing step of 58 °C for 1 min was used. The amplification of the 3´-end of the 18S rRNA gene was accomplished using primers BT18S3F and 18SRev-TB, with an annealing step of 55 °C for 1 min. An internal 800 bp product, which overlapped both the 5’ and 3’ fragments by 400 bp, was amplified using primers BT18S2F and BT18S2R and an annealing step of 55 °C for 1 min.

4.4.6. Sequencing, Phylogenetic, and Haplotype Analyses

The PCR products (RAP -1 and 18S rRNA genes) were purified with a commercial Silica Bead DNA Gel Extraction Kit (Thermo Scientific®, Waltham, MA, USA), following the manufacturer’s instructions, and sent to Macrogen® (Seoul, Korea) for sequencing by the Sanger method in both directions [75]. The nucleotide sequences obtained were analyzed in Bioedit v. 7.0.5.3 (Carlsbad, CA, USA), and consensus sequences were obtained from both the forward and the reverse oligonucleotides. The BLASTn analysis tool was used to compare sequences in the FASTA format with others previously deposited in the GenBank database [76]. Sequences were aligned using MAFFT software [77].
The alignments saved in FASTA mode were transformed into Nexus and Phylip by the Alignment Transformation Environment site, to perform Bayesian analysis using the software MrBayes 3.2.2 in the XSEDE [78] and the maximum likelihood analysis, using the cluster BlackBox RaxML BlackBox 7.6.3 [79], both via the CIPRES portal [80]. Bayesian analysis was performed with 106 generations, with varying numbers of substitution classes according to the evolutionary model found for each dataset and a burn-in = 25%. The bootstrap was accessed with 1000 replicates, and the evolutionary model was based on the Akaike Information Criterion (AIC) using the jModelTest2 software (version 2.1.6) on XSEDE [81]. Phylogenetic tree editing and rooting (via external group) were performed using the Treegraph software 2.0.56-381 beta [82].
Polymorphism nucleotide analysis of 18S rRNA and RAP-1gene sequences was performed using DnaSP v5 [83]. Haplotype diversity (Hd), number of haplotypes (n), and nucleotide diversity (Pi) were analyzed to explore genetic differentiation among the sampled horses. Subsequently, the sequences used in the phylogeny (from Chile and others previously deposited in GenBank) were aligned by the BioEdit Sequence Alignment Editor software [84]. The alignment was re-opened in the DnaSP version 5.10.1 software to group the sequences according to their location and saved in the NEXUS format. Then, the sequences were submitted to the analysis of the TCS network [39], which was inferred using the Population Analysis with Reticulate Trees (popART) program [85].

4.4.7. Data Analysis

To determine the overall EP agent’s occurrence in racecourses from Chile, the ELISA-positive and the PCR-positive horses were divided by the total number of animals and multiplied by 100. The observed occurrence was expressed in percentages, and the 95% IC was calculated. The occurrence was also calculated per racecourse (Concepción, Santiago, and Viña del Mar).

5. Conclusions

This is the first molecular and serological survey and genetic assessment of piroplasmids in Chilean Thoroughbred horses. Both Babesia caballi and Theileria equi circulate in the three leading racecourses from Chile, highlighting the impact of the pathogens on the equine industry. Our phylogenetic and haplotype analysis showed a low diversity of Chilean samples compared to the high genetic variability of piroplasmids in horses globally. The sequences we detected in Chile may have originated from Brazil, Israel, or Cuba. Further studies are needed to identify the significant vectors and routes of transmission of the pathogens in this country.

Author Contributions

Conceptualization, A.M., R.Z.M. and M.R.A.; Methodology, R.T., C.H., S.P.-M., C.F. and V.V.C.d.M.; Formal analysis, R.T., C.H., C.F. and S.P.-M.; Investigation, A.M., M.R.A., P.B. and R.Z.M.; Resources, A.M., M.R.A. and R.Z.M.; Data curation, R.T. and V.V.C.d.M.; writing—original draft preparation, R.T. and A.M.; writing—review and editing, P.B., R.Z.M., M.R.A., V.V.C.d.M., S.P.-M., C.F. and C.H.; visualization, A.M. and M.R.A.; supervision, A.M., M.R.A. and R.Z.M.; project administration A.M., M.R.A.; funding acquisition, A.M., M.R.A. and R.Z.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received financial support from Magister en Ciencias Mención Salud Animal, Universidad Austral de Chile. We would also like to thank the One Health Center for Zoonoses and Tropical Veterinary Medicine of Ross University School of Veterinary Medicine for their financial support for open access publication.

Institutional Review Board Statement

The study was approved by the Universidad Austral de Chile (UACh) bioethics committee (UACh 238/2015).

Informed Consent Statement

Informed consent was obtained from each owner before the horses’ blood samples were taken.

Data Availability Statement

The data supporting the findings of this study are included within this article. Raw datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request. Representative sequences were submitted to the GenBank database under the accession numbers: MT463604-MT463613; MT521699.

