Occurrence of Chlamydiaceae and Chlamydia felis pmp9 Typing in Conjunctival and Rectal Samples of Swiss Stray and Pet Cats
Abstract
:1. Introduction
2. Results
2.1. Flocked Swabs Led to Higher Feline Cell Yields Compared to Cytology Brushes
2.2. Chlamydiaceae 23S rRNA qPCR
2.2.1. Chlamydiaceae Were More Often Detected in Symptomatic Cats
2.2.2. The Prevalence of Chlamydiaceae Differs between Symptomatic Stray and Pet Cats but Not between the Overall Stray and Pet Populations
2.2.3. Rectal Shedding Was Observed in 25.0% of Chlamydiaceae-Positive Animals
2.3. Chlamydia felis Is the Most Prevalent Chlamydial Species in Stray and Pet Cats
2.4. C. felis pmp9 Typing and Sequencing
3. Discussion
3.1. Swab Comparison Trial
3.2. Chlamydiaceae qPCR
3.2.1. Comparing of Symptomatic and Asymptomatic Cats
3.2.2. Pet Cats
3.2.3. Stray Cats
3.2.4. Comparing Stray and Pet Cats
3.2.5. Risk Factors
3.2.6. Rectal Shedding of Chlamydiaceae
3.3. Chlamydia Species Identification
3.4. C. felis Typing
4. Materials and Methods
4.1. Samples
4.2. DNA Extraction
4.3. Feline Albumin qPCR for Swab Comparison Trial
4.4. Chlamydiaceae 23S rRNA qPCR
PCR | Gene Target | Primer and Probe | Final Conc. | Sequence (5′ to 3′) | Size | Ref. |
---|---|---|---|---|---|---|
Chlamydiaceae 23S rRNA qPCR | 23S rRNA | Ch23S-F Ch23S-R Ch23-S-P | 0.5 μM 0.5 μM 0.2 μM | CTGAAACCAGTAGCTTATAAGCGGT ACCTCGCCGTTTAACTTAACTCC FAM-CTCATCATGCAAAAGGCACGCCG-TAMRA | 111 bp | [80] |
eGFP | EGFP-1-F EGFP-10-R EGFP-Hex | 0.4 μM 0.4 μM 0.2 μM | GACCACTACCAGCAGAACAC CTTGTACAGCTCGTCCATGC HEX-AGCACCCAGTCCGCCCTGAGCA-BHQ1 | 177 bp | [68,81] | |
Feline albumin qPCR | fALB | fALB-345F fALB-494R fAlb-413P | 0.5 μM 0.5 μM 0.2 μM | GATGGCTGATTGCTGTGAGA CCCAGGAACCTCTGTTCATT FAM-ATCCCGGCTTCGGTCAGCTG-TAMRA | 150 bp | [50] |
DNA microarray assay | 23S rRNA | U23-F19 23R-22 | 0.5 μM 0.5 μM | ATTGAMAGGCGAWGAAGGA Biotin-GCYTACTAAGATGTTTCAGTTC | 175 bp | [82] |
eGFP | EGFP-11-F EGFP-10-R | 0.25 μM 0.25 μM | CAGCCACAACGTCTATATCATG Biotin-CTTGTACAGCTCGTCCATGC | 277 bp | [68,83] | |
16S rRNA PCR | 16S rRNA | 16S-IGF 16S-IGR | 0.3 μM 0.3 μM | GATGAGGCATGCAAGTCGAACG CCAGTGTTGGCGGTCAATCTCTC | 278 bp | [71,84] |
C. felis pmp9 typing PCR | pmp9 | Pmp9-F Pmp9-R | 0.2 μM 0.2 μM | GCGATTCATGTAGCAGCAAA GTCCAGCTTCCTTGATACCC | 632 bp | [14] |
4.5. DNA Microarray Assay
4.6. 16S rRNA Pan Chlamydiales PCR
4.7. C. felis pmp9 PCR
4.8. Sequencing Preparation and Analysis
4.9. Statistical Analysis
4.10. Ethical Statement
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Borel, N.; Polkinghorne, A.; Pospischil, A. A Review on Chlamydial Diseases in Animals: Still a Challenge for Pathologists? Vet. Pathol. 2018, 55, 374–390. [Google Scholar] [CrossRef] [Green Version]
- Sachse, K.; Borel, N. Recent Advances in Epidemiology, Pathology and Immunology of Veterinary Chlamydiae. In Chlamydia Biology: From Genome to Disease; Caister Academic Press: Poole, UK, 2020; pp. 403–428. [Google Scholar]
- Mitchell, N. Feline ophthalmology Part 2: Clinical presentation and aetiology of common ocular conditions. Ir. Vet. J. 2006, 59, 223–232. [Google Scholar]
- Sykes, J.E. Feline chlamydiosis. Clin. Tech. Small Anim. Pract. 2005, 20, 129–134. [Google Scholar] [CrossRef] [PubMed]
