Comparison of Three Real-Time PCR Assays Targeting the SSU rRNA Gene, the COWP Gene and the DnaJ-Like Protein Gene for the Diagnosis of Cryptosporidium spp. in Stool Samples
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. Nucleic Acid Extraction and Real-Time PCR Assays
2.3. Exclusion Criteria and Statistical Assessment
3. Results
3.1. Agreement Kappa between the Real-Time PCR Assays, LCA-Based Calculation of Sensitivity as Well as Specificity of the Assays, and Accuracy-Adjusted Prevalence in the Study Population
3.2. Comparison of the Cycle Threshold (Ct) Values between the Assays
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Positive Control Insert Based on Cryptosporidium spp. Sequences According to the NCBI GenBank Accession Numbers AY458612, AF248743 and AF188110. |
---|
GAATTCTACCGTGGCAATGACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCTAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTAATACAGGGAGGTAGTGACAAGAAATAACAATACAGGACTTTTTGGTTTTGTAATTGGAATGAGTTAAGAATTCATTAATTCAACAAATTGATACCGTTTGTCCTTCTGGTTTTGTTGAAGAAGGAAATAGATGTGTTCAATATCTCCCTGCAAATAAAATCTGTCCTCCTGGATTCAATTTGTCAGGACAACAATGTATGGCACCAGAATCAGCTGAATTAGAATCGACATGCCCACCTAATTCGAATTCCTACGTCTAACTTCACGTGTGTTTGCCAATGCATATGAAGTTATAGGGATACCAGTCGATTCTGATGATTCTGTGATTGGTAAAAAGTATAGAAAGCTCTCATTATTGATCCACCCTGATAAGACAAGTCATGAAAAGGCTAGAGAAGCGTTTGAAATACGAATTC |
References
- Bouzid, M.; Hunter, P.R.; Chalmers, R.M.; Tyler, K.M. Cryptosporidium pathogenicity and virulence. Clin. Microbiol. Rev. 2013, 26, 115–134. [Google Scholar] [CrossRef] [Green Version]
- Crawford, F.G.; Vermund, S.H. Human cryptosporidiosis. Crit. Rev. Microbiol. 1988, 16, 113–159. [Google Scholar] [CrossRef]
- Hoepelman, I.M. Human cryptosporidiosis. Int. J. STD AIDS 1996, 7 (Suppl. 1), 28–33. [Google Scholar] [CrossRef]
- Hagen, R.M.; Loderstaedt, U.; Frickmann, H. An evaluation of the potential use of Cryptosporidium species as agents for deliberate release. J. R. Army Med. Corps. 2014, 160, 289–294. [Google Scholar] [CrossRef]
- van Lieshout, L.; Roestenberg, M. Clinical consequences of new diagnostic tools for intestinal parasites. Clin. Microbiol. Infect. 2015, 21, 520–528. [Google Scholar] [CrossRef] [Green Version]
- Utzinger, J.; Botero-Kleiven, S.; Castelli, F.; Chiodini, P.L.; Edwards, H.; Köhler, N.; Gulletta, M.; Lebbad, M.; Manser, M.; Matthys, B.; et al. Microscopic diagnosis of sodium acetate-acetic acid-formalin-fixed stool samples for helminths and intestinal protozoa: A comparison among European reference laboratories. Clin. Microbiol. Infect. 2010, 16, 267–273. [Google Scholar] [CrossRef] [Green Version]
- Frickmann, H.; Hoffmann, T.; Köller, T.; Hahn, A.; Podbielski, A.; Landt, O.; Loderstädt, U.; Tannich, E. Comparison of five commercial real-time PCRs for in-vitro diagnosis of Entamoeba histolytica, Giardia duodenalis, Cryptosporidium spp., Cyclospora cayetanensis, and Dientamoeba fragilis in human stool samples. Travel. Med. Infect. Dis. 2021, 41, 102042. [Google Scholar] [CrossRef]
- Laude, A.; Valot, S.; Desoubeaux, G.; Argy, N.; Nourrisson, C.; Pomares, C.; Machouart, M.; Le Govic, Y.; Dalle, F.; Botterel, F.; et al. Is real-time PCR-based diagnosis similar in performance to routine parasitological examination for the identification of Giardia intestinalis, Cryptosporidium parvum/Cryptosporidium hominis and Entamoeba histolytica from stool samples? Evaluation of a new commercial multiplex PCR assay and literature review. Clin. Microbiol. Infect. 2016, 22, e1–e190. [Google Scholar]
- Paulos, S.; Saugar, J.M.; de Lucio, A.; Fuentes, I.; Mateo, M.; Carmena, D. Comparative performance evaluation of four commercial multiplex real-time PCR assays for the detection of the diarrhoea-causing protozoa Cryptosporidium hominis/parvum, Giardia duodenalis and Entamoeba histolytica. PLoS ONE 2019, 14, e0215068. [Google Scholar] [CrossRef] [PubMed]
- Pomari, E.; Piubelli, C.; Perandin, F.; Bisoffi, Z. Digital PCR: A new technology for diagnosis of parasitic infections. Clin. Microbiol. Infect. 2019, 25, 1510–1516. [Google Scholar] [CrossRef] [PubMed]