Acknowledgments

The authors are thankful to IMMUNODOT Diagnosticos (Jaboticabal, SP, Brasil). MRA and RZM are fellowship researchers of “Conselho Nacional de Desenvolvimento Científico e Tecnólogico” (CNPq Process number #302420/2017-7 and #306326/2014-0, respectively).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Brüning, A. Equine piroplasmosis an update on diagnosis, treatment and prevention. Br. Vet. J. 1996, 152, 139–151. [Google Scholar] [CrossRef]
  2. Mehlhorn, H.; Schein, E. Redescription of Babesia equi Laveran, 1901 as Theileria equi Mehlhorn, Schein 1998. Parasitol. Res. 1998, 84, 467–475. [Google Scholar] [CrossRef]
  3. Wise, L.N.; Knowles, D.P.; Rothschild, C.M. Piroplasmosis, 2nd ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2013; ISBN 9781455708918. [Google Scholar]
  4. Ferreira, E.P.; Vidotto, O.; Almeida, J.C.; Ribeiro, L.P.S.; Borges, M.V.; Pequeno, W.H.C.; Stipp, D.T.; de Oliveira, C.J.B.; Biondo, A.W.; Vieira, T.S.W.J.; et al. Serological and molecular detection of Theileria equi in sport horses of northeastern Brazil. Comp. Immunol. Microbiol. Infect. Dis. 2016, 47, 72–76. [Google Scholar] [CrossRef]
  5. Georges, K.C.; Ezeokoli, C.D.; Sparagano, O.; Pargass, I.; Campbell, M.; D’Abadie, R.; Yabsley, M.J. A case of transplacental transmission of Theileria equi in a foal in Trinidad. Vet. Parasitol. 2011, 175, 363–366. [Google Scholar] [CrossRef]
  6. Rothschild, C.M. Equine piroplasmosis. J. Equine Vet. Sci. 2013, 33, 497–508. [Google Scholar] [CrossRef]
  7. Wise, L.N.; Pelzel-McCluskey, A.M.; Mealey, R.H.; Knowles, D.P. Equine Piroplasmosis. AAEP 2014, 56, 1–7. [Google Scholar] [CrossRef]
  8. Allsopp, M.T.E.P.; Lewis, B.D.; Penzhorn, B.L. Molecular evidence for transplacental transmission of Theileria equi from carrier mares to their apparently healthy foals. Vet. Parasitol. 2007, 148, 130–136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Onyiche, T.E.; Suganuma, K.; Igarashi, I.; Yokoyama, N. A Review on Equine Piroplasmosis: Epidemiology, Vector Ecology, Risk Factors, Host Immunity, Diagnosis and Control. Int. J. Environ. Res. Public Health 2019, 16, 1736. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Sant, C.; Pargass, I.; Basu, A.; Asgarali, Z.; Georges, K. Investigating Transplacental Transmission of Equine Piroplasmosis in Thoroughbred Foals in Trinidad. J. Equine Vet. Sci. 2016, 39, S98–S99. [Google Scholar] [CrossRef]
  11. Francoso, R.; Riccio, A.V.; Fernandes, B.; Alonso, M.A.; Belli, C.B. Highlights SC. Transplacental transmission of Theileria equi in mules: Should we worry? Vet. Parasitol. 2018, 264, 39–41. [Google Scholar] [CrossRef]
  12. Zobba, R.; Ardu, M.; Niccolini, S.; Chessa, B.; Manna, L.; Cocco, R.; Pinna Parpaglia, M.L. Clinical and Laboratory Findings in Equine Piroplasmosis. J. Equine Vet. Sci. 2008, 28, 301–308. [Google Scholar] [CrossRef]
  13. Wise, L.N.; Kappmeyer, L.S.; Mealey, R.H.; Knowles, D.P. Review of Equine Piroplasmosis. J. Vet. Intern. Med. 2013, 27, 1334–1346. [Google Scholar] [CrossRef]
  14. Sevinc, F.; Maden, M.; Kumas, C.; Sevinc, M.; Ekici, O.D. A comparative study on the prevalence of Theileria equi and Babesia caballi infections in horse sub-populations in Turkey. Vet. Parasitol. 2008, 156, 173–177. [Google Scholar] [CrossRef]
  15. Ogunremi, O.; Halbert, G.; Mainar-Jaime, R.; Benjamin, J.; Pfister, K.; Lopez-Rebollar, L.; Georgiadis, M.P. Accuracy of an indirect fluorescent-antibody test and of a complement-fixation test for the diagnosis of Babesia caballi in field samples from horses. Prev. Vet. Med. 2008, 83, 41–51. [Google Scholar] [CrossRef] [PubMed]
  16. Sumbria, D.; Singla, L.D.; Sharma, A. Theileria equi and Babesia caballi infection of equids in Punjab, India: A serological and molecular survey. Trop. Anim. Health Prod. 2016, 48, 45–52. [Google Scholar] [CrossRef]
  17. Sumbria, D.; Singla, L.D.; Kumar, S.; Sharma, A.; Dahiya, R.K.; Setia, R. Spatial distribution, risk factors and haemato-biochemical alterations associated with Theileria equi infected equids of Punjab (India) diagnosed by indirect ELISA and nested PCR. Acta Trop. 2016, 155, 104–112. [Google Scholar] [CrossRef]
  18. Salim, B.; Bakheit, M.A.; Kamau, J.; Sugimoto, C. Current status of equine piroplasmosis in the Sudan. Infect. Genet. Evol. 2013, 16, 191–199. [Google Scholar] [CrossRef] [PubMed]
  19. Butler, C. Can Theileria equi be eliminated from carrier horses? Vet. J. 2013, 196, 279. [Google Scholar] [CrossRef] [PubMed]