- Bart, M.; Guscetti, F.; Zurbriggen, A.; Pospischil, A.; Schiller, I. Feline infectious pneumonia: A short literature review and a retrospective immunohistological study on the involvement of Chlamydia spp. and distemper virus. Vet. J. 2000, 159, 220–230. [Google Scholar] [CrossRef]
- Sykes, J.E.; Studdert, V.P.; Browning, G.F. Comparison of the Polymerase Chain Reaction and Culture for the Detection of Feline Chlamydia psittaci in Untreated and Doxycycline-Treated Experimentally Infected Cats. J. Vet. Intern. Med. 1999, 13, 146. [Google Scholar] [CrossRef]
- Masubuchi, K.; Nosaka, H.; Iwamoto, K.; Kokubu, T.; Yamanaka, M.; Shimizu, Y. Experimental infection of cats with Chlamydophila felis. J. Vet. Med. Sci. 2002, 64, 1165–1168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hargis, A.M.; Prieur, D.J.; Gaillard, E.T. Chlamydial Infection of the Gastric Mucosa in Twelve Cats. Vet. Pathol. 1983, 20, 170–178. [Google Scholar] [CrossRef]
- Gomes, J.P.; Hsia, R.; Mead, S.; Borrego, M.J.; Dean, D. Immunoreactivity and differential developmental expression of known and putative Chlamydia trachomatis membrane proteins for biologically variant serovars representing distinct disease groups. Microbes Infect. 2005, 7, 410–420. [Google Scholar] [CrossRef] [PubMed]
- Becker, E.; Hegemann, J.H. All subtypes of the Pmp adhesin family are implicated in chlamydial virulence and show species-specific function. Microbiologyopen 2014, 3, 544–556. [Google Scholar] [CrossRef]
- Wehrl, W.; Brinkmann, V.; Jungblut, P.R.; Meyer, T.F.; Szczepek, A.J. From the inside out—Processing of the Chlamydial autotransporter PmpD and its role in bacterial adhesion and activation of human host cells. Mol. Microbiol. 2004, 51, 319–334. [Google Scholar] [CrossRef]
- Stothard, D.R.; Toth, G.A.; Batteiger, B.E. Polymorphic membrane protein H has evolved in parallel with the three disease-causing groups of Chlamydia trachomatis. Infect. Immun. 2003, 71, 1200–1208. [Google Scholar] [CrossRef] [Green Version]
- Favaroni, A.; Trinks, A.; Weber, M.; Hegemann, J.H.; Schnee, C. Pmp Repertoires Influence the Different Infectious Potential of Avian and Mammalian Chlamydia psittaci Strains. Front. Microbiol. 2021, 12, 1–13. [Google Scholar] [CrossRef]
- Harley, R.; Herring, A.; Egan, K.; Howard, P.; Gruffydd-Jones, T.; Azuma, Y.; Shirai, M.; Helps, C. Molecular characterisation of 12 Chlamydophila felis polymorphic membrane protein genes. Vet. Microbiol. 2007, 124, 230–238. [Google Scholar] [CrossRef] [PubMed]
- Sostaric-Zuckermann, I.C.; Borel, N.; Kaiser, C.; Grabarevic, Z.; Pospischil, A. Chlamydia in canine or feline coronary arteriosclerotic lesions. BMC Res. Notes 2011, 4, 350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sibitz, C.; Rudnay, E.C.; Wabnegger, L.; Spergser, J.; Apfalter, P.; Nell, B. Detection of Chlamydophila pneumoniae in cats with conjunctivitis. Vet. Ophthalmol. 2011, 14, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Sanderson, H.; Vasquez, M.; Killion, H.; Vance, M.; Sondgeroth, K.; Fox, J. Fatal Chlamydia psittaci infection in a domestic kitten. J. Vet. Diagn. Investig. 2021, 33, 101–103. [Google Scholar] [CrossRef] [PubMed]