- Morio, F.; Poirier, P.; Le Govic, Y.; Laude, A.; Valot, S.; Desoubeaux, G.; Argy, N.; Nourrisson, C.; Pomares, C.; Machouart, M.; et al. Assessment of the first commercial multiplex PCR kit (ParaGENIE Crypto-Micro Real-Time PCR) for the detection of Cryptosporidium spp., Enterocytozoon bieneusi, and Encephalitozoon intestinalis from fecal samples. Diagn. Microbiol. Infect. Dis. 2019, 95, 34–37. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, B.; Li, J.; Yu, S.; Zhang, N.; Liu, S.; Zhang, Y.; Li, J.; Ma, N.; Cai, Y.; et al. Development of a Quantitative Real-Time PCR Assay for Detection of Cryptosporidium spp. Infection and Threatening Caused by Cryptosporidium parvum Subtype IIdA19G1 in Diarrhea Calves from Northeastern China. Vector Borne Zoonotic Dis. 2021, 21, 179–190. [Google Scholar] [CrossRef]
- Shin, J.H.; Lee, S.E.; Kim, T.S.; Ma, D.W.; Cho, S.H.; Chai, J.Y.; Shin, E.H. Development of Molecular Diagnosis Using Multiplex Real-Time PCR and T4 Phage Internal Control to Simultaneously Detect Cryptosporidium parvum, Giardia lamblia, and Cyclospora cayetanensis from Human Stool Samples. Korean J. Parasitol. 2018, 56, 419–427. [Google Scholar] [CrossRef] [PubMed]
- Higgins, J.A.; Fayer, R.; Trout, J.M.; Xiao, L.; Lal, A.A.; Kerby, S.; Jenkins, M.C. Real-time PCR for the detection of Cryptosporidium parvum. J. Microbiol. Methods 2001, 47, 323–337. [Google Scholar] [CrossRef]
- Adamska, M.; Leońska-Duniec, A.; Maciejewska, A.; Sawczuk, M.; Skotarczak, B. PCR and real time PCR for the detection of Cryptosporidium parvum oocyst DNA. Folia Biol. 2011, 59, 115–120. [Google Scholar]
- Burnet, J.B.; Ogorzaly, L.; Tissier, A.; Penny, C.; Cauchie, H.M. Novel quantitative TaqMan real-time PCR assays for detection of Cryptosporidium at the genus level and genotyping of major human and cattle-infecting species. J. Appl. Microbiol. 2013, 114, 1211–1222. [Google Scholar] [CrossRef]
- Mary, C.; Chapey, E.; Dutoit, E.; Guyot, K.; Hasseine, L.; Jeddi, F.; Menotti, J.; Paraud, C.; Pomares, C.; Rabodonirina, M.; et al. ANOFEL Cryptosporidium National Network. Multicentric evaluation of a new real-time PCR assay for quantification of Cryptosporidium spp. and identification of Cryptosporidium parvum and Cryptosporidium hominis. J. Clin. Microbiol. 2013, 51, 2556–2563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bouzid, M.; Elwin, K.; Nader, J.L.; Chalmers, R.M.; Hunter, P.R.; Tyler, K.M. Novel real-time PCR assays for the specific detection of human infective Cryptosporidium species. Virulence 2016, 7, 395–399. [Google Scholar] [CrossRef] [Green Version]
- Cheun, H.I.; Kim, K.; Yoon, S.; Lee, W.J.; Park, W.Y.; Sim, S.; Yu, J.R. Cryptosporidium hominis infection diagnosed by real-time PCR-RFLP. Korean J. Parasitol. 2013, 51, 353–355. [Google Scholar] [CrossRef]
- Amar, C.F.; Dear, P.H.; McLauchlin, J. Detection and identification by real time PCR/RFLP analyses of Cryptosporidium species from human faeces. Lett. Appl. Microbiol. 2004, 38, 217–222. [Google Scholar] [CrossRef]
- Robinson, G.; Elwin, K.; Chalmers, R.M. Cryptosporidium Diagnostic Assays: Molecular Detection. Methods Mol. Biol. 2020, 2052, 11–22. [Google Scholar]
- Hadfield, S.J.; Robinson, G.; Elwin, K.; Chalmers, R.M. Detection and differentiation of Cryptosporidium spp. in human clinical samples by use of real-time PCR. J. Clin. Microbiol. 2011, 49, 918–924. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stroup, S.E.; Roy, S.; Mchele, J.; Maro, V.; Ntabaguzi, S.; Siddique, A.; Kang, G.; Guerrant, R.L.; Kirkpatrick, B.D.; Fayer, R.; et al. Real-time PCR detection and speciation of Cryptosporidium infection using Scorpion probes. J. Med. Microbiol. 2006, 55 Pt 9, 1217–1222. [Google Scholar] [CrossRef]
- Jothikumar, N.; Hill, V.R. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp. Biochem. Biophys. Res. Commun. 2013, 436, 134–139. [Google Scholar] [CrossRef]
- Haque, R.; Roy, S.; Siddique, A.; Mondal, U.; Rahman, S.M.; Mondal, D.; Houpt, E.; Petri, W.A., Jr. Multiplex real-time PCR assay for detection of Entamoeba histolytica, Giardia intestinalis, and Cryptosporidium spp. Am. J. Trop. Med. Hyg. 2007, 76, 713–717. [Google Scholar] [CrossRef] [Green Version]
- Stroup, S.; Tongjai, S.; Swai, N.; Maro, A.; Kibiki, G.; Houpt, E.R. Dual probe DNA capture for sensitive real-time PCR detection of Cryptosporidium and Giardia. Mol. Cell. Probes. 2012, 26, 104–106. [Google Scholar] [CrossRef] [Green Version]