  20. Ernst Castro, N.S. Piroplasmosis en Caballo Fina Sangre de Carrera; Estudio serológico en Club Hípico de Santiago; Universidad de Chile: Santiago, Chile, 1999. [Google Scholar]
  21. Kim, C.M.; Blanco, L.B.C.; Alhassan, A.; Iseki, H.; Yokoyama, N.; Xuan, X.; Igarashi, I. Diagnostic real-time PCR assay for the quantitative detection of Theileria equi from equine blood samples. Vet. Parasitol. 2008, 151, 158–163. [Google Scholar] [CrossRef]
  22. Peckle, M.; Pires, M.S.; Dos Santos, T.M.; Roier, E.C.R.; Da Silva, C.B.; Vilela, J.A.; Santos, H.A.; Massard, C.L. Molecular epidemiology of Theileria equi in horses and their association with possible tick vectors in the state of Rio de Janeiro, Brazil. Parasitol. Res. 2013, 112, 2017–2025. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Rampersad, J.; Cesar, E.; Campbell, M.D.; Samlal, M.; Ammons, D. A field evaluation of PCR for the routine detection of Babesia equi in horses. Vet. Parasitol. 2003, 114, 81–87. [Google Scholar] [CrossRef]
  24. Rosales, R.; Rangel-Rivas, A.; Escalona, A.; Jordan, L.S.; Gonzatti, M.I.; Aso, P.M.; Perrone, T.; Silva-Iturriza, A.; Mijares, A. Detection of Theileria equi and Babesia caballi infections in Venezuelan horses using Competitive-Inhibition ELISA and PCR. Vet. Parasitol. 2013, 196, 37–43. [Google Scholar] [CrossRef]
  25. Asgarali, Z.; Coombs, D.K.; Mohammed, F.; Campbell, M.D.; Caesar, E. A serological study of Babesia caballi and Theileria equi in Thoroughbreds in Trinidad. Vet. Parasitol. 2007, 144, 167–171. [Google Scholar] [CrossRef] [PubMed]
  26. Posada-Guzmán, M.F.; Dolz, G.; Romero-Zúñiiga, J.J.; Jiménez-Rocha, A.E. Detection of Babesia caballi and Theileria equi in Blood from Equines from Four Indigenous Communities in Costa Rica. Vet. Med. Int. 2015, 2015. [Google Scholar] [CrossRef]
  27. Prochno, H.C.; Scorsin, L.M.; De Melo, F.R.; Baldani, C.D.; Falbo, M.K.; Aquino, L.C.T.D.; Lemos, K.R. Seroprevalence rates of antibodies against Theileria equi in team roping horses from central-western region of Paraná. Rev. Bras. Parasitol. Vet. 2014, 2961, 8. [Google Scholar] [CrossRef]
  28. Vieira, M.; Costa, M.; de Oliveira, M.; Goncalve, L.; André, M.; Zacarías, R. Serological detection and molecular characterization of piroplasmids in equids in Brazil. Acta Trop. 2017, 179, 81–87. [Google Scholar] [CrossRef] [Green Version]
  29. Braga, M.; Costa, F.N.; Gomes, D.; Xavier, D.R.; André, M.R.; Gonçalves, L.R.; Freschi, C.R.; Machado, R.Z. Genetic diversity of piroplasmids species in equids from island of São Luís, northeastern Brazil. Rev. Bras. Parasitol. Vet. 2017, 2961, 331–339. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Campos, J.B.V.; André, M.R.; Gonçalves, L.R.; Freschi, C.R.; Santos, F.M.; De Oliveira, C.E.; Piranda, E.M.; Andrade, G.B.D.; Macedo, G.C. Ticks and Tick-borne Diseases Assessment of equine piroplasmids in the Nhecolândia sub-region of Brazilian Pantanal wetland using serological, parasitological, molecular, and hematological approaches. Ticks Tick-Borne Dis. 2019, 10, 714–721. [Google Scholar] [CrossRef]
  31. Servicio Agricola y Ganadero (SAG). Informe sanidad animal chile; Gobierno de Chile, Ministerio de Agricultura: Santiago, Chile, 2014; pp. 1–94. [Google Scholar]
  32. Campano Díaz, S. Distribución de Babesia equi (apicomplexa: Babesiidae) en equinos fina sangre. Parasitol. Día 1991, 15, 128–130. [Google Scholar]
  33. Ausset Chimenti, G.C. Piroplasmosis Equina en Criaderos de Caballos Fina Sangre de Carrera en la Quinta Región y Región Metropolitana. Master’s Thesis, Universidad de Chile, Santiago, Chile, 1999. [Google Scholar]
  34. Vargas, D.; Bonet, R.; Oliva, P.; Campano, S. Implementación de la técnica de PCR enla identificación de Babesia ssp en equinos. Parasitol. Latinoam. 2004, 59, 179–182. [Google Scholar] [CrossRef] [Green Version]
  35. Terroba Aedo, V.E. Evaluación de la Situación de Piroplasmosis (Babesia equi) en Equinos fina Sangre de Carrera del Hipódromo Chile Diagnosticadas Mediante Inmunofluorescencia Indirecta. Master’s Thesis, Universidad Santo Tomás, Santiago, Chile, 2009. [Google Scholar]
  36. Weber, C.W. Prevalencia y Descripción de Conductas Estereotipadas en Equinos Purasangre inglés Destinados a Carrera en chile. Bachelor’s Thesis, Universidad Austral de Chile, Santiago, Chile, 2010. [Google Scholar]
  37. Bhoora, R.; Franssen, L.; Oosthuizen, M.C.; Guthrie, A.J.; Zweygarth, E.; Penzhorn, B.L.; Jongejan, F.; Collins, N.E. Sequence heterogeneity in the 18S rRNA gene within Theileria equi and Babesia caballi from horses in South Africa. Vet. Parasitol. 2009, 159, 112–120. [Google Scholar] [CrossRef] [Green Version]