- Pantchev, A.; Sting, R.; Bauerfeind, R.; Tyczka, J.; Sachse, K. Detection of all Chlamydophila and Chlamydia spp. of veterinary interest using species-specific real-time PCR assays. Comp. Immunol. Microbiol. Infect. Dis. 2010, 33, 473–484. [Google Scholar] [CrossRef]
- Schachter, J.; Bruce Ostler, H.; Meyer, K.F. Human infection with the agent of feline pneumonitis. Lancet 1969, 293, 1063–1065. [Google Scholar] [CrossRef]
- Shewen, P.E.; Povey, R.C.; Wilson, M.R. Case report. Feline chlamydial infection. Can. Vet. J. Rev. Vet. Can. 1978, 19, 289–292. [Google Scholar]
- Hartley, J.C.; Stevenson, S.; Robinson, A.J.; Littlewood, J.D.; Carder, C.; Cartledge, J.; Clark, C.; Ridgway, G.L. Conjunctivitis Due to Chlamydophila felis (Chlamydia psittaci Feline Pneumonitis Agent) Acquired From a Cat: Case Report with Molecular Characterization of Isolates from the Patient and Cat. J. Infect. 2001, 43, 7–11. [Google Scholar] [CrossRef]
- Wons, J.; Meiller, R.; Bergua, A.; Bogdan, C.; Geißdörfer, W. Follicular Conjunctivitis due to Chlamydia felis—Case Report, Review of the Literature and Improved Molecular Diagnostics. Front. Med. 2017, 4, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Di Francesco, A.; Donati, M.; Mazzeo, C.; Battelli, G.; Piva, S.; Cevenini, R.; Baldelli, R. Feline chlamydiosis: A seroepidemiological investigation of human beings with and without contact with cats. Vet. Rec. 2006, 159, 778–779. [Google Scholar] [CrossRef]
- Gruffydd-Jones, T.; Addie, D.; Belák, S.; Boucraut-Baralon, C.; Egberink, H.; Frymus, T.; Hartmann, K.; Hosie, M.J.; Lloret, A.; Lutz, H.; et al. Chlamydophila felis Infection: ABCD Guidelines on Prevention and Management. J. Feline Med. Surg. 2009, 11, 605–609. [Google Scholar] [CrossRef]
- TerWee, J.; Sabara, M.; Kokjohn, K.; Sandbulte, J.; Frenchick, P.; Dreier, K.J. Characterization of the systemic disease and ocular signs induced by experimental infection with Chlamydia psittaci in cats. Vet. Microbiol. 1998, 59, 259–281. [Google Scholar] [CrossRef]
- Hoover, E.A.; Kahn, D.E.; Langloss, J.M. Experimentally induced feline chlamydial infection (feline pneumonitis). Am. J. Vet. Res. 1978, 39, 541–547. [Google Scholar] [PubMed]
- Wills, J.M.; Gruffydd-Jones, T.J.; Richmond, S.J.; Gaskell, R.M.; Bourne, F.J. Effect of vaccination on feline Chlamydia psittaci infection. Infect. Immun. 1987, 55, 2653–2657. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- O’Dair, H.A.; Hopper, C.D.; Gruffydd-Jones, T.J.; Harbour, D.A.; Waters, L. Clinical aspects of Chlamydia psittaci infection in cats infected with feline immunodeficiency virus. Vet. Rec. 1994, 134, 365–368. [Google Scholar] [CrossRef] [PubMed]
- Laroucau, K.; Di Francesco, A.; Vorimore, F.; Thierry, S.; Pingret, J.L.; Bertin, C.; Willems, H.; Bölske, G.; Harley, R. Multilocus Variable-Number Tandem-Repeat Analysis Scheme for Chlamydia felis Genotyping: Comparison with Multilocus Sequence Typing. J. Clin. Microbiol. 2012, 50, 1860–1866. [Google Scholar] [CrossRef] [Green Version]