- Stark, D.; Al-Qassab, S.E.; Barratt, J.L.; Stanley, K.; Roberts, T.; Marriott, D.; Harkness, J.; Ellis, J.T. Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool samples. J. Clin. Microbiol. 2011, 49, 257–262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Lint, P.; Rossen, J.W.; Vermeiren, S.; Ver Elst, K.; Weekx, S.; Van Schaeren, J.; Jeurissen, A. Detection of Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica in clinical stool samples by using multiplex real-time PCR after automated DNA isolation. Acta Clin. Belg. 2013, 68, 188–192. [Google Scholar] [CrossRef]
- Madison-Antenucci, S.; Relich, R.F.; Doyle, L.; Espina, N.; Fuller, D.; Karchmer, T.; Lainesse, A.; Mortensen, J.E.; Pancholi, P.; Veros, W.; et al. Multicenter Evaluation of BD Max Enteric Parasite Real-Time PCR Assay for Detection of Giardia duodenalis, Cryptosporidium hominis, Cryptosporidium parvum, and Entamoeba histolytica. J. Clin. Microbiol. 2016, 54, 2681–2688. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goldfarb, D.M.; Dixon, B.; Moldovan, I.; Barrowman, N.; Mattison, K.; Zentner, C.; Baikie, M.; Bidawid, S.; Chan, F.; Slinger, R. Nanolitre real-time PCR detection of bacterial, parasitic, and viral agents from patients with diarrhoea in Nunavut, Canada. Int. J. Circumpolar Health 2013, 72, 19903. [Google Scholar] [CrossRef] [PubMed]
- Mergen, K.; Espina, N.; Teal, A.; Madison-Antenucci, S. Detecting Cryptosporidium in Stool Samples Submitted to a Reference Laboratory. Am. J. Trop. Med. Hyg. 2020, 103, 421–427. [Google Scholar] [CrossRef] [PubMed]
- Limor, J.R.; Lal, A.A.; Xiao, L. Detection and differentiation of Cryptosporidium parasites that are pathogenic for humans by real-time PCR. J. Clin. Microbiol. 2002, 40, 2335–2338. [Google Scholar] [CrossRef] [Green Version]
- Godiwala, N.T.; Vandewalle, A.; Ward, H.D.; Leav, B.A. Quantification of in vitro and in vivo Cryptosporidium parvum infection by using real-time PCR. Appl. Environ. Microbiol. 2006, 72, 4484–4488. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Köller, T.; Hahn, A.; Altangerel, E.; Verweij, J.J.; Landt, O.; Kann, S.; Dekker, D.; May, J.; Loderstädt, U.; Podbielski, A.; et al. Comparison of commercial and in-house real-time PCR platforms for 15 parasites and microsporidia in human stool samples without a gold standard. Acta Trop. 2020, 207, 105516. [Google Scholar] [CrossRef] [PubMed]
- Won, E.J.; Kim, S.H.; Kee, S.J.; Shin, J.H.; Suh, S.P.; Chai, J.Y.; Ryang, D.W.; Shin, M.G. Multiplex Real-Time PCR Assay Targeting Eight Parasites Customized to the Korean Population: Potential Use for Detection in Diarrheal Stool Samples from Gastroenteritis Patients. PLoS ONE 2016, 11, e0166957. [Google Scholar] [CrossRef]
- Hønsvall, B.K.; Robertson, L.J. Real-time nucleic acid sequence-based amplification (NASBA) assay targeting MIC1 for detection of Cryptosporidium parvum and Cryptosporidium hominis oocysts. Exp. Parasitol. 2017, 172, 61–67. [Google Scholar] [CrossRef]
- Verweij, J.J.; Blangé, R.A.; Templeton, K.; Schinkel, J.; Brienen, E.A.; van Rooyen, M.A.; van Lieshout, L.; Polderman, A.M. Simultaneous detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum in fecal samples by using multiplex real-time PCR. J. Clin. Microbiol. 2004, 42, 1220–1223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tanriverdi, S.; Tanyeli, A.; Başlamişli, F.; Köksal, F.; Kilinç, Y.; Feng, X.; Batzer, G.; Tzipori, S.; Widmer, G. Detection and genotyping of oocysts of Cryptosporidium parvum by real-time PCR and melting curve analysis. J. Clin. Microbiol. 2002, 40, 3237–3244. [Google Scholar] [CrossRef] [Green Version]
- Amar, C.F.L.; Dear, P.H.; McLauchlin, J. Detection and genotyping by real-time PCR/RFLP analyses of Giardia duodenalis from human faeces. J. Med. Microbiol. 2003, 52 Pt 8, 681–683. [Google Scholar] [CrossRef] [Green Version]
- Cunha, F.S.; Peralta, R.H.S.; Peralta, J.M. New insights into the detection and molecular characterization of Cryptosporidium with emphasis in Brazilian studies: A review. Rev. Inst. Med. Trop. Sao Paulo 2019, 61, e28. [Google Scholar] [CrossRef]
- ten Hove, R.; Schuurman, T.; Kooistra, M.; Möller, L.; van Lieshout, L.; Verweij, J.J. Detection of diarrhoea-causing protozoa in general practice patients in The Netherlands by multiplex real-time PCR. Clin. Microbiol. Infect. 2007, 13, 1001–1007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maas, L.; Dorigo-Zetsma, J.W.; de Groot, C.J.; Bouter, S.; Plötz, F.B.; van Ewijk, B.E. Detection of intestinal protozoa in paediatric patients with gastrointestinal symptoms by multiplex real-time PCR. Clin. Microbiol. Infect. 2014, 20, 545–550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lamien-Meda, A.; Schneider, R.; Walochnik, J.; Auer, H.; Wiedermann, U.; Leitsch, D. A novel 5-Plex qPCR-HRM assay detecting human diarrheal parasites. Gut Pathog. 2020, 12, 27. [Google Scholar] [CrossRef] [PubMed]