  38. Battsetseg, B.; Lucero, S.; Xuan, X.; Claveria, F.G.; Inoue, N.; Alhassan, A.; Kanno, T.; Igarashi, I.; Nagasawa, H.; Mikami, T.; et al. Detection of natural infection of Boophilus microplus with Babesia equi and Babesia caballi in Brazilian horses using nested polymerase chain reaction. Vet. Parasitol. 2002, 107, 351–357. [Google Scholar] [CrossRef]
  39. Clement, M.; Posada, D.; Crandall, K. TCS: A computer program to estimate gene genealogies. Mol. Ecol. 2000, 9, 1657–1659. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Schein, F.B.; Maia, M.O.; Witter, R.; Marcili, A.; Nakazato, L.; Almeida, E.M.D.; Castro, A.; Oliveira, S.D.; Pacheco, R.D.C. Molecular survey and genetic diversity of piroplasmids in equids from Midwestern Brazil. Rev. Bras. Parasitol. Vet. 2018, 27, 464–472. [Google Scholar] [CrossRef]
  41. Costa, S.; Freitas, J.; da Silva, A.; Lacerda, L.; Rebeca, C.; Carvalho, F.; Pereira, M.; Munhoz, A. Frequency and factors associated with Theileria equi, Babesia caballi and Trypanosoma evansi in equids from Bahia (Northeast Brazil). Rev. Bras. Parasitol. Vet. 2019, 28, 47–58. [Google Scholar] [CrossRef]
  42. Bashiruddin, J.B.; Cammà, C.; Rebêlo, E. Molecular detection of Babesia equi and Babesia caballi in horse blood by PCR amplification of part of the 16S rRNA gene. Vet. Parasitol. 1999, 84, 75–83. [Google Scholar] [CrossRef]
  43. Valente, J.D.M.; Mongruel, A.C.B.; Machado, C.A.L.; Chiyo, L.; Leandro, A.S.; Britto, A.S.; Martins, T.F.; Barros-filho, I.R.; Biondo, A.W.; Perotta, J.H.; et al. Veterinary Parasitology Tick-borne pathogens in carthorses from Foz do Iguaçu City, Paraná State, southern Brazil: A tri-border area of Brazil, Paraguay and Argentina. Vet. Parasitol. 2019, 273, 71–79. [Google Scholar] [CrossRef]
  44. Ybañez, A.P.; Haidee, R.; Ybañez, D.; Talle, M.G.; Marie, R.; Arreglo, T.; Janniel, M.; Geens, C.; Gelacio, J.; Iii, I.V.; et al. Ticks and Tick-borne Diseases Serological and molecular detection of Theileria equi and Babesia caballi in Philippine horses. Ticks Tick-Borne Dis. 2018, 9, 1125–1128. [Google Scholar] [CrossRef]
  45. Laus, F.; Spaterna, A.; Faillace, V.; Veronesi, F.; Ravagnan, S.; Beribé, F.; Cerquetella, M.; Meligrana, M.; Tesei, B. Clinical investigation on Theileria equi and Babesia caballi infections in Italian donkeys. BMC Vet. Res. 2015, 11, 100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Sloboda, M.; Jirků, M.; Lukešová, D.; Qablan, M.; Batsukh, Z.; Fiala, I.; Hořín, P.; Modrý, D.; Lukeš, J. A survey for piroplasmids in horses and Bactrian camels in North-Eastern Mongolia. Vet. Parasitol. 2011, 179, 246–249. [Google Scholar] [CrossRef]
  47. Montes, M.G.; Fernández-García, M.Á. PT Graphical abstract. Ticks Tick-Borne Dis. 2018. [Google Scholar] [CrossRef]
  48. Bartolomé Del Pino, L.E.; Roberto, N.; Vincenzo, V.; Francesca, I.; Antonella, C.; Luca, A.G.; Francesco, B.; Teresa, S.M. Babesia caballi and Theileria equi infections in horses in Central-Southern Italy: Sero-molecular survey and associated risk factors. Ticks Tick-Borne Dis. 2016, 7, 462–469. [Google Scholar] [CrossRef]
  49. Cerón, J. Diferencias entre los Parámetros Hematológicos en Caballos Fina Sangre de Carrera Seropositivos y Seronegativos a Babesia caballi y Theileria equi. Bachelor’s Thesis, Universidad Austral de Chile, Valdivia, Chile, 2017. Volume 91. Available online: http://cybertesis.uach.cl/tesis/uach/2017/fvc416d/doc/fvc416d.pdf (accessed on 1 February 2021).
  50. Hussain, M.H.; Saqib, M.; Raza, F.; Muhammad, G.; Asi, M.N.; Mansoor, M.K.; Saleem, M.; Jabbar, A. Seroprevalence of Babesia caballi and Theileria equi in five draught equine populated metropolises of Punjab, Pakistan. Vet. Parasitol. 2014, 202, 248–256. [Google Scholar] [CrossRef]
  51. García-Bocanegra, I.; Arenas-Montes, A.; Hernández, E.; Adaszek, Ł.; Carbonero, A.; Almería, S.; Jaén-Téllez, J.A.; Gutiérrez-Palomino, P.; Arenas, A. Seroprevalence and risk factors associated with Babesia caballi and Theileria equi infection in equids. Vet. J. 2013, 195, 172–178. [Google Scholar] [CrossRef] [PubMed]
  52. Moretti, A.; Mangili, V.; Salvatori, R.; Maresca, C.; Scoccia, E.; Torina, A.; Moretta, I.; Gabrielli, S.; Tampieri, M.P.; Pietrobelli, M. Prevalence and diagnosis of Babesia and Theileria infections in horses in Italy: A preliminary study. Vet. J. 2010, 184, 346–350. [Google Scholar] [CrossRef] [PubMed]