- Bavoil, P.M.; Marques, P.X.; Brotman, R.; Ravel, J. Does Active Oral Sex Contribute to Female Infertility? J. Infect. Dis. 2017, 216, 932–935. [Google Scholar] [CrossRef]
- Bavoil, P.M. What’s in a word: The use, misuse, and abuse of the word “persistence” in Chlamydia biology. Front. Cell. Infect. Microbiol. 2014, 4, 27. [Google Scholar] [CrossRef] [Green Version]
- Yeruva, L.; Spencer, N.; Bowlin, A.K.; Wang, Y.; Rank, R.G. Chlamydial infection of the gastrointestinal tract: A reservoir for persistent infection. Pathog. Dis. 2013, 68, 88–95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rank, R.G.; Yeruva, L. Hidden in Plain Sight: Chlamydial Gastrointestinal Infection and Its Relevance to Persistence in Human Genital Infection. Infect. Immun. 2014, 82, 1362–1371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McDonald, M.; Willett, B.J.; Jarrett, O.; Addie, D.D. A comparison of DNA amplification, isolation and serology for the detection of Chlamydia psittaci infection in cats. Vet. Rec. 1998, 143, 97–101. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, K.; Schott, F.; Donati, M.; Di Francesco, A.; Hässig, M.; Wanninger, S.; Sidler, X.; Borel, N. Prevalence of Chlamydial Infections in Fattening Pigs and Their Influencing Factors. PLoS ONE 2015, 10, e0143576. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wanninger, S.; Donati, M.; Di Francesco, A.; Hässig, M.; Hoffmann, K.; Seth-Smith, H.M.B.; Marti, H.; Borel, N. Selective Pressure Promotes Tetracycline Resistance of Chlamydia Suis in Fattening Pigs. PLoS ONE 2016, 11, e0166917. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leonard, C.A.; Meli, M.L.; Novacco, M.; Borel, N. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA. Biomed Res. Int. 2016, 2016, 1–6. [Google Scholar] [CrossRef] [Green Version]
- Honkila, M.; Renko, M.; Ikäheimo, I.; Pokka, T.; Uhari, M.; Tapiainen, T. Aetiology of neonatal conjunctivitis evaluated in a population-based setting. Acta Paediatr. 2018, 107, 774–779. [Google Scholar] [CrossRef]
- Chernesky, M.A. The laboratory diagnosis of Chlamydia trachomatis infections. Can. J. Infect. Dis. Med. Microbiol. 2005, 16, 39–44. [Google Scholar] [CrossRef] [Green Version]
- Low, H.C.; Powell, C.C.; Veir, J.K.; Hawley, J.R.; Lappin, M.R. Prevalence of feline herpesvirus 1, Chlamydophila felis, and Mycoplasma spp DNA in conjunctival cells collected from cats with and without conjunctivitis. Am. J. Vet. Res. 2007, 68, 643–648. [Google Scholar] [CrossRef]
- Rampazzo, A.; Appino, S.; Pregel, P.; Tarducci, A.; Zini, E.; Biolatti, B. Prevalence of Chlamydophila felis and Feline Herpesvirus 1 in Cats with Conjunctivitis in Northern Italy. J. Vet. Intern. Med. 2003, 17, 799–807. [Google Scholar] [CrossRef]
- Fernandez, M.; Manzanilla, E.G.; Lloret, A.; León, M.; Thibault, J. Prevalence of feline herpesvirus-1, feline calicivirus, Chlamydophila felis and Mycoplasma felis DNA and associated risk factors in cats in Spain with upper respiratory tract disease, conjunctivitis and/or gingivostomatitis. J. Feline Med. Surg. 2017, 19, 461–469. [Google Scholar] [CrossRef] [PubMed]
