Next Article in Journal
Strategies of Influenza A Virus to Ensure the Translation of Viral mRNAs
Previous Article in Journal
SARS-CoV-2 and Animals: From a Mirror Image to a Storm Warning
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 11
Issue 12
10.3390/pathogens11121520
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Investigation of Parasitic Nematodes Detected in the Feces of Wild Carnivores in the Eastern Qinghai-Tibet Plateau, China

by
Qilu Chen
1,
Xu Wang
1,*,
Chunyang Li
2,
Weiping Wu
1,
Kaige Zhang
1,
Xueying Deng
1,
Yi Xie
1 and
Yayi Guan
1,*
1
NHC Key Laboratory of Parasite and Vector Biology, WHO Collaborating Centre for Tropical Diseases, National Center for International Research on Tropical Diseases, National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research), Shanghai 200025, China
2
Tianjin Cancer Hospital Airport Hospital, Tianjin 300308, China
*
Authors to whom correspondence should be addressed.
Pathogens 2022, 11(12), 1520; https://doi.org/10.3390/pathogens11121520
Submission received: 11 November 2022 / Revised: 7 December 2022 / Accepted: 7 December 2022 / Published: 12 December 2022
(This article belongs to the Section Parasitic Pathogens)
Browse Figures
Versions Notes

Abstract

:
Wildlife shares grazing areas with herders in the eastern Qinghai-Tibet Plateau, and humans can be infected by zoonotic nematodes through direct contact with animals or contaminated water. In this study, fecal samples (n = 296) from wild carnivores were collected to explore the infection rate and molecular genetic characteristics of nematodes by stratified random sampling in the survey areas. Host species and the nematodes they carried were then identified using 16S rRNA and 18S rRNA gene sequencing, respectively. Statistical analysis, neutrality tests, genetic diversity analysis and Bayesian inferred trees were performed to complete the study. In total, 10 species of nematodes were detected in 240 feces from six species of carnivores identified (including dominant Vulpes ferrilata and Vulpes vulpes), namely Uncinaria stenocephala, Toxascaris sp., Crenosoma vulpis, Parapharyngodon bainae, Oesophagostomum muntiacum, Aspiculuris tetraptera, Mastophorus muris, Nematodirus spathiger, Muellerius capillaris, and Molineus patens. Among these nematodes, U. stenocephala (35.83%, 86/240) and Toxascaris sp. (14.58%, 35/240) were detected at higher rates than the other nematodes (χ2 = 516.909, p < 0.05). Of 17 and 18 haplotypes were found based on the ITS1 gene for U. stenocephala and nad1 gene for Toxascaris sp., respectively. For the first time, using molecular methods, we report the infection of V. ferrilata by U. stenocephala, a potential zoonotic parasite, and suggest Toxascaris sp. may be a newly discovered nematode that lives within the fox intestine.

1. Introduction

Nematodes are unsegmented helminths widely distributed in freshwater, brackish water, soil, plants, and animals [1]. According to the reports, over 25,000 species of nematodes have been described so far, 12,000 of which are vertebrate parasitic nematodes [2]. For humans, some of the most prevalent but neglected tropical diseases are caused by nematode infections (e.g., ascariasis, hookworm disease, whipworm disease, lymphatic filariasis, and onchocerciasis), which lead to a decline in health and productivity, adversely affecting socio-economic development [3]. The statistics based on the global burden of diseases caused by soil-transmitted nematodes showed that ascariasis, trichuriasis, and hookworm disease, were estimated to result in 4.5 and 39 million disability-adjusted life-years (DALYs) [4]. Among them, certain nematodes are among the most common infectious pathogens in developing countries with poor sanitation, potentially affecting the psychological and physical development of children by causing anemia, malnutrition, stunting, and cognitive impairment [5,6]. According to the third national survey of important zoonotic diseases in China in 2015, Sichuan Province is a highly endemic area for soil-derived nematodes with a 23.55% infection rate, and herders are a key population experiencing soil-derived nematode infections [7].
Wild carnivores carry a variety of nematodes, some of which are zoonotic parasites that can cause human infection through contaminated water, food, or direct contact, and nematodiasis including toxocariasis and hookworm diseases could be transmitted from wild hosts to humans [8]. Clinically, human infections with Toxocara spp. can cause covert toxocariasis, neurotoxocariasis (e.g., eosinophilic meningoencephalitis), ocular larva migrans, and visceral larva migrans, affecting millions of children and adolescents worldwide [9,10]. From 1983 to 2019, a total of 103 documented human toxocariasis cases were reported in China, mainly in the southern provinces, and the seroprevalence of Toxocara spp. among children increased from 12.14% in 1993 to 19.3% in 2015 [11,12]. Hookworm, a blood-sucking nematode of the mammalian digestive system, is an important cause of neonatal mortality [13]. Iron deficiency anemia is the main clinical symptom of hookworm infection, potentially leading to proteinemia and generalized edema, in addition to cutaneous larva migrans or creeping [14,15]. There were an estimated 16.97 million hookworm infections in China in 2015 [16]. In addition, Cai [17] compiled the species of parasitic infections in ruminant livestock in Qinghai Province, and found that there were 85 species in six orders, 15 families and 24 genera belonging to the phylum Nematoda, including 71 species of digestive nematodes, such as Toxaocara vitulorum, Oesophagostomum asperum, Nematodirus sapathiger and Bunostomum phlebotomum and 13 species of pulmonary nematodes, such as Muellerius capillaris and one species of nematode that parasitizes the transverse muscle—Trichinella spiralis.
However, most of the current studies about nematodes focus on livestock and humans, and the potential for wildlife transmission of zoonotic nematodes has long been overlooked [8]. In an investigation of wildlife, Eslahi et al. reported that the pooled prevalence of toxocariasis in Canis aureus and Vulpes vulpes was 23.3% and 69.4%, respectively, and a high prevalence of 9.3% for humans in Iran [18]; Waindok et al. found that the prevalence of Toxocara canis in red foxes and raccoon dogs was 43.8% and 33.3%, respectively, in northern Germany [19]. In China, there was a record of Canis lupus infected with T. canis in Heilongjiang Province [20]; moreover, an investigation by Xie et al. showed that three species of ascaridoid nematodes, namely T. canis, Toxocara cati and Toxascaris lenonia were detected from 11 species of wild animals including Prionailurus bengalensis, Felis chaus, Catopuma temminckii, Alopex lagopus, V. vulpes, Panthera tigris altaica, Panthera tigris amoyensis, Panthera tigris corbetti, Panthera leo spelaea, Lynx lynx and Canis lupus in Sichuan Province, China [21]. Another study showed that black bears, red foxes, and bobcats exhibited the highest parasitic hookworm species diversity, with infection by Ancylostoma pluridentatum, Ancylostoma tubaeforme, Uncinaria stenocephala, and Necator americanus [22]. In central Europe, the prevalence of hookworm infection in red foxes is as high as 67.9% [23]. In Asia, hookworm prevalence was approximately 48% in jackals and 19% in red foxes [24]. Notably, the boundary between wildlife and humans is gradually shrinking, with an increasing number of wildlife habitats intersecting with humans and living places owing to rapid population growth and urbanization [24,25]. Therefore, there is an urgent need for the investigation of parasitic nematode infection in wild animals to reduce the potential risk of nematodiasis.
The eastern Tibetan Plateau is a global biodiversity hotspot [26], where carnivores such as V. ferrilata, V. vulpes, Panthera uncia, Canis lupus, and Ursus arctos pruinosus are widely distributed [27]. This plateau is also an important grazing area for Tibetan sheep and yaks [28,29]. At present, the limited investigation and surveillance of parasitic infections in the region mostly target humans and livestock, with knowledge of nematode infections in local wild carnivores remaining limited. Therefore, we conducted a preliminary exploration of local wild carnivore nematode infections to establish a basis for devising disease prevention and control measures at the interface between humans, animals, and the environment.

2. Materials and Methods

2.1. Study Area

Shiqu County is located northwest of Ganzi Tibetan Autonomous Prefecture, Sichuan Province, the eastern part of the Qinghai-Tibet Plateau, at the junction of Sichuan Province, Qinghai Province, and the Tibet Autonomous Region, with an average altitude of above 4200 m, where animal husbandry is the main vocation in the alpine meadows covering the vast majority of territory [30,31]. It belongs to an area of subtropical climate, but the climate in the territory is influenced by the complex topography of the Qinghai-Tibet Plateau, showing the characteristics of a mountainous climate and continental climate of the Qinghai-Tibet Plateau [32].

2.2. Sampling

In October 2021, five townships, namely Derongma, Niga, Sexu, Luoxu, and Zhengke, in Shiqu County, were selected for investigation based on previous survey results and information on the local landscape distribution. Sampling points were selected via stratified random sampling based on the proportion of land-use area within the study area extracted from the 2020 China Land Use Remote Sensing Monitoring Data released by the Institute of Geographic Sciences and Natural Resources Research, Chinese Academy of Sciences. Sixty-seven 15 m × 200 m plots were sampled. Each sampling point was spaced 5 km apart. All fecal samples of field carnivores were thoroughly searched at the selected sites, with the fresher samples collected and stored in 50 mL centrifuge tubes and numbered using new disposable tools to avoid cross-contamination.

2.3. Molecular Identification

Each fresh fecal sample collected was mixed well, and 2 g of each sample was used for DNA extraction. Deionized water (50 mL) was added to each fecal sample, followed by incubation in a water bath at 80 °C for 10 min. Thereafter, the sample was filtered through two layers of gauze, and the filtrate was added into another 50 mL centrifuge tube, then centrifuged at 3000× g for 30 min. The supernatant was discarded, and the precipitate was retained. DNA was extracted using the QIAamp Fast DNA Stool Mini Kit as per the manufacturer’s instructions (QIAGEN, Hilden, Germany). Parallel polymerase chain reaction (PCR) tests were performed for each sample using six pairs of primer pairs. Primer synthesis was conducted by Sangong Biotech Co. Ltd. (Shanghai, China). Host universal primers (16S) were used to identify host species based on the 16S rRNA gene, and a primary screening was performed to detect nematodes using three pairs of universal parasitic primers (Nems A/B/C) targeting the 18S rRNA gene. Considering the lack of reference sequences for the amplified target fragment, the specific primers ITS1 and nad1 were used to enrich sequence information for Unicinaria sp. and Toxascaris sp., respectively (see Table 1 for details).
All PCRs were carried out in a final reaction volume of 50 μL, consisting of 25 μL of Ex TaqTM PCR premix (RR902A; Takara, Dalian, China), 17 μL of RNase-free water (9012, Takara, Dalian, China), 1 μL of bovine serum albumin (2320, Takara, Dalian, China), 1 μL of each primer (10 pmol/μL) (Sangon Biotech Co. Ltd., Shanghai, China), and 2 μL template DNA. PCR reactions were performed on a Bio-Rad DNA Engine Dyad PCR instrument (Bio-Rad) with the following amplification reaction parameters: 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing for 30 s (annealing temperature selected according to primers), extension at 72 °C for 30 s and a final extension step at 72 °C for 10 min.
All PCR products were sequenced, and abnormal sequencing results with multiple peaks were cloned at Sangong Biotech (Shanghai) Co., Ltd. The final sequences obtained were compared with those in the National Center for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov, accessed on 15 September 2022) to identify host and parasite species.

2.4. Statistics

SPSS (version 25.0; IBM Corp., Armonk, NY, USA) was used for the statistical analysis of data, with indicators such as frequency and rate used to describe host species identification and parasite detection. Comparisons between rates or composition ratios were performed using the chi-squared test at a significance level of p = 0.05. Comparisons between groups were performed using the Z test and Bonferroni correction. Fisher’s exact test was used to compare data that did not meet the requirements for chi-squared tests.

2.5. Phylogenetic Analyses

Reference sequences for the nad1 gene of Uncinaria stenocephala, ITS1 gene of Toxascaris sp., and 18S rRNA gene of Crenosoma vulpis were searched in NCBI (see Additional file: Table S1 for details). All the sequences were first imported into MEGA 7 for alignment and trimming [37]. Thereafter, the ordered sequences were input into DNASP 6 to obtain haplotypes and perform neutrality tests, including haplotype diversity, nucleotide diversity, Tajima’s D, and Fu’s Fs [38]. The haplotype network graphs were mapped using Network 10.2.0.0 (http://www.fluxus-engineering.com) (accessed on 27 September 2022). Bayesian phylogenetic trees for U. stenocephala, Toxascaris sp., and Crenosoma vulpis were constructed to analyze the relationship between the nematodes obtained in this survey and other regions. The best nucleotide substitution models were screened using jModeltest 2.1.10 [39]. Phylogenetic trees were constructed using MrBayes 3.2.4 [40]. Markov chain Monte Carlo (MCMC) data simulation was used to estimate the posterior probabilities with 10,000 generations of operations, the sampling frequency was set to 10, and the first 25% of aging samples were discarded. Finally, Bayesian trees were compiled and processed using FigTree 1.4.3 (http://tree.bio.ed.ac.uk/software/figtree, accessed on 27 September 2022).

3. Results

3.1. Host Species Composition

Of the 296 fecal samples initially recognized by the investigators as wild canids, 240 were successfully identified after DNA extraction (81%). Six carnivorous species belonging to the families of Canidae, Mustelidae, and Felidae were identified, namely Vulpes ferrilata (81.25%, 195/240), Vulpes vulpes (15.83%, 38/240), Vulpes sp. (0.83%, 2/240), Canis lupus (0.83%, 2/240), Meles leucurus (0.42%, 1/240), Mustela altaica (0.42%, 1/240), and Prionailurus bengalensis (0.42%, 1/240) (Figure 1). The foxes, especially V. ferrilata, were dominant among carnivores in the area (Figure 1).

3.2. Nematode Detections

A total of 10 nematode species were detected in 240 host samples using three parasitic universal primers (NemA/B/C): Uncinaria stenocephala, Toxascaris sp., Crenosoma vulpis, Parapharyngodon bainae, Oesophagostomum muntiacum, Aspiculuris tetraptera, Mastophorus muris, Nematodirus spathiger, Muellerius capillaris, and Molineus patens (accession numbers of 18S rRNA gene in NCBI database: OP788051–OP788057, OP788064), with an overall detection rate of 57.92% (139/240, 95% CI: 51.67–64.16%). All nematodes were detected in fox feces (V. ferrilata and V. vulpes). Uncinaria stenocephala (35.83%, 95% CI: 29.77–42.25%) and Toxascaris sp. (14.58%, 95% CI: 10.12–19.05%) were detected at a higher rate than other nematodes in all carnivore feces (χ2 = 516.909, p < 0.05), and the detection rate of nematodes in V. ferrilata feces was significantly higher than that in V. vulpes feces (χ2 = 4.200, p < 0.05), especially in the case of U. stenocephala (χ2 = 4.903, p < 0.05). In addition, the detection rate of Molineus patens between V. ferrilata and V. vulpes was significantly different (χ2 = 0.000, p < 0.05, Fisher’s exact test). Further details are provided in Table 2.

3.3. Nucleotide Polymorphisms and Haplotype Network Graph Construction Results

The haplotype network graphs showed that 122 DNA sequences obtained from U. stenocephala were clustered as 17 haplotypes (Hap-Us-1–Hap-Us-17) based on the ITS1 gene (accession in NCBI database: OP788006–OP788023). Hap-Us-1 (number of sequences included was 87) and Hap-Us-2 (n = 19) were the main gene haplotypes for U. stenocephala in the study areas. All haplotypes were detected in the feces of V. ferrilata, whereas only Hap-Us-1 was isolated from V. vulpes (n = 10) (Figure 2a). Correspondingly, 18 haplotypes (Hap-Ts-1–Hap-Ts-18) were counted from 45 nad1 gene sequences of Toxascaris sp. (accession in NCBI database: OP800273–OP800283, OP805342–OP805348), with Hap-Ts-5 as the core, dominant haplotype detected in V. ferrilata. Hap-Ts-4 (n = 1) was a common haplotype shared between Toxascaris sp. from V. ferrilata and V. vulpes, and Hap-Ts-6 was found only in V. vulpes (Figure 2b).

3.4. Nucleotide Polymorphisms

Neutral tests showed significant negative results (Tajima’s D = −2.20369, p < 0.05; Fu’s Fs = −12.411, p < 0.05) for U. stenocephala, suggesting that the population had a large number of low-frequency mutant genes in its gene pool and underwent an expansion after a recent bottleneck effect under significant selection pressure. Moreover, U. stenocephala had lower genetic diversity (Hd = 0.470 and Pi = 0.00249) than Toxascaris sp. (Hd = 0.836 and Pi = 0.01836). In contrast, although the neutrality tests showed negative values, there was no significant difference for Toxascaris sp. (Tajima’s D = −4.9277, p > 0.10; Fu’s Fs = −2.610, p > 0.10), indicating that Toxascaris sp. population dynamics were closer to neutrality with random evolution (see Table 3 for details).

3.5. Phylogenetic Tree Results

The Bayesian tree showed that U. stenocephala isolates from the United States and the haplotypes in this survey were located on the same branch, with 99% support. However, some haplotypes were clustered into new sub-branches, such as Hap-Us-1, Hap-Us-6, Hap-Us-8, Hap-Us-12, Hap-Us-13, Hap-Us-15, and Hap-Us-16, which may have been formed by potential geographical divergence (Figure 3c). As shown in Figure 3a, some parasitic gene sequences obtained from this study were clustered on a sister branch of Toxascaris leonina and were, therefore, considered a new local species of the Toxascaris genus. Figure 3b shows that the genes of Crenosoma vulpis from this study and from a study in Italy clustered together.

3.6. Primers Variability Comparison

Of the 10 nematode species detected, only one (U. stenocephala) was detected using all three primers, and Nem A detected the largest number of nematode species (Figure 4). Statistically significant differences were observed in the detection rates of parasites using different primers. The detection rate of Toxascaris sp. was higher for Nem A than for Nem B and C (χ2 = 73.577, p < 0.05). The detection rates of U. stenocephala were higher for Nem B and Nem C than for Nem A (χ2 = 16.620, p < 0.05), and the detection rate of Mastophorus muris was higher for Nem A than for Nem C (χ2 = 9.520, p < 0.05, Fisher’s exact test).

4. Discussion

This study provides molecular evidence for the presence of local nematode-infected carnivores in the Qinghai-Tibetan Plateau. In this study, six species of carnivores were identified through the analysis of fecal DNA collected throughout Shiqu County, Ganzi Tibetan Autonomous Prefecture, the eastern Qinghai-Tibetan Plateau. Foxes, especially V. ferrilata, were the dominant species within the region based on fecal analysis. In the present work, the zoonotic parasite U. stenocephala was reported to infect V. ferrilata for the first time through molecular detection. The findings suggest that Toxascaris sp. may be a new parasitic species affecting foxes, distinct from T. leonina and other Toxascaris sp. reported worldwide.
Uncinaria stenocephala belongs to the family Ancylostomatidae [41], which is widely parasitic in dogs, wolves, foxes, and badgers, as well as other canids, and is distributed in regions with colder climates throughout Asia, Europe, North America, South America, Australia, and New Zealand [42]. It is among the most common hookworms infecting dogs [43]. Cats can also be infected by this parasite, but their resistance is higher than that of canines [44,45]. U. stenocephala eggs are transmitted via the feces of definitive canine hosts, Larvae hatch in the superficial soil layer within one day and then develop into third-stage larvae after approximately one week under ideal conditions [46,47]. Humans are infected through skin contact with infective third-stage larvae or through the consumption of raw food containing infectious third-stage larvae [48]. However, due to the lack of relevant investigations in China, only very limited data can be referred to. The earliest records were reported in Sichuan Province: U. stenocephala was observed in the intestines of V. ferrilata and Arctonyx collaris by morphological methods in Luhuo County and Hongyuan County in 1963 and 1981, respectively [49]. Since then, there were no reports in the literature until 2019, when U. stenocephala infection was determined morphologically in five of 10 dogs examined in Nangqian County, Qinghai Province [50]. In the present work, the overall detection rate of U. stenocephala in foxes was 36.9% (86/233), lower than rates reported from Denmark (60–86%) [51], Spain (58.2%) [52], Switzerland (64–78%) [53,54], and Italy (39–75%) [55], but comparable to that in Ireland (38%) [56]. Those data suggest that foxes are an important definitive host for U. stenocephala and play a key role in the process of transmission that cannot be ignored. This should be considered a warning because this parasite can cause disease in humans. Fourteen U. stenocephala isolates were detected from the feces of 128 patients in Iran [57]; further, 22% of prisons in Madrid, Spain, had reported U. stenocephala infections [58] and compared to a prevalence of 7.9% from 38 residents tested in a suburb of Buenos Aires, Argentina. While no U. stenocephala infection in humans has been reported in China thus far, given the high detection rate of foxes in the present investigation, it is rather likely for transmission to the local residents to have occurred. Furthermore, when patients have hookworm-related cutaneous larva migrans, the location of the larvae is usually more distant than the visible area of the lesion and cannot be diagnosed via biopsy or based only on clinical features and epidemiological history [59]. Thus, we recommend relevant diagnostic training for local physicians to raise vigilance for U. stenocephala infection.
It is worth mentioning that a species of Toxascaris sp., suspected to be a new species of the genus Toxascaris, was identified in this study, with a detection rate of 14.58%. The phylogenetic tree revealed that it was closely related to Toxascaris leonina, currently the only known species in this genus [60]. The eggs of T. leonina can adapt to cold climatic conditions, survive for 40 days at −15 °C, and continue to develop to the infectious stage when the temperature returns to 25 °C, after which it infects animals via the oral route [61]. In general, canines and cats are the definitive hosts of T. leonina; small rodents can be their intermediate hosts, while rabbits and chickens can act as reservoir hosts [62,63]. In particular, T. leonina migrates into the intestinal wall only during the larval stage and has a long incubation period (48–72 days). A young host can complete growth and development before its health is affected, and thus, T. leonina is considered to have low pathogenicity [64]. Current research suggests that T. leonina is a potentially zoonotic parasite that may be responsible for eosinophilia among people in the St. Lawrence Island region of Alaska [60,63]. Whether the Toxascaris sp. found in this study has the same pathogenic potential as T. leonina requires further study.
Crenosoma vulpis, a parasite species with foxes as the common definitive host, also infects stray and domestic dogs as well as various other carnivores such as Canis lupus, Canis aureus, Nyctereutes procyonoides, Urocyon cinereoargenteus, Lutra lutra and Meles meles. Further, it is an important causative pathogen of chronic respiratory disease in canids [65]. Infected animals suffer from chronic respiratory diseases, exhibit poor growth, and may even die due to bronchopneumonia in severe cases [66]. Its larvae reside in gastropods, with third-stage larvae (L3) infecting the definitive host. Adult nematodes reside within the bronchi and bronchioles where they produce first-stage larvae (L1) that can be coughed up within three weeks of infection or passed from the feces of definitive hosts through swallowing [67]. The high infection rate of Crenosoma vulpis in V. vulpes has been reported in Europe and America, including 78.4% in Canada [68], 8.7–15.8% in Italy [69], and 24.6% in Hungary [70]. We found only one infection case in V. ferrilata in this study, which may be related to the fact that the samples collected are feces rather than lung tissues.
In addition to the above three parasites with foxes as definitive hosts, some parasites detected in this study may not be common intestinal species of foxes. Parapharyngodon bainae is an intestinal parasite affecting carnivorous reptiles [71]. Oesophagostomum muntiacum usually lives in the intestinal tract of muntjacs and can also be parasitic in primates, such as macaques [72,73]. Aspiculuris tetraptera, a common parasite in the digestive system of mice, is usually non-pathogenic or slightly pathogenic in mice with a normal immune system [74]. Mastophorus muris is a common parasitic nematode in the stomachs of rodents, and its intermediate hosts are beetles, locusts, earwigs, cockroaches and other insects [75]. Muellerius capillaris is a common pulmonary parasitic nematode in small ruminants, such as goats and sheep, causing respiratory distress and coughing in small ruminants, making their lungs more susceptible to bacterial infection [76,77]. Molineus patens is a common intestinal parasite of mustelids; it can impair the health of skunks, affecting their population size [78,79]. This observation may be related to the feeding habits of carnivores. Vulpes ferrilata identified in this survey mainly prey on pika and voles [80], its prey also includes Pantholops hodgsoni, Lepus oiostolus, Phrynocephalus spp., Marmota himalayana, Moschus spp., Pseudois nayaur, and young domestic animals [81,82]. While foxes might not be the most suitable host, the current study indicates the local presence of these parasitic nematodes.
All results of this study were obtained by molecular methods and were not supported by morphological analysis. Because, V. ferrilata is protected in China [83], only non-invasive methods, such as fecal sample testing, can be applied in survey studies. Further in-depth study of parasitology and host-parasite relationships should be carried out in the future. However, even with the use of molecular detection, it should be noted that the experimental results of three pairs of nematode primers showed differences in detection rates. Therefore, we suggest that parallel experiments using multiple primer pairs would be a prudent approach for future studies.
The livestock industry is the major source of income within the Ganzi Prefecture on the eastern Tibetan Plateau, and its development has led to considerable overlap between the living areas of local herders and wild habitats [84,85]. Shared grazing areas and water sources are key factors in facilitating the transmission of nematodes between wildlife and humans [86,87]. The current surveillance of foxes and humans on the Tibetan Plateau for zoonotic nematode infection focuses mainly on echinococcosis [88,89], with the transmission of some zoonotic nematodes, such as U. stenocephala, potentially being overlooked. Monitoring and investigation of human-animal nematodes in the eastern Tibetan Plateau need to be improved to determine the disease burden of zoonotic nematodes in the area. This would require the combined efforts of ecologists, wildlife specialists, veterinarians, human physicians, and relevant disease control personnel from a “One Health” perspective (encompassing humans, domestic animals, wildlife, and the changing ecosystems in which they live [90]) in order to better prevent the spread of zoonotic nematodes.

5. Conclusions

Foxes are dominant among wildlife populations on the eastern Qinghai-Tibet Plateau, especially Vulpes ferrilata, which exhibits a very high nematode infection rate. Uncinaria stenocephala was the most common zoonotic nematode, detected for the first time using molecular methods, in V. ferrilata at a rate of 35.83%. The Toxcascaris sp. found in this survey may represent a new species of the genus Toxascaris. Taken together, we suggest strengthening parasite monitoring among foxes on the eastern Tibetan Plateau in the future to prevent the local transmission of zoonotic nematodes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pathogens11121520/s1, Table S1 Accession numbers of reference sequences for the nad1 gene of Uncinaria stenocephala, ITS1 gene of Toxascaris sp., and 18S rRNA gene of Crenosoma vulpis.

Author Contributions

Conceptualization, X.W. and Y.G.; Methodology, Q.C., X.W. and Y.G.; Software, X.W. and Q.C.; Formal Analysis, Q.C. and X.W.; Investigation, Q.C., C.L., X.W., K.Z., X.D. and Y.X.; Resources, W.W.; Data Curation, Q.C.; Writing—Original Draft Preparation, Q.C.; Writing—Review and Editing, X.W., W.W. and Y.G.; Visualization, Q.C. and X.W.; Supervision, Y.G. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Research Projects of Shanghai Municipal Health (Grant No. 2021Y0213).

Data Availability Statement

Not applicable.

Acknowledgments

We appreciate Center for Disease Control and Prevention of Shiqu County for their help with field survey.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Poinar, G.J. Nematoda (Roundworms). In eLS.; John Wiley & Sons, Ltd.: Chichester, UK, 2012; pp. 1–5. [Google Scholar]
  2. Morand, S.; Bouamer, S.; Hugot, J.-P. Nematodes. In Micro Mammals and Macroparasites: From Evolutionary Ecology to Management; Serge, M., Salah, B., Jean-Pierre, H., Eds.; Springer: Berlin/Heidelberg, Germany, 2005; Chapter 4; pp. 63–80. [Google Scholar]
  3. Barry, M.A.; Simon, G.G.; Mistry, N.; Hotez, P.J. Global trends in neglected tropical disease control and elimination: Impact on child health. Arch. Dis. Child. 2013, 98, 635–641. [Google Scholar] [CrossRef] [PubMed]
  4. Knopp, S.; Steinmann, P.; Keiser, J.; Utzinger, J. Nematode infections: Soil-transmitted helminths and trichinella. Infect. Dis. Clin. N. Am. 2012, 26, 341–358. [Google Scholar] [CrossRef] [PubMed]
  5. Sorobetea, D.; Svensson-Frej, M.; Grencis, R. Immunity to gastrointestinal nematode infections. Mucosal. Immunol. 2018, 11, 304–315. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Lustigman, S.; Prichard, R.K.; Gazzinelli, A.; Grant, W.N.; Boatin, B.A.; McCarthy, J.S.; Basáñez, M.G. A research agenda for helminth diseases of humans: The problem of helminthiases. PLoS Negl. Trop. Dis. 2012, 6, e1582. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Chen, Y.D.; Zhou, C.H.; Zhu, H.H.; Huang, J.L.; Duan, L.; Zhu, T.J.; Qian, M.B.; Li, S.Z.; Chen, H.G.; Cai, L.; et al. National survey on the current status of important human parasitic diseases in China in 2015. Chin. J. Parasitol. Parasit. Dis. 2020, 38, 5–12. (In Chinese) [Google Scholar]
  8. Otranto, D.; Deplazes, P. Zoonotic nematodes of wild carnivores. Int. J. Parasitol. Parasites Wildl. 2019, 9, 370–383. [Google Scholar] [CrossRef]
  9. Rostami, A.; Ma, G.; Wang, T.; Koehler, A.V.; Hofmann, A.; Chang, B.C.H.; Macpherson, C.N.; Gasser, R.B. Human toxocariasis—A look at a neglected disease through an epidemiological ‘prism’. Infect. Genet. Evol. 2019, 74, 104002. [Google Scholar] [CrossRef]
  10. Hotez, P.J.; Wilkins, P.P. Toxocariasis: America’s most common neglected infection of poverty and a helminthiasis of global importance? PLoS Negl. Trop. Dis. 2009, 3, e400. [Google Scholar] [CrossRef]
  11. Wang, S.; Li, H.; Yao, Z.; Li, P.; Wang, D.; Zhang, H.; Xie, Q.; Zhang, Z.; Li, X. Toxocara infection: Seroprevalence and associated risk factors among primary school children in central China. Parasite 2020, 27, 30. [Google Scholar] [CrossRef]
  12. Kong, L.; Peng, H.J. Current epidemic situation of human toxocariasis in China. Adv. Parasitol. 2020, 109, 433–448. [Google Scholar]
  13. Brooker, S.; Hotez, P.J.; Bundy, D.A. Hookworm-related anaemia among pregnant women: A systematic review. PLoS Negl. Trop. Dis. 2008, 2, e291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Wang, C.H.; Lee, S.C.; Huang, S.S.; Chang, L.C. Hookworm infection in a healthy adult that manifested as severe eosinphilia and diarrhea. J. Microbiol. Immunol. Infect. 2011, 44, 484–487. [Google Scholar] [CrossRef] [PubMed]
  15. Zibaei, M.; Nosrati, M.R.C.; Shadnoosh, F.; Houshmand, E.; Karami, M.F.; Rafsanjani, M.K.; Majidiani, H.; Ghaffarifar, F.; Cortes, H.C.E.; Dalvand, S.; et al. Insights into hookworm prevalence in Asia: A systematic review and meta-analysis. Trans. R. Soc. Trop. Med. Hyg. 2020, 114, 141–154. [Google Scholar] [CrossRef] [PubMed]
  16. Chen, Y.D.; Qian, M.B.; Zhu, H.H.; Zhou, C.H.; Zhu, T.J.; Huang, J.L.; Li, Z.J.; Li, S.Z.; Zhou, X.N.; Group on National Survey of Important Human Parasitic Diseases in China. Soil-transmitted helminthiasis in China: A national survey in 2014–2015. PLoS Negl. Trop. Dis. 2021, 15, e0009710. [Google Scholar] [CrossRef]
  17. Cai, J.Z. Classification of Nematode in Ruminantfrom Qinghai Province. Chin. J. Parasitol. Parasit. Dis. 2006, 24, 68–72. (In Chinese) [Google Scholar]
  18. Eslahi, A.V.; Badri, M.; Khorshidi, A.; Majidiani, H.; Hooshmand, E.; Hosseini, H.; Taghipour, A.; Foroutan, M.; Pestehchian, N.; Firoozeh, F.; et al. Prevalence of Toxocara and Toxascaris infection among human and animals in Iran with meta-analysis approach. BMC Infect. Dis. 2020, 20, 20. [Google Scholar] [CrossRef] [Green Version]
  19. Waindok, P.; Raue, K.; Grilo, M.L.; Siebert, U.; Strube, C. Predators in northern Germany are reservoirs for parasites of One Health concern. Parasitol. Res. 2021, 120, 4229–4239. [Google Scholar] [CrossRef]
  20. Chang, Q.C.; Gao, J.F.; Sheng, Z.H.; Lou, Y.; Zheng, X.; Wang, C.R. Sequence variability in three mitochondrial genes among four roundworm species from wild animals in China. Mitochondrial DNA 2015, 26, 75–78. [Google Scholar] [CrossRef]
  21. Xie, Y.; Chen, Z.; Zhao, B.; Niu, L.; Gu, X.; Yang, G. Characterization of Roundworms from Eleven Species of Captive Wild Canin and Feline Animals, in Sichuan Provinces, China, Using Mitochondrial and Nuclear Genes. In Proceedings of the 11th China Symposium on Young Workers of Parasitology, Kunming, China, 10 August 2018. (In Chinese). [Google Scholar]
  22. Seguel, M.; Gottdenker, N. The diversity and impact of hookworm infections in wildlife. Int. J. Parasitol. Parasites Wildl. 2017, 6, 177–194. [Google Scholar] [CrossRef]
  23. Karamon, J.; Dabrowska, J.; Kochanowski, M.; Samorek-Pierog, M.; Sroka, J.; Rozycki, M.; Bilska-Zajac, E.; Zdybel, J.; Cencek, T. Prevalence of intestinal helminths of red foxes (Vulpes vulpes) in central Europe (Poland): A significant zoonotic threat. Parasites Vectors 2018, 11, 436. [Google Scholar] [CrossRef]
  24. Kimpston, C.N.; Hatke, A.L.; Castelli, B.; Otto, N.; Tiffin, H.S.; Machtinger, E.T.; Brown, J.D.; Van Why, K.R.; Marconi, R.T. High Prevalence of Antibodies against Canine Parvovirus and Canine Distemper Virus among Coyotes and Foxes from Pennsylvania: Implications for the Intersection of Companion Animals and Wildlife. Microbiol. Spectr. 2022, 10, e0253221. [Google Scholar] [CrossRef] [PubMed]
  25. Treves, A.; Karanth, K.U. Human-carnivore conflict and perspectives on carnivore management worldwide. Conserv. Biol. 2003, 17, 1491–1499. [Google Scholar] [CrossRef]
  26. Myers, N.; Mittermeier, R.A.; Mittermeier, C.G.; Fonseca, G.; Kent, J.M.J.N. Biodiversity hotspots for conservation priorities. Nature 2000, 403, 853–858. [Google Scholar] [CrossRef] [PubMed]
  27. Dai, Y.; Xue, Y.; Hacker, C.E.; Zhang, Y.; Zhang, Y.; Liu, F.; Li, D. Human-carnivore conflicts and mitigation options in Qinghai province, Chian. J. Nat. Conser. 2020, 53, 125776. [Google Scholar] [CrossRef]
  28. Li, W.; Cao, W.; Wang, J.; Li, X.; Xu, C.; Shi, S.J.E.E. Effects of grazing regime on vegetation structure, productivity, soil quality, carbon and nitrogen storage of alpine meadow on the Qinghai-Tibetan Plateau. Ecol. Eng. 2017, 98, 123–133. [Google Scholar] [CrossRef]
  29. Miao, F.; Guo, Z.; Xue, R.; Wang, X.; Shen, Y. Effects of grazing and precipitation on herbage biomass, herbage nutritive value, and yak performance in an alpine meadow on the Qinghai-Tibetan Plateau. PLoS ONE 2015, 10, e0127275. [Google Scholar] [CrossRef] [Green Version]
  30. Hao, L.; Yuan, D.; Guo, L.; Hou, W.; Mo, X.; Yin, J.; Yang, A.; Li, R. Molecular detection of Bartonella in ixodid ticks collected from yaks and plateau pikas (Ochotona curzoniae) in Shiqu County, China. BMC Vet. Res. 2020, 16, 235. [Google Scholar] [CrossRef]
  31. Wang, D.; Wu, J.; Wang, Y.; Ji, Y. Finding High-Quality Groundwater Resources to Reduce the Hydatidosis Incidence in the Shiqu County of Sichuan Province, China: Analysis, Assessment, and Management. Expos. Health 2020, 12, 307–322. [Google Scholar] [CrossRef]
  32. Shao Xinning, S.D.; Huang, Q.; Li, S.; Yao, M. Fast surveys and molecular diet analysis of carnivores based on fecal DNA and metabarcoding. Biodiv. Sci. 2019, 27, 543–556. (In Chinese) [Google Scholar] [CrossRef]
  33. Cannon, M.V.; Bogale, H.; Rutt, L.; Humphrys, M.; Korpe, P.; Duggal, P.; Ravel, J.; Serre, D. A high-throughput sequencing assay to comprehensively detect and characterize unicellular eukaryotes and helminths from biological and environmental samples. Microbiome 2018, 6, 195. [Google Scholar] [CrossRef] [Green Version]
  34. Catalano, S.; Lejeune, M.; van Paridon, B.; Pagan, C.A.; Wasmuth, J.D.; Tizzani, P.; Duignan, P.J.; Nadler, S.A. Morphological variability and molecular identification of Uncinaria spp. (Nematoda: Ancylostomatidae) from grizzly and black bears: New species or phenotypic plasticity? J. Parasitol. 2015, 101, 182–192. [Google Scholar] [CrossRef] [PubMed]
  35. Mikaeili, F.; Mirhendi, H.; Mohebali, M.; Hosseini, M.; Sharbatkhori, M.; Zarei, Z.; Kia, E.B. Sequence variation in mitochondrial cox1 and nad1 genes of ascaridoid nematodes in cats and dogs from Iran. J. Helminthol. 2015, 89, 496–501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Xiong, M.; Shao, X.; Long, Y.; Bu, H.; Zhang, D.; Wang, D.; Li, S.; Wang, R.; Yao, M. Molecular analysis of vertebrates and plants in scats of leopard cats (Prionailurus bengalensis) in southwest China. J. Mammal. 2016, 97, 1054–1064. [Google Scholar] [CrossRef]
  37. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
  38. Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
  39. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Green Version]
  40. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Green Version]
  41. Nadler, S.A.; Adams, B.J.; Lyons, E.T.; DeLong, R.L.; Melin, S.R. Molecular and morphometric evidence for separate species of Uncinaria (Nematoda: Ancylostomatidae) in California sea lions and northern fur seals: Hypothesis testing supplants verification. J. Parasitol. 2000, 86, 1099–1106. [Google Scholar] [CrossRef]
  42. Bowman, D.D.; Montgomery, S.P.; Zajac, A.M.; Eberhard, M.L.; Kazacos, K.R. Hookworms of dogs and cats as agents of cutaneous larva migrans. Trends Parasitol. 2010, 26, 162–167. [Google Scholar] [CrossRef]
  43. Postigo, I.; Martínez, J.; Cardona, G.; Fernández-Pérez, I.; Guisantes, J.A. Uncinaria stenocephala: Antigenic characterization of larvae and adults worms using sera from naturally infected dogs. Exp. Parasitol. 2003, 103, 171–173. [Google Scholar] [CrossRef]
  44. Rodan, I.; Sparkes, A.H. The Cat; Susan, E.L., Ed.; Saunders: Philadelphia, PA, USA, 2012; Chapter 8; pp. 151–180. [Google Scholar]
  45. Datz, C. Parasitic and Protozoal Diseases. In Small Animal Pediatrics; Peterson, M.E., Kutzler, M.A., Eds.; Elsevier: St. Louis, MO, USA, 2011; Chapter 19; pp. 154–160. [Google Scholar]
  46. Feldmeier, H.; Schuster, A. Mini review: Hookworm-related cutaneous larva migrans. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 915–918. [Google Scholar] [CrossRef] [PubMed]
  47. Heukelbach, J.; Feldmeier, H. Epidemiological and clinical characteristics of hookworm-related cutaneous larva migrans. Lancet Infec. Dis. 2008, 8, 302–309. [Google Scholar] [CrossRef] [PubMed]
  48. Matthews, M.; Vanlier, C.; Montjoye, L.; Baeck, M. A creeping holiday souvenir: About a misleading case of hookworm folliculitis J. Trave. Med. 2020, 27, taaa101. [Google Scholar] [CrossRef]
  49. Wu, J.; Chen, D.M.; Ma, F.H. Studies on the Tibetan fox and pig badger Uncinario stenocephala. Chin. J. Wild. 1982, 3, 53–55. (In Chinese) [Google Scholar]
  50. Zhang, Z.P.; Hu, G.W.; Zhao, Q.B.; Li, J.; Shen, Y.L.; Zhou, L.; Li, S.; Cai, J.S. Uncinaria stenocephala found in the Sanjiangyuan area. China Anim. Husb. Vet. Med. 2019, 11, 29–30. (In Chinese) [Google Scholar]
  51. Al-Sabi, M.N.; Halasa, T.; Kapel, C.M. Infections with cardiopulmonary and intestinal helminths and sarcoptic mange in red foxes from two different localities in Denmark. Acta Parasitol. 2014, 59, 98–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Criado-Fornelio, A.; Gutierrez-Garcia, L.; Rodriguez-Caabeiro, F.; Reus-Garcia, E.; Roldan-Soriano, M.A.; Diaz-Sanchez, M.A. A parasitological survey of wild red foxes (Vulpes vulpes) from the province of Guadalajara, Spain. Vet. Parasitol. 2000, 92, 245–251. [Google Scholar] [CrossRef]
  53. Hofer, S.; Gloor, S.; MÜLler, U.; Mathis, A.; Hegglin, D.; Deplazes, P. High prevalence of Echinococcus multilocularis in urban red foxes (Vulpes vulpes) and voles (Arvicola terrestris) in the city of Zürich, Switzerland. Parasitology 2000, 120, 135–142. [Google Scholar] [CrossRef] [Green Version]
  54. Reperant, L.A.; Hegglin, D.; Fischer, C.; Kohler, L.; Weber, J.-M.; Deplazes, P. Influence of urbanization on the epidemiology of intestinal helminths of the red fox (Vulpes vulpes) in Geneva, Switzerland. Parasitol. Res. 2007, 101, 605–611. [Google Scholar] [CrossRef] [Green Version]
  55. Di Cerbo, A.R.; Manfredi, M.T.; Bregoli, M.; Cova, M. Wild carnivores as source of zoonotic helminths in north-eastern Italy. Helminthologia 2008, 45, 13–19. [Google Scholar] [CrossRef] [Green Version]
  56. Stuart, P.; Golden, O.; Zintl, A.; de Waal, T.; Mulcahy, G.; McCarthy, E.; Lawton, C. A coprological survey of parasites of wild carnivores in Ireland. Parasitol. Res. 2013, 112, 3587–3593. [Google Scholar] [CrossRef] [PubMed]
  57. Ghadirian, E. Human Infection with Uncinaria in North of Iran. Iranian J. Parasitol. 2007, 2, 38–41. [Google Scholar]
  58. Alonso-Sanz, M.; Chaves, F.; Dronda, F.; Catalán, S.; González-López, A. Intestinal parasitoses in the prison population in the Madrid area (1991–1993). Enferm. Infecc. Microbiol. Clin. 1995, 13, 90–95. [Google Scholar] [PubMed]
  59. Baple, K.; Clayton, J. Hookworm-related cutaneous larva migrans acquired in the UK. BMJ Case. Rep. 2015, 2015, bcr2015210165. [Google Scholar] [CrossRef]
  60. Jin, Y.C.; Li, X.Y.; Liu, J.H.; Zhu, X.Q.; Liu, G.H. Comparative analysis of mitochondrial DNA datasets indicates that Toxascaris leonina represents a species complex. Parasites Vectors 2019, 12, 194. [Google Scholar] [CrossRef] [Green Version]
  61. Rostami, A.; Riahi, S.M.; Fallah Omrani, V.; Wang, T.; Hofmann