  53. Guidi, E.; Pradier, S.; Lebert, I.; Leblond, A. Piroplasmosis in an endemic area: Analysis of the risk factors and their implications in the control of Theileriosis and Babesiosis in horses. Parasitol. Res. 2014, 114, 71–83. [Google Scholar] [CrossRef]
  54. Vieira, T.S.W.J.; Vieira, R.F.C.; Finger, M.A.P.; Nascimento, D.A.G.; Sicupira, P.M.L.; Dutra, L.H.; Deconto, I.; Barros-Filho, I.R.; Dornbusch, P.T.; Biondo, A.W.; et al. Seroepidemiological survey of Theileria equi and Babesia caballi in horses from a rural and from urban areas of Paraná State, southern Brazil. Ticks Tick-Borne Dis. 2013, 4, 537–541. [Google Scholar] [CrossRef]
  55. Munkhjargal, T.; Sivakumar, T.; Battsetseg, B.; Nyamjargal, T.; Aboulaila, M.; Purevtseren, B.; Bayarsaikhan, D.; Byambaa, B.; Terkawi, M.A.; Yokoyama, N.; et al. Prevalence and genetic diversity of equine piroplasms in Tov province, Mongolia. Infect. Genet. Evol. 2013, 16, 178–185. [Google Scholar] [CrossRef] [PubMed]
  56. Sumbria, D.; Singla, L.D.; Sharma, A.; Bal, M.S.; Kumar, S. Multiplex PCR for detection of Trypanosoma evansi and Theileria equi in equids of Punjab, India. Vet. Parasitol. 2015, 211, 293–299. [Google Scholar] [CrossRef]
  57. Shkap, V.; Cohen, I.; Leibovitz, B. Seroprevalence of Babesia equi among horses in Israel using competitive inhibition ELISA and IFA assays. Vet. Parasitol. 1998, 76, 251–259. [Google Scholar] [CrossRef]
  58. Knowles, D.P.; Kappmeyer, L.S.; Haney, D.; Herndon, D.R.; Fry, L.M.; Munro, J.B.; Sears, K.; Ueti, M.W.; Wise, L.N.; Silva, M.; et al. Discovery of a novel species, Theileria haneyi n. sp., infective to equids, highlights exceptional genomic diversity within the genus Theileria: Implications for apicomplexan parasite surveillance. Int. J. Parasitol. 2018, 48, 679–690. [Google Scholar] [CrossRef]
  59. Hurtado, C.; Torres, R.; Pérez-macchi, S.; Sagredo, K.; Uberti, B.; Carlos, D.; Zanatto, D.S.; Zacarias, R.; Rogério, M.; Bittencourt, P.; et al. Ticks and Tick-borne Diseases Serological and molecular detection of Anaplasma phagocytophilum in Thoroughbred horses from Chilean racecourses. Ticks Tick-Borne Dis. 2020, 11, 101441. [Google Scholar] [CrossRef] [PubMed]
  60. Badal, J. El Espectáculo de la Hípica en Chile, 2nd ed.; Badal, G., Ed.; Ocho Libros Editores: Santiago, Chile, 2001. [Google Scholar]
  61. Liu, Q.; Meli, M.L.; Zhang, Y.; Meili, T.; Stirn, M.; Riond, B.; Weibel, B.; Hofmann-Lehmann, R. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland. Vet. Parasitol. 2016, 221, 24–29. [Google Scholar] [CrossRef]
  62. Qablan, M.A.; Oborník, M.; Elková, K.J.P.Ž.; Sloboda, M.; Shudiefat, M.F.; Horãn, P.; Modrã, D. Infections by Babesia caballi and Theileria equi in Jordanian equids: Epidemiology and genetic diversity. Parasitology 2013, 1096–1103. [Google Scholar] [CrossRef] [PubMed]
  63. Peckle, M.; Sandes, M.; Bezerra, C.; Lins, R.; Lopes, G.; Vitari, V.; Vinicius, M.; Senra, X.; Júnio, R.; Dias, P.; et al. Ticks and Tick-borne Diseases Molecular characterization of Theileria equi in horses from the state of Rio de. Ticks Tick-Borne Dis. 2017, 9, 349–353. [Google Scholar] [CrossRef]
  64. Cross, P. Global Horse Statistics Internal in Global Horse Statistics Validation for HPAB Associates, Virtual Conference, February 2019, HPAB Associates. Available online: https://www.researchgate.net/publication/331234705_Global_Horse_statistics_internal_02_2019 (accessed on 6 February 2021).
  65. González, D.; Guglielmone, A. Ticks (Acari: Ixodoidea: Argasidae, Ixodidae) of Chile. Exp. Appl. Acarol. 2005, 35, 147–163. [Google Scholar] [CrossRef] [PubMed]
  66. Díaz-sánchez, A.A.; Pires, M.S.; Estrada, C.Y.; Cañizares, E.V.; Luis, S.; Cabezas-cruz, A.; Rivero, E.L.; Henrique, A.; Massard, C.L.; Corona-gonzález, B.; et al. First molecular evidence of Babesia caballi and Theileria equi infections in horses in Cuba. Parasitol. Res. 2018, 17, 3109–3118. [Google Scholar] [CrossRef] [PubMed]
  67. Seo, M.G.; Yun, S.H.; Choi, S.K.; Cho, G.J.; Park, Y.S.; Cho, K.H.; Kwon, O.D.; Kwak, D. Molecular and phylogenetic analysis of equine piroplasms in the Republic of Korea. Res. Vet. Sci. 2013, 94, 579–583. [Google Scholar] [CrossRef]
  68. Spotin, A.A.; Boufana, B.; Ahmadpour, E.; Casulli, A.; Mahami-oskouei, M.; Javadi-mamaghani, A.; Shahrivar, F. Assessment of the global pattern of genetic diversity in Echinococcus multilocularis inferred by mitochondrial DNA sequences. Vet. Parasitol. 2018. [Google Scholar] [CrossRef]