- Sykes, J.E.; Anderson, G.A.; Studdert, V.P.; Browning, G.F. Prevalence of Feline Chlamydia psittaci and Feline Herpesvirus 1 in Cats with Upper Respiratory Tract Disease. J. Vet. Intern. Med. 1999, 13, 153–162. [Google Scholar] [CrossRef]
- Wills, J.M.; Howard, P.E.; Gruffydd-Jones, T.J.; Wathes, C.M. Prevalence of Chlamydia psittaci in different cat populations in Britain. J. Small Anim. Pract. 1988, 29, 327–339. [Google Scholar] [CrossRef]
- Von Bomhard, W.; Polkinghorne, A.; Huat Lu, Z.; Vaughan, L.; Vogtlin, A.; Zimmermann, D.R.; Spiess, B.; Pospischil, A. Detection of novel chlamydiae in cats with ocular disease. Am. J. Vet. Res. 2003, 64, 1421–1428. [Google Scholar] [CrossRef]
- Halánová, M.; Petrová, L.; Halán, M.; Trbolová, A.; Babinská, I.; Weissová, T. Impact of way of life and environment on the prevalence of Chlamydia felis in cats as potentional sources of infection for humans. Ann. Agric. Environ. Med. 2019, 26, 222–226. [Google Scholar] [CrossRef]
- Mochizuki, M.; Kawakami, K.; Hashimoto, M.; Ishida, T. Recent Epidemiological Status of Feline Upper Respiratory Infections in Japan. J. Vet. Med. Sci. 2000, 62, 801–803. [Google Scholar] [CrossRef] [Green Version]
- Halánová, M.; Sulinová, Z.; Cisláková, L.; Trbolová, A.; Páleník, L.; Weissová, T.; Halán, M.; Kalinová, Z.; Holičková, M. Chlamydophila felis in cats--are the stray cats dangerous source of infection? Zoonoses Public Health 2011, 58, 519–522. [Google Scholar] [CrossRef]
- Nasisse, M.P.; Guy, J.S.; Stevens, J.B.; English, R.V.; Davidson, M.G. Clinical and laboratory findings in chronic conjunctivitis in cats: 91 cases (1983–1991). J. Am. Vet. Med. Assoc. 1993, 203, 834–837. [Google Scholar]
- Helfer-Hungerbuehler, A.K.; Widmer, S.; Hofmann-Lehmann, R. GAPDH Pseudogenes and the Quantification of Feline Genomic DNA Equivalents. Mol. Biol. Int. 2013, 2013, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Russell, W.M.S.; Burch, R.L. The Principles of Humane Experimental Technique; Methuen: North Yorkshire, UK, 1959. [Google Scholar]
- McManus, C.M.; Levy, J.K.; Andersen, L.A.; McGorray, S.P.; Leutenegger, C.M.; Gray, L.K.; Hilligas, J.; Tucker, S.J. Prevalence of upper respiratory pathogens in four management models for unowned cats in the Southeast United States. Vet. J. 2014, 201, 196–201. [Google Scholar] [CrossRef]
- Hwang, J.; Gottdenker, N.L.; Oh, D.; Nam, H.; Lee, H.; Chun, M.-S. Disentangling the link between supplemental feeding, population density, and the prevalence of pathogens in urban stray cats. PeerJ 2018, 6, e4988. [Google Scholar] [CrossRef]
- Barimani, M.; Mosallanejad, B.; Ghorbanpoor, M.; Esmaeilzadeh, S. Molecular Detection of Chlamydia felis in Cats in Ahvaz, Iran. Arch. Razi Inst. 2019, 74, 119–126. [Google Scholar] [CrossRef]
- Roberts, J.P.; Grimes, J.E. Chlamydia shedding by four species of wild birds. Avian Dis. 1978, 22, 698–706. [Google Scholar] [CrossRef] [PubMed]
- York, C.J.; Baker, J.A. A new member of the psittacosis-lymphogranuloma group of viruses that causes infection in calves. J. Exp. Med. 1951, 93, 587–604. [Google Scholar] [CrossRef] [Green Version]
- Clarkson, M.J.; Philips, H.L. Isolation of faecal chlamydia from sheep in Britain andtheir characterization by cultural properties. Vet. J. 1997, 153, 307–310. [Google Scholar] [CrossRef]