- Zebardast, N.; Yeganeh, F.; Gharavi, M.J.; Abadi, A.; Tabaei, S.J.S.; Haghighi, A. Simultaneous detection and differentiation of Entamoeba histolytica, E. dispar, E. moshkovskii, Giardia lamblia and Cryptosporidium spp. in human fecal samples using multiplex PCR and qPCR-MCA. Acta Trop. 2016, 162, 233–238. [Google Scholar] [CrossRef] [PubMed]
- Van den Bossche, D.; Cnops, L.; Verschueren, J.; Van Esbroeck, M. Comparison of four rapid diagnostic tests, ELISA, microscopy and PCR for the detection of Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica in feces. J. Microbiol. Methods 2015, 110, 78–84. [Google Scholar] [CrossRef] [PubMed]
- Parr, J.B.; Sevilleja, J.E.; Samie, A.; Alcantara, C.; Stroup, S.E.; Kohli, A.; Fayer, R.; Lima, A.A.; Houpt, E.R.; Guerrant, R.L. Detection and quantification of Cryptosporidium in HCT-8 cells and human fecal specimens using real-time polymerase chain reaction. Am. J. Trop. Med. Hyg. 2007, 76, 938–942. [Google Scholar] [CrossRef] [PubMed]
- Shrivastava, A.K.; Panda, S.; Kumar, S.; Sahu, P.S. Two novel genomic DNA sequences as common diagnostic targets to detect Cryptosporidium hominis and Cryptosporidium parvum: Development of quantitative polymerase chain reaction assays, and clinical evaluation. Indian J. Med. Microbiol. 2020, 38, 430–439. [Google Scholar] [CrossRef] [PubMed]
- Fontaine, M.; Guillot, E. Development of a TaqMan quantitative PCR assay specific for Cryptosporidium parvum. FEMS Microbiol. Lett. 2002, 214, 13–17. [Google Scholar] [CrossRef]
- Zhan, Z.; Guo, J.; Xiao, Y.; He, Z.; Xia, X.; Huang, Z.; Guan, H.; Ling, X.; Li, J.; Diao, B.; et al. Comparison of BioFire FilmArray gastrointestinal panel versus Luminex xTAG Gastrointestinal Pathogen Panel (xTAG GPP) for diarrheal pathogen detection in China. Int. J. Infect. Dis. 2020, 99, 414–420. [Google Scholar] [CrossRef]
- Mejia, R.; Vicuña, Y.; Broncano, N.; Sandoval, C.; Vaca, M.; Chico, M.; Cooper, P.J.; Nutman, T.B. A novel, multi-parallel, real-time polymerase chain reaction approach for eight gastrointestinal parasites provides improved diagnostic capabilities to resource-limited at-risk populations. Am. J. Trop. Med. Hyg. 2013, 88, 1041–1047. [Google Scholar] [CrossRef]
- Jothikumar, N.; da Silva, A.J.; Moura, I.; Qvarnstrom, Y.; Hill, V.R. Detection and differentiation of Cryptosporidium hominis and Cryptosporidium parvum by dual TaqMan assays. J. Med. Microbiol. 2008, 57 Pt 9, 1099–1105. [Google Scholar] [CrossRef] [Green Version]
- Khalil, S.; Mirdha, B.R.; Paul, J.; Panda, A.; Makharia, G.; Chaudhry, R.; Bhatnagar, S. Development and evaluation of molecular methods for detection of Cryptosporidium spp. in human clinical samples. Exp. Parasitol. 2016, 170, 207–213. [Google Scholar] [CrossRef]
- Taniuchi, M.; Verweij, J.J.; Noor, Z.; Sobuz, S.U.; Lieshout, L.v.; Petri, W.A., Jr.; Haque, R.; Houpt, E.R. High throughput multiplex PCR and probe-based detection with Luminex beads for seven intestinal parasites. Am. J. Trop. Med. Hyg. 2011, 84, 332–337. [Google Scholar] [PubMed] [Green Version]
- Hartmeyer, G.N.; Hoegh, S.V.; Skov, M.N.; Dessau, R.B.; Kemp, M. Selecting PCR for the Diagnosis of Intestinal Parasitosis: Choice of Targets, Evaluation of In-House Assays, and Comparison with Commercial Kits. J. Parasitol. Res. 2017, 2017, 6205257. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.; Gratz, J.; Amour, C.; Kibiki, G.; Becker, S.; Janaki, L.; Verweij, J.J.; Taniuchi, M.; Sobuz, S.U.; Haque, R.; et al. A laboratory-developed TaqMan Array Card for simultaneous detection of 19 enteropathogens. J. Clin. Microbiol. 2013, 51, 472–480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wessels, E.; Rusman, L.G.; van Bussel, M.J.; Claas, E.C. Added value of multiplex Luminex gastrointestinal Pathogen Panel (xTAG® GPP) testing in the diagnosis of infectious gastroenteritis. Clin. Microbiol. Infect. 2014, 20, O182–O187. [Google Scholar] [PubMed] [Green Version]