  69. Prugnolle, F.; Liu, H.; Meeu, T. De Population genetics of complex life-cycle parasites: An illustration with trematodes. Int. J. Parasitol. 2005, 35, 255–263. [Google Scholar] [CrossRef]
  70. Thrusfield, M. Veterinary Epidemiology; Blackwell Science Ltd.: Hoboken, NJ, USA, 2007; pp. 228–246. [Google Scholar]
  71. Machado, R.Z.; Toledo, C.Z.P.; Teixeira, M.C.A.; André, M.R.; Freschi, C.R.; Sampaio, P.H. Molecular and serological detection of Theileria equi and Babesia caballi in donkeys (Equus asinus) in Brazil. Vet. Parasitol. 2012, 186, 461–465. [Google Scholar] [CrossRef] [PubMed]
  72. Machado, R.Z.; Montassier, H.J.; Pinto, A.A.; Lemos, E.G.; Machado, M.R.F.; Valadão, I.F.F.; Barci, L.G.; Malheiros, E.B. An enzyme-linked immunosorbent assay (ELISA) for the detection of antibodies against Babesia bovis in cattle. Vet. Parasitol. 1997, 71, 17–26. [Google Scholar] [CrossRef]
  73. Swiderski, C.E.; Klei, T.R.; Horohov, D.W. Quantitative measurement of equine cytokine mRNA expression by polymerase chain reaction using target-specific standard curves. J. Immunol. Methods 1999, 222, 155–169. [Google Scholar] [CrossRef]
  74. Beekman, L.; Tohver, T.; Dardari, R.; Léguillette, R. Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage cells from horses with inflammatory airway disease. BMC Mol. Biol. 2011, 12, 1–10. [Google Scholar] [CrossRef] [Green Version]
  75. Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Benson, D.A.; Karsch-mizrachi, I.; Lipman, D.J.; Ostell, J.; Rapp, B.A.; Wheeler, D.L. GenBank. Nucleic Acids Res. 2002, 30, 17–20. [Google Scholar] [CrossRef]
  77. Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef] [Green Version]
  78. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Green Version]
  79. Stamatakis, A.; Hoover, P.; Rougemont, J. A Rapid Bootstrap Algorithm for the RAxML Web Servers. Syst. Biol. 2008, 57, 758–771. [Google Scholar] [CrossRef]
  80. Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for Inference of Large Phylogenetic Trees. In Proceedings of the Gateway, Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010; pp. 1–8. [Google Scholar]
  81. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing CircadiOmics: Integrating circadian genomics, transcriptomics, proteomics. Nat. Methods 2012, 9, 2106. [Google Scholar] [CrossRef] [Green Version]
  82. Stöver, B.C.; Müller, K.F. TreeGraph 2: Combining and visualizing evidence from different phylogenetic analyses. BMC Bioinform. 2010, 11, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  83. Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  84. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. In Nucleic Acids Symposium Series; Information Retrieval Ltd.: London, UK, 1999; pp. 95–98. [Google Scholar]
  85. Leigh, J.W.; Bryant, D. POPART: Full-feature software for haplotype network construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
Pathogens 10 00714 g001 550
Figure 1. Phylogenetic tree of Theileria equi 18S rRNA (1600 bp) sequences. The analysis was performed using the maximum likelihood method with the TPM3uf+I substitution model. Numbers in the branches correspond to bootstrap values after 1000 repetitions. 18S rRNA sequences of T. sergenti and T. bufelli were used as outgroups. Red branches identify the sequences from this study.
Figure 1. Phylogenetic tree of Theileria equi 18S rRNA (1600 bp) sequences. The analysis was performed using the maximum likelihood method with the TPM3uf+I substitution model. Numbers in the branches correspond to bootstrap values after 1000 repetitions. 18S rRNA sequences of T. sergenti and T. bufelli were used as outgroups. Red branches identify the sequences from this study.
Pathogens 10 00714 g001
Pathogens 10 00714 g002 550
Figure 2. Phylogenetic tree of B. caballi 48 KDa rhoptry protein (430 bp) sequences. The analysis was performed using the Bayesian method with a TPM2uf substitution model. Numbers in the branches correspond to bootstrap values after 1000 repetitions. The 48 KDa rhoptry protein gene sequence of B. microti was used as an outgroup. The red branch indicates the sequence from this study.
Figure 2. Phylogenetic tree of B. caballi 48 KDa rhoptry protein (430 bp) sequences. The analysis was performed using the Bayesian method with a TPM2uf substitution model. Numbers in the branches correspond to bootstrap values after 1000 repetitions. The 48 KDa rhoptry protein gene sequence of B. microti was used as an outgroup. The red branch indicates the sequence from this study.
Pathogens 10 00714 g002
Pathogens 10 00714 g003 550