- Zhang, Q.; Huang, Y.; Gong, S.; Yang, Z.; Sun, X.; Schenken, R.; Zhong, G. In Vivo and Ex Vivo Imaging Reveals a Long-Lasting Chlamydial Infection in the Mouse Gastrointestinal Tract following Genital Tract Inoculation. Infect. Immun. 2015, 83, 3568–3577. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gratrix, J.; Singh, A.E.; Bergman, J.; Egan, C.; Plitt, S.S.; McGinnis, J.; Bell, C.A.; Drews, S.J.; Read, R. Evidence for Increased Chlamydia Case Finding After the Introduction of Rectal Screening Among Women Attending 2 Canadian Sexually Transmitted Infection Clinics. Clin. Infect. Dis. 2015, 60, 398–404. [Google Scholar] [CrossRef]
- Szeredi, L.; Schiller, I.; Sydler, T.; Guscetti, F.; Heinen, E.; Corboz, L.; Eggenberger, E.; Jones, G.E.; Pospischil, A. Intestinal Chlamydia in Finishing Pigs. Vet. Pathol. 1996, 33, 369–374. [Google Scholar] [CrossRef]
- Wang, L.; Zhu, C.; Zhang, T.; Tian, Q.; Zhang, N.; Morrison, S.; Morrison, R.; Xue, M.; Zhong, G. Nonpathogenic Colonization with Chlamydia in the Gastrointestinal Tract as Oral Vaccination for Inducing Transmucosal Protection. Infect. Immun. 2018, 86, e00630-17. [Google Scholar] [CrossRef] [Green Version]
- Igietseme, J.U.; Portis, J.L.; Perry, L.L. Inflammation and Clearance of Chlamydia trachomatis in Enteric and Nonenteric Mucosae. Infect. Immun. 2001, 69, 1832–1840. [Google Scholar] [CrossRef] [Green Version]
- Zhong, G. Chlamydia overcomes multiple gastrointestinal barriers to achieve long-lasting colonization. Trends Microbiol. 2021, 1–9. [Google Scholar] [CrossRef]
- Longbottom, D.; Coulter, L.J. Animal chlamydioses and zoonotic implications. J. Comp. Pathol. 2003, 128, 217–244. [Google Scholar] [CrossRef]
- Chanton-Greutmann, H.; Thoma, R.; Corboz, L.; Borel, N.; Pospischil, A. Aborte beim kleinen Wiederkäuer in der Schweiz: Untersuchungen während zwei Ablammperioden (1996–1998) unter besonderer Beachtung des Chlamydienabortes. Schweiz. Archiv. Tierheilkd. 2002, 144, 483–492. [Google Scholar] [CrossRef]
- Schenk, B. Border-Disease-Infektionen in Betrieben mit Gleichzeitiger Schaf- und Rinderhaltung. Ph.D. Thesis, Vetsuisse Faculty, University of Zurich, Zurich, Switzerland, 2012. [Google Scholar] [CrossRef]
- Hoelzle, K.; Wittenbrink, M.M.; Corboz, L.; Hoelzle, L.E. Chlamydophila abortus -induced keratoconjunctivitis in a dog. Vet. Rec. 2005, 157, 632–633. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoffmann, B.; Depner, K.; Schirrmeier, H.; Beer, M. A universal heterologous internal control system for duplex real-time RT-PCR assays used in a detection system for pestiviruses. J. Virol. Methods 2006, 136, 200–209. [Google Scholar] [CrossRef]
- Azuma, Y.; Hirakawa, H.; Yamashita, A.; Cai, Y.; Rahman, M.A.; Suzuki, H.; Mitaku, S.; Toh, H.; Goto, S.; Murakami, T.; et al. Genome Sequence of the Cat Pathogen, Chlamydophila felis. DNA Res. 2006, 13, 15–23. [Google Scholar] [CrossRef] [Green Version]
- Harley, R.; Day, S.; Di Rocco, C.; Helps, C. The Chlamydophila felis plasmid is highly conserved. Vet. Microbiol. 2010, 146, 172–174. [Google Scholar] [CrossRef]