- ten Hove, R.J.; van Esbroeck, M.; Vervoort, T.; van den Ende, J.; van Lieshout, L.; Verweij, J.J. Molecular diagnostics of intestinal parasites in returning travellers. Eur. J. Clin. Microbiol. Infect. Dis. 2009, 28, 1045–1053. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parčina, M.; Reiter-Owona, I.; Mockenhaupt, F.P.; Vojvoda, V.; Gahutu, J.B.; Hoerauf, A.; Ignatius, R. Highly sensitive and specific detection of Giardia duodenalis, Entamoeba histolytica, and Cryptosporidium spp. in human stool samples by the BD MAX™ Enteric Parasite Panel. Parasitol. Res. 2018, 117, 447–451. [Google Scholar] [CrossRef]
- Schuurs, T.A.; Koelewijn, R.; Brienen, E.A.T.; Kortbeek, T.; Mank, T.G.; Mulder, B.; Stelma, F.F.; van Lieshout, L.; van Hellemond, J.J. Harmonization of PCR-based detection of intestinal pathogens: Experiences from the Dutch external quality assessment scheme on molecular diagnosis of protozoa in stool samples. Clin. Chem. Lab. Med. 2018, 56, 1722–1727. [Google Scholar]
- Tanriverdi, S.; Arslan, M.O.; Akiyoshi, D.E.; Tzipori, S.; Widmer, G. Identification of genotypically ixed Cryptosporidium parvum populations in humans and calves. Mol. Biochem. Parasitol. 2003, 130, 13–22. [Google Scholar] [CrossRef]
- Puebla, L.E.J.; Núñez-Fernández, F.A.; Nodarse, J.F.; Millán, I.A.; Rodríguez, I.C.; Silva, I.M.; Valdés, L.A.; Robertson, L.J. Diagnosis of intestinal protozoan infections in patients in Cuba by microscopy and molecular methods: Advantages and disadvantages. J. Microbiol. Methods 2020, 179, 106102. [Google Scholar] [CrossRef] [PubMed]
- Shaposhnik, E.G.; Abozaid, S.; Grossman, T.; Marva, E.; On, A.; Azrad, M.; Peretz, A. The Prevalence of Cryptosporidium among Children Hospitalized because of Gastrointestinal Symptoms and the Efficiency of Diagnostic Methods for Cryptosporidium. Am. J. Trop. Med. Hyg. 2019, 101, 160–163. [Google Scholar] [CrossRef]
- Calderaro, A.; Montecchini, S.; Gorrini, C.; Dettori, G.; Chezzi, C. Similar diagnostic performances of antigen detection and nucleic acid detection of Cryptosporidium spp. in a low-prevalence setting. Diagn. Microbiol. Infect. Dis. 2011, 70, 72–77. [Google Scholar] [CrossRef] [PubMed]
- Chalmers, R.M.; Campbell, B.M.; Crouch, N.; Charlett, A.; Davies, A.P. Comparison of diagnostic sensitivity and specificity of seven Cryptosporidium assays used in the UK. J. Med. Microbiol. 2011, 60 Pt 11, 1598–1604. [Google Scholar] [CrossRef] [Green Version]
- Elsafi, S.H.; Al-Maqati, T.N.; Hussein, M.I.; Adam, A.A.; Hassan, M.M.; Al Zahrani, E.M. Comparison of microscopy, rapid immunoassay, and molecular techniques for the detection of Giardia lamblia and Cryptosporidium parvum. Parasitol. Res. 2013, 112, 1641–1646. [Google Scholar] [CrossRef] [PubMed]
- Johansen, Ø.H.; Abdissa, A.; Zangenberg, M.; Mekonnen, Z.; Eshetu, B.; Bjørang, O.; Alemu, Y.; Sharew, B.; Langeland, N.; Robertson, L.J.; et al. Performance and operational feasibility of two diagnostic tests for cryptosporidiosis in children (CRYPTO-POC): A clinical, prospective, diagnostic accuracy study. Lancet Infect. Dis. 2021, 21, 722–730. [Google Scholar]
- van Coppenraet, L.E.B.; Wallinga, J.A.; Ruijs, G.J.; Bruins, M.J.; Verweij, J.J. Parasitological diagnosis combining an internally controlled real-time PCR assay for the detection of four protozoa in stool samples with a testing algorithm for microscopy. Clin. Microbiol. Infect. 2009, 15, 869–874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koltas, I.S.; Elgun, G.; Demirkazık, M. The importance of Real-Time Polymerase Chain Reaction method in diagnosis of intestinal parasites in cases with diarrhea. Trop. Biomed. 2017, 34, 895–902. [Google Scholar]
- Velásquez, J.N.; Pantano, M.L.; Vittar, N.; Nigro, M.G.; Figueiras, O.; Astudillo, O.G.; Ricart, J.; Della Paolera, D.; Carnevale, S. First detection of Cryptosporidium DNA in blood and cerebrospinal fluid of HIV-infected patients. Parasitol. Res. 2018, 117, 875–881. [Google Scholar] [CrossRef] [PubMed]
- Mero, S.; Kirveskari, J.; Antikainen, J.; Ursing, J.; Rombo, L.; Kofoed, P.E.; Kantele, A. Multiplex PCR detection of Cryptosporidium sp, Giardia lamblia and Entamoeba histolytica directly from dried stool samples from Guinea-Bissauan children with diarrhoea. Infect. Dis. 2017, 49, 655–663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Natarajan, G.; Kabir, M.; Perin, J.; Hossain, B.; Debes, A.; Haque, R.; George, C.M. Whatman Protein Saver Cards for Storage and Detection of Parasitic Enteropathogens. Am. J. Trop. Med. Hyg. 2018, 99, 1613–1618. [Google Scholar] [CrossRef] [PubMed]