Figure 3. Haplotype TCS network [39] for Theileria equi 18S rRNA sequences (1600 bp) detected in blood samples from Chilean thoroughbred horses and others in GenBank. Each small dash indicates a mutational event. Black circles represent median vectors.
Figure 3. Haplotype TCS network [39] for Theileria equi 18S rRNA sequences (1600 bp) detected in blood samples from Chilean thoroughbred horses and others in GenBank. Each small dash indicates a mutational event. Black circles represent median vectors.
Pathogens 10 00714 g003
Pathogens 10 00714 g004 550
Figure 4. Haplotype TCS network [39] for B. caballi 48 KDa rhoptry protein sequences (430 bp) detected in blood samples from Chilean thoroughbred horses and others in GenBank. Each small dash indicates a mutational event. Black circles represent median vectors.
Figure 4. Haplotype TCS network [39] for B. caballi 48 KDa rhoptry protein sequences (430 bp) detected in blood samples from Chilean thoroughbred horses and others in GenBank. Each small dash indicates a mutational event. Black circles represent median vectors.
Pathogens 10 00714 g004
Pathogens 10 00714 g005 550
Figure 5. The political division of Chile, showing administrative regions where the horses were sampled.
Figure 5. The political division of Chile, showing administrative regions where the horses were sampled.
Pathogens 10 00714 g005
Table
Table 1. Molecular and serological occurrence of Babesia caballi and Theileria equi in Chilean Thoroughbred racehorses.
Table 1. Molecular and serological occurrence of Babesia caballi and Theileria equi in Chilean Thoroughbred racehorses.
RacecourseNnPCR ELISA nPCR+ELISA
Co-Positivity
B. caballi
(rap-1 gene)		T. equi
(18S rRNA gene)		Co-positivity B. caballiT. equiCo-seropositivityB. caballiT. equi
Hipódromo de Concepción16712.5%
(21/167)		75.4 % (126/167)10.1 % (17/167)NANANANANA
Club Hípico de Santiago1510 %
(0/151)		21.1 % (32/151)0 %
(0/151)		12.6 % (19/150)42.0 % (63/150)6 %
(9/150)		0%
(0/150)		14.0% (21/150)
Valparaíso Sporting Club1392.8 %
(4/139)		31.6 % (44/139)0.7 %
(1/139)		3.6 %
(5/136)		3.7 % (5/136)0.7 %
(1/136)		0%
(0/136)		2.2% (3/136)
Total4575.4% (25/457)44.2.% (202/457)3.9% (18/457)8.4% (24/286)23.7% (68/286)3.5%
(10/286)		0%
(0/286)		8.4%
(24/286)
N = Sample size; nPCR = Nested Polymerase Chain Reaction; ELISA = Enzyme-Linked Immunosorbent Assay; NA = Not Available.
Table
Table 2. Polymorphism and genetic diversity of Theileria equi and Babesia caballi sequences in horses, including animals from this study.
Table 2. Polymorphism and genetic diversity of Theileria equi and Babesia caballi sequences in horses, including animals from this study.
SpeciesGene (bp)NVSGC %hHd (Mean ± SD)π (Mean ± SD)K
Theileria equi18S rRNA110035610.45170.934 ± 0.0210.02186 ± 0.0019617.163
Babesia caballiRAP-1350172890.5140.971 ± 0.0320.21122 ± 0.08271.60294
N, number of sequences analyzed; VS, number of variable sites; GC, G+C content; h, number of haplotypes; hd, haplotype diversity; SD, standard deviation; π, nucleotide diversity (per site = PI); K, the average number of nucleotide differences.
Table
Table 3. Summary of the different primer sets and product sizes used in conventional PCRs.
Table 3. Summary of the different primer sets and product sizes used in conventional PCRs.
GeneTargetPrimerSequence
(5′–3′)		Product Size
(bp)		Reference
DNA Integrity checking
Beta-actin proteinEquus caballusACTBF
ACTBR		CTGGCACCACACCTTCTACA
CCCTCATAGATGGGCACAGT		249[74]
Initial Screening
48 KDa rhoptry protein (RAP-1)Babesia caballiBC48F1
BC48R3		PrimaryACGAATTCCCACAACAGCCGTGTT
ACGAATTCGTAAAGCGTGGCCATG		530[38]
BC48F11
BC48R31		NestedGGGCGACGTGACTAAGACCTTATT
GTTCTCAATGTCAGTAGCATCCGC		430
18S rRNATheileria equiBallF
BallR		PrimaryGTAATTCCAGCTCCAATAG
AAAGTCCCTCTAAGAAGC		814[23]
BeqF1
BeqR1		NestedTTCGTTGACTGCGCTTGGCG
CTAAGAAGCGGAAATGAAA		709
Molecular Characterization
18S rRNA
PiroplasmidaNBabesia1F
18SRev-TB		PrimaryAAGCCATGCATGTCTAAGTATAAGCTTTT
GAATAATTCACCGGATCACTCG		1600[37]
NBabesia1F
BT18S3R
NestedAAGCCATGCATGTCTAAGTATAAGCTTTT
CCTCTGACAGTTAAATACGAATGCCC		800
BT18S3F
18SRev-TB		GGGCATTCGTATTTAACTGTCAGAGG
GAATAATTCACCGGATCACTCG		800
BT18S2F
BT18S2R		GGGTTCGATTCCGGAGAGGG
CCCGTGTTGAGTCAAATTAAGCCG		750
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Torres, R.; Hurtado, C.; Pérez-Macchi, S.; Bittencourt, P.; Freschi, C.; de Mello, V.V.C.; Machado, R.Z.; André, M.R.; Müller, A. Occurrence and Genetic Diversity of Babesia caballi and Theileria equi in Chilean Thoroughbred Racing Horses. Pathogens 2021, 10, 714. https://doi.org/10.3390/pathogens10060714