- Everett, K.D.E.; Bush, R.M.; Andersen, A.A. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards. Int. J. Syst. Evol. Microbiol. 1999, 49, 415–440. [Google Scholar] [CrossRef]
- Sykes, J.E.; Studdert, V.P.; Anderson, G.; Browning, G.F. Comparison of Chlamydia psittaci from cats with upper respiratory tract disease by polymerase chain reaction analysis of the ompA gene. Vet. Rec. 1997, 140, 310–313. [Google Scholar] [CrossRef] [PubMed]
- Di Francesco, A.; Baldelli, R. Feline chlamydiosis in Italy: PCR amplification and analysis of the ompA and groEL-homolog genes. New Microbiol. 2002, 25, 341–344. [Google Scholar]
- Pannekoek, Y.; Morelli, G.; Kusecek, B.; Morré, S.A.; Ossewaarde, J.M.; Langerak, A.A.; van der Ende, A. Multi locus sequence typing of Chlamydiales: Clonal groupings within the obligate intracellular bacteria Chlamydia trachomatis. BMC Microbiol. 2008, 8, 42. [Google Scholar] [CrossRef] [Green Version]
- Seth-Smith, H.M.B.; Busó, L.S.; Livingstone, M.; Sait, M.; Harris, S.R.; Aitchison, K.D.; Vretou, E.; Siarkou, V.I.; Laroucau, K.; Sachse, K.; et al. European Chlamydia abortus livestock isolate genomes reveal unusual stability and limited diversity, reflected in geographical signatures. BMC Genom. 2017, 18, 344. [Google Scholar] [CrossRef] [Green Version]
- Siarkou, V.I.; Vorimore, F.; Vicari, N.; Magnino, S.; Rodolakis, A.; Pannekoek, Y.; Sachse, K.; Longbottom, D.; Laroucau, K. Diversification and Distribution of Ruminant Chlamydia abortus Clones Assessed by MLST and MLVA. PLoS ONE 2015, 10, e0126433. [Google Scholar] [CrossRef] [Green Version]
- Everett, K.D.E.; Hornung, L.J.; Andersen, A.A. Rapid detection of the Chlamydiaceae and other families in the order Chlamydiales: Three PCR tests. J. Clin. Microbiol. 1999, 37, 575–580. [Google Scholar] [CrossRef] [Green Version]
- Mattmann, P.; Marti, H.; Borel, N.; Jelocnik, M.; Albini, S.; Vogler, B.R. Chlamydiaceae in wild, feral and domestic pigeons in Switzerland and insight into population dynamics by Chlamydia psittaci multilocus sequence typing. PLoS ONE 2019, 14, e0226088. [Google Scholar] [CrossRef] [Green Version]
- Stalder, S.; Marti, H.; Borel, N.; Sachse, K.; Albini, S.; Vogler, B.R. Occurrence of Chlamydiaceae in Raptors and Crows in Switzerland. Pathogens 2020, 9, 724. [Google Scholar] [CrossRef]
- Ehricht, R.; Slickers, P.; Goellner, S.; Hotzel, H.; Sachse, K. Optimized DNA microarray assay allows detection and genotyping of single PCR-amplifiable target copies. Mol. Cell. Probes 2006, 20, 60–63. [Google Scholar] [CrossRef] [PubMed]
- Blumer, S.; Greub, G.; Waldvogel, A.; Hässig, M.; Thoma, R.; Tschuor, A.; Pospischil, A.; Borel, N. Waddlia, Parachlamydia and Chlamydiaceae in bovine abortion. Vet. Microbiol. 2011, 152, 385–393. [Google Scholar] [CrossRef] [Green Version]
- Borel, N.; Kempf, E.; Hotzel, H.; Schubert, E.; Torgerson, P.; Slickers, P.; Ehricht, R.; Tasara, T.; Pospischil, A.; Sachse, K. Direct identification of chlamydiae from clinical samples using a DNA microarray assay—A validation study. Mol. Cell. Probes 2008, 22, 55–64. [Google Scholar] [CrossRef] [PubMed]
- Schnee, C.; Sachse, K. DNA microarray-based detection of multiple pathogens: Mycoplasma spp. and Chlamydia spp. Methods Mol. Biol. 2015, 1247, 193–208. [Google Scholar] [CrossRef] [PubMed]
- Blumer, C.; Zimmermann, D.R.; Weilenmann, R.; Vaughan, L.; Pospischil, A. Chlamydiae in Free-Ranging and Captive Frogs in Switzerland. Vet. Pathol. 2007, 44, 144–150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gibbons, R.D.; Hedeker, D.R.; Davis, J.M. Estimation of Effect Size from a Series of Experiments Involving Paired Comparisons. J. Educ. Stat. 1993, 18, 271. [Google Scholar] [CrossRef] [Green Version]
Population (Year) | Symptomatic Cats | Asymptomatic Cats | Health Status Unknown | Total | ||||
---|---|---|---|---|---|---|---|---|
BE (2020) | 0/2 | (0%) | 2/32 | (6.3%) | - | - | 2/34 | (5.9%) |
FR (2017/18) | 4/5 | (80.0%) | 0/51 | (0%) | 0/1 | (0%) | 4/57 | (7.0%) |
NW (2017/18/20) | 26/44 | (59.1%) | 11/108 | (10.2%) | 2/2 | (100%) | 39/154 | (25.3%) |
OW (2020) | 10/16 | (62.5%) | 4/48 | (8.3%) | - | - | 14/64 | (21.9%) |
Stray Cats Subtotal | 40/67 | (59.7%) | 17/239 | (7.1%) | 2/3 | (66.7%) | 59/309 | (19.1%) |
ZH Ophthalmology (2020/21) | 9/53 | (17.0%) | 1/1 | (100%) | - | - | 10/54 | (18.5%) |
ZH Veterinary Practices (2020/21) | 0/12 | (0%) | 0/20 | (0%) | - | - | 0/32 | (0%) |
Pet Cats Subtotal | 9/65 | (13.8%) | 1/21 | (4.8%) | - | - | 10/86 | (11.6%) |
Total Cats | 49/132 | (37.1%) | 18/260 | (6.9%) | 2/3 | (66.7%) | 69/395 | (17.5%) |
Population (Year) | Conjunctival Swabs | Rectal Swabs | Sampling Site Unknown | Total | ||||
---|---|---|---|---|---|---|---|---|
BE (2020) | 1/50 | (2.0%) | 1/32 | (3.1%) | - | - | 2/82 | (2.4%) |
FR (2017/18) | 5/61 | (8.2%) | 0/56 | (0%) | - | - | 5/117 | (4.3%) |
NW (2017/18/20) | 56/209 | (26.8%) | 8/149 | (5.4%) | 2/2 | (100%) | 66/360 | (18.3%) |
OW (2020) | 21/93 | (22.6%) | 3/64 | (4.7%) | - | - | 24/157 | (15.3%) |
Stray Cats Subtotal | 83/413 | (20.1%) | 12/301 | (4.0%) | 2/2 | (100%) | 97/716 | (13.5%) |
ZH Ophthalmology (2020/21) | 15/107 | (14.0%) | 4/54 | (7.4%) | - | - | 19/161 | (11.8%) |
ZH Veterinary Practices (2020/21) | 0/45 | (0%) | 0/32 | (0%) | - | - | 0/77 | (0%) |
Pet Cats Subtotal | 15/152 | (9.9%) | 4/86 | (4.7%) | - | - | 19/238 | (8.0%) |
Total Cats | 98/565 | (17.3%) | 16/387 | (4.1%) | 2/2 | (100%) | 116/954 | (12.2%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bressan, M.; Rampazzo, A.; Kuratli, J.; Marti, H.; Pesch, T.; Borel, N. Occurrence of Chlamydiaceae and Chlamydia felis pmp9 Typing in Conjunctival and Rectal Samples of Swiss Stray and Pet Cats. Pathogens 2021, 10, 951. https://doi.org/10.3390/pathogens10080951
Bressan M, Rampazzo A, Kuratli J, Marti H, Pesch T, Borel N. Occurrence of Chlamydiaceae and Chlamydia felis pmp9 Typing in Conjunctival and Rectal Samples of Swiss Stray and Pet Cats. Pathogens. 2021; 10(8):951. https://doi.org/10.3390/pathogens10080951
Chicago/Turabian StyleBressan, Michelle, Antonella Rampazzo, Jasmin Kuratli, Hanna Marti, Theresa Pesch, and Nicole Borel. 2021. "Occurrence of Chlamydiaceae and Chlamydia felis pmp9 Typing in Conjunctival and Rectal Samples of Swiss Stray and Pet Cats" Pathogens 10, no. 8: 951. https://doi.org/10.3390/pathogens10080951