- O’Leary, J.K.; Blake, L.; Corcoran, D.; Elwin, K.; Chalmers, R.; Lucey, B.; Sleator, R.D. Cryptosporidium spp. surveillance and epidemiology in Ireland: A longitudinal cohort study employing duplex real-time PCR based speciation of clinical cases. J. Clin. Pathol. 2020, 73, 758–761. [Google Scholar] [CrossRef]
- Nazeer, J.T.; Khalifa, K.E.S.; von Thien, H.; El-Sibaei, M.M.; Abdel-Hamid, M.Y.; Tawfik, R.A.; Tannich, E. Use of multiplex real-time PCR for detection of common diarrhea causing protozoan parasites in Egypt. Parasitol. Res. 2013, 112, 595–601. [Google Scholar] [CrossRef]
- Velasco, J.M.; Yoon, I.K.; Mason, C.J.; Jarman, R.G.; Bodhidatta, L.; Klungthong, C.; Silapong, S.; Valderama, M.T.; Wongstitwilairoong, T.; Torres, A.G.; et al. Applications of PCR (real-time and MassTag) and enzyme-linked immunosorbent assay in diagnosis of respiratory infections and diarrheal illness among deployed U.S. military personnel during exercise Balikatan 2009, Philippines. Mil. Med. 2011, 176, 1096–1100. [Google Scholar] [CrossRef] [Green Version]
- Efunshile, M.A.; Ngwu, B.A.; Kurtzhals, J.A.; Sahar, S.; König, B.; Stensvold, C.R. Molecular Detection of the Carriage Rate of Four Intestinal Protozoa with Real-Time Polymerase Chain Reaction: Possible Overdiagnosis of Entamoeba histolytica in Nigeria. Am. J. Trop. Med. Hyg. 2015, 93, 257–262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Incani, R.N.; Ferrer, E.; Hoek, D.; Ramak, R.; Roelfsema, J.; Mughini-Gras, L.; Kortbeek, T.; Pinelli, E. Diagnosis of intestinal parasites in a rural community of Venezuela: Advantages and disadvantages of using microscopy or RT-PCR. Acta Trop. 2017, 167, 64–70. [Google Scholar] [CrossRef]
- Ögren, J.; Dienus, O.; Matussek, A. Optimization of routine microscopic and molecular detection of parasitic protozoa in SAF-fixed faecal samples in Sweden. Infect. Dis. 2020, 52, 87–96. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elwin, K.; Robinson, G.; Hadfield, S.J.; Fairclough, H.V.; Iturriza-Gómara, M.; Chalmers, R.M. A comparison of two approaches to extracting Cryptosporidium DNA from human stools as measured by a real-time PCR assay. J. Microbiol. Methods 2012, 89, 38–40. [Google Scholar] [CrossRef]
- Valeix, N.; Costa, D.; Basmaciyan, L.; Valot, S.; Vincent, A.; Razakandrainibe, R.; Robert-Gangneux, F.; Nourrisson, C.; Pereira, B.; Fréalle, E.; et al. Multicenter Comparative Study of Six Cryptosporidium parvum DNA Extraction Protocols Including Mechanical Pretreatment from Stool Samples. Microorganisms 2020, 8, 1450. [Google Scholar] [CrossRef]
- Halstead, F.D.; Lee, A.V.; Couto-Parada, X.; Polley, S.D.; Ling, C.; Jenkins, C.; Chalmers, R.M.; Elwin, K.; Gray, J.J.; Iturriza-Gómara, M.; et al. Universal extraction method for gastrointestinal pathogens. J. Med. Microbiol. 2013, 62 Pt 10, 1535–1539. [Google Scholar] [CrossRef] [Green Version]
- Claudel, L.; Valeix, N.; Basmaciyan, L.; Pereira, B.; Costa, D.; Vincent, A.; Valot, S.; Favennec, L.; Dalle, F. Comparative Study of Eleven Mechanical Pretreatment Protocols for Cryptosporidium parvum DNA Extraction from Stool Samples. Microorganisms 2021, 9, 297. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, T.; Hahn, A.; Verweij, J.J.; Leboulle, G.; Landt, O.; Strube, C.; Kann, S.; Dekker, D.; May, J.; Frickmann, H.; et al. Differing Effects of Standard and Harsh Nucleic Acid Extraction Procedures on Diagnostic Helminth Real-Time PCRs Applied to Human Stool Samples. Pathogens 2021, 10, 188. [Google Scholar] [CrossRef] [PubMed]
- Woolsey, I.D.; Blomstrand, B.; Øines, Ø.; Enemark, H.L. Assessment of differences between DNA content of cell-cultured and freely suspended oocysts of Cryptosporidium parvum and their suitability as DNA standards in qPCR. Parasites Vectors 2019, 12, 596. [Google Scholar] [CrossRef] [PubMed]
- Paziewska-Harris, A.; Schoone, G.; Schallig, H.D. An easy ‘one tube’ method to estimate viability of Cryptosporidium oocysts using real-time qPCR. Parasitol. Res. 2016, 115, 2873–2877. [Google Scholar] [CrossRef]
- Fontaine, M.; Guillot, E. Study of 18S rRNA and rDNA stability by real-time RT-PCR in heat-inactivated Cryptosporidium parvum oocysts. FEMS Microbiol. Lett. 2003, 226, 237–243. [Google Scholar] [CrossRef] [Green Version]
- Zautner, A.E.; Groß, U.; Emele, M.F.; Hagen, R.M.; Frickmann, H. More Pathogenicity or Just More Pathogens?-On the Interpretation Problem of Multiple Pathogen Detections with Diagnostic Multiplex Assays. Front. Microbiol. 2017, 8, 1210. [Google Scholar] [CrossRef] [PubMed]
- Elfving, K.; Andersson, M.; Msellem, M.I.; Welinder-Olsson, C.; Petzold, M.; Björkman, A.; Trollfors, B.; Mårtensson, A.; Lindh, M. Real-time PCR threshold cycle cutoffs help to identify agents causing acute childhood diarrhea in Zanzibar. J. Clin. Microbiol. 2014, 52, 916–923. [Google Scholar] [CrossRef] [Green Version]
- Rogawski, E.T.; Liu, J.; Platts-Mills, J.A.; Kabir, F.; Lertsethtakarn, P.; Siguas, M.; Khan, S.S.; Praharaj, I.; Murei, A.; Nshama, R.; et al. Use of quantitative molecular diagnostic methods to investigate the effect of enteropathogen infections on linear growth in children in low-resource settings: Longitudinal analysis of results from the MAL-ED cohort study. Lancet Glob. Health 2018, 6, e1319–e1328. [Google Scholar] [CrossRef] [Green Version]
- Schotte, U.; Hoffmann, T.; Schwarz, N.G.; Rojak, S.; Lusingu, J.; Minja, D.; Kaseka, J.; Mbwana, J.; Gesase, S.; May, J.; et al. Study of enteric pathogens among children in the tropics and effects of prolonged storage of stool samples. Lett. Appl. Microbiol. 2021, 72, 774–782. [Google Scholar] [CrossRef] [PubMed]
- Platts-Mills, J.A.; Gratz, J.; Mduma, E.; Svensen, E.; Amour, C.; Liu, J.; Maro, A.; Saidi, Q.; Swai, N.; Kumburu, H.; et al. Association between stool enteropathogen quantity and disease in Tanzanian children using TaqMan array cards: A nested case-control study. Am. J. Trop. Med. Hyg. 2014, 90, 133–138. [Google Scholar]
- Verweij, J.J.; Stensvold, C.R. Molecular testing for clinical diagnosis and epidemiological investigations of intestinal parasitic infections. Clin. Microbiol. Rev. 2014, 27, 371–418. [Google Scholar]
- Guy, R.A.; Payment, P.; Krull, U.J.; Horgen, P.A. Real-time PCR for quantification of Giardia and Cryptosporidium in environmental water samples and sewage. Appl. Environ. Microbiol. 2003, 69, 5178–5185. [Google Scholar]
- Laxer, M.A.; Timblin, B.K.; Patel, R.J. DNA sequences for the specific detection of Cryptosporidium parvum by the polymerase chain reaction. Am. J. Trop. Med. Hyg. 1991, 45, 688–694. [Google Scholar] [PubMed]
- Tanida, K.; Hahn, A.; Eberhardt, K.A.; Tannich, E.; Landt, O.; Kann, S.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; et al. Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples. Pathogens 2021, 10, 656. [Google Scholar] [PubMed]
- Hahn, A.; Podbielski, A.; Meyer, T.; Zautner, A.E.; Loderstädt, U.; Schwarz, N.G.; Krüger, A.; Cadar, D.; Frickmann, H. On detection thresholds-a review on diagnostic approaches in the infectious disease laboratory and the interpretation of their results. Acta Trop. 2020, 205, 105377. [Google Scholar] [PubMed]
- Qu, Y.; Tan, M.; Kutner, M.H. Random effects models in latent class analysis for evaluating accuracy of diagnostic tests. Biometrics 1996, 52, 797–810. [Google Scholar]
- Eberhardt, K.A.; Sarfo, F.S.; Dompreh, A.; Kuffour, E.O.; Geldmacher, C.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; et al. Helicobacter pylori Coinfection Is Associated with Decreased Markers of Immune Activation in ART-Naive HIV-Positive and in HIV-Negative Individuals in Ghana. Clin. Infect. Dis. 2015, 61, 1615–1623. [Google Scholar] [PubMed] [Green Version]
- Sarfo, F.S.; Eberhardt, K.A.; Dompreh, A.; Kuffour, E.O.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; Oteng-Seifah, E.E.; et al. Helicobacter pylori Infection Is Associated with Higher CD4 T Cell Counts and Lower HIV-1 Viral Loads in ART-Naïve HIV-Positive Patients in Ghana. PLoS ONE 2015, 10, e0143388. [Google Scholar]
- Blohm, M.; Hahn, A.; Hagen, R.M.; Eberhardt, K.A.; Rohde, H.; Leboulle, G.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; et al. Comparison of Two Real-Time PCR Assays Targeting Ribosomal Sequences for the Identification of Cystoisospora belli in Human Stool Samples. Pathogens 2021, 10, 1053. [Google Scholar]
- Bossuyt, P.M.; Reitsma, J.B.; Bruns, D.E.; Gatsonis, C.A.; Glasziou, P.P.; Irwig, L.; Lijmer, J.G.; Moher, D.; Rennie, D.; De Vet, H.C.W.; et al. STARD 2015: An updated list of essential items for reporting diagnostic accuracy studies. BMJ 2015, 351, h5527. [Google Scholar]
- Niesters, H.G. Quantitation of Viral Load Using Real-Time Amplification Techniques. Methods 2001, 25, 419–429. [Google Scholar] [CrossRef] [PubMed]
- Landis, J.R.; Koch, G.G. The Measurement of Observer Agreement for Categorical Data. Biometrics 1977, 33, 159–174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frickmann, H.; Hinz, R.; Hagen, R.M. Comparison of an automated nucleic acid extraction system with the column-based procedure. Eur. J. Microbiol. Immunol. 2015, 5, 94–102. [Google Scholar]
- Schawaller, M.; Wiemer, D.; Hagen, R.M.; Frickmann, H. Infectious diseases in German military personnel after predominantly tropical deployments: A retrospective assessment over 13 years. BMJ Mil. Health 2020. [Google Scholar] [CrossRef] [PubMed]
- Frickmann, H.; Warnke, P.; Frey, C.; Schmidt, S.; Janke, C.; Erkens, K.; Schotte, U.; Köller, T.; Maaßen, W.; Podbielski, A.; et al. Surveillance of Food- and Smear-Transmitted Pathogens in European Soldiers with Diarrhea on Deployment in the Tropics: Experience from the European Union Training Mission (EUTM) Mali. Biomed. Res. Int. 2015, 2015, 573904. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frickmann, H.; Schwarz, N.G.; Wiemer, D.F.; Fischer, M.; Tannich, E.; Scheid, P.L.; Müller, M.; Schotte, U.; Bock, W.; Hagen, R.M. Food and drinking water hygiene and intestinal protozoa in deployed German soldiers. Eur. J. Microbiol. Immunol. 2013, 3, 53–60. [Google Scholar] [CrossRef] [Green Version]
Forward Primer Name | Forward Primer Sequence | Reverse Primer Name | Reverse Primer Sequence | Probe Name | Probe Sequence |
---|---|---|---|---|---|
SSU rRNA gene PCR according to [51] | |||||
JVAF | 5′-ATGACGGGTAACGGGGAAT-3′ | JVAR | 5′-CCAATTACAAAACCAAAAAGTCC-3′ | JVAP18S | 5′-CY3-CGCGCCTGCTGCCTTCCTTAGATG-BHQ-2-3′ |
DnaJ-like protein gene according to [48] | |||||
DnaJ F | 5′-CGCTTCTCTAGCCTTTTCATGA-3′ | DnaJ R | 5′-CTTCACGTGTGTTTGCCAAT-3′ | DnaJ P | 5′-CY5-CCAATCACAGAATCATCAGAATCGACTGGTATC-BHQ-2-3′ |
COWP gene PCR according to [92] | |||||
COWP P702 F | 5′-CAAATTGATACCGTTTGTCCTTCTG-3′ | COWP P702 R | 5′-GGCATGTCGATTCTAATTCAGCT-3′ | COWP P702 P | 5′-ROX5-TGCCATACATTGTTGTCCTGACAAATTGAAT-BHQ-2-3′ |
Assay | n | Positives (%) | Sensitivity (0.95 CI) | Specificity (0.95 CI) | Kappa (0.95 CI) |
---|---|---|---|---|---|
DnaJ PCR | 967 | 80 (8.27) | 0.888 (0.770, 0.949) | 0.969 (0.955, 0.978) | 0.663 (0.574, 0.744) |
COWP PCR | 967 | 56 (5.79) | 0.900 (0.773, 0.960) | 0.996 (0.989, 0.998) | |
SSU rRNA gene PCR | 967 | 86 (8.89) | 1 (0, 1) | 0.969 (0.956, 0.979) | |
Prevalence (0.95 CI) | 0.060 (0.047, 0.078) |
DnaJ PCR | COWP PCR | SSU rRNA Gene PCR | |||||
---|---|---|---|---|---|---|---|
Negative | Positive | Negative | Positive | Negative | Positive | ||
DnaJ PCR | negative | 887 | 0 | ||||
positive | 0 | 80 | |||||
COWP PCR | negative | 878 | 33 | 911 | 0 | ||
positive | 9 | 47 | 0 | 56 | |||
SSU rRNA gene PCR | negative | 854 | 27 | 878 | 3 | 881 | 0 |
positive | 33 | 53 | 33 | 53 | 0 | 86 |
Assay | n | Mean (SD) | Median (Min, Max) |
---|---|---|---|
DnaJ PCR | 80 | 34.14 (4.87) | 34.41 (22.12, 41.50) |
COWP PCR | 56 | 32.14 (3.84) | 33.16 (22.30, 38.07) |
SSU rRNA gene PCR | 86 | 32.09 (4.31) | 33.21 (20.38, 39.16) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Weinreich, F.; Hahn, A.; Eberhardt, K.A.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; Loderstädt, U. Comparison of Three Real-Time PCR Assays Targeting the SSU rRNA Gene, the COWP Gene and the DnaJ-Like Protein Gene for the Diagnosis of Cryptosporidium spp. in Stool Samples. Pathogens 2021, 10, 1131. https://doi.org/10.3390/pathogens10091131
Weinreich F, Hahn A, Eberhardt KA, Feldt T, Sarfo FS, Di Cristanziano V, Frickmann H, Loderstädt U. Comparison of Three Real-Time PCR Assays Targeting the SSU rRNA Gene, the COWP Gene and the DnaJ-Like Protein Gene for the Diagnosis of Cryptosporidium spp. in Stool Samples. Pathogens. 2021; 10(9):1131. https://doi.org/10.3390/pathogens10091131
Chicago/Turabian StyleWeinreich, Felix, Andreas Hahn, Kirsten Alexandra Eberhardt, Torsten Feldt, Fred Stephen Sarfo, Veronica Di Cristanziano, Hagen Frickmann, and Ulrike Loderstädt. 2021. "Comparison of Three Real-Time PCR Assays Targeting the SSU rRNA Gene, the COWP Gene and the DnaJ-Like Protein Gene for the Diagnosis of Cryptosporidium spp. in Stool Samples" Pathogens 10, no. 9: 1131. https://doi.org/10.3390/pathogens10091131