AMA Style

Torres R, Hurtado C, Pérez-Macchi S, Bittencourt P, Freschi C, de Mello VVC, Machado RZ, André MR, Müller A. Occurrence and Genetic Diversity of Babesia caballi and Theileria equi in Chilean Thoroughbred Racing Horses. Pathogens. 2021; 10(6):714. https://doi.org/10.3390/pathogens10060714

Chicago/Turabian Style

Torres, Reinaldo, Claudio Hurtado, Sandra Pérez-Macchi, Pedro Bittencourt, Carla Freschi, Victoria Valente Califre de Mello, Rosangela Zacarias Machado, Marcos Rogério André, and Ananda Müller. 2021. "Occurrence and Genetic Diversity of Babesia caballi and Theileria equi in Chilean Thoroughbred Racing Horses" Pathogens 10, no. 6: 714. https://doi.org/10.3390/pathogens10060714

APA Style

Torres, R., Hurtado, C., Pérez-Macchi, S., Bittencourt, P., Freschi, C., de Mello, V. V. C., Machado, R. Z., André, M. R., & Müller, A. (2021). Occurrence and Genetic Diversity of Babesia caballi and Theileria equi in Chilean Thoroughbred Racing Horses. Pathogens, 10(6), 714. https://doi.org/10.3390/pathogens10060714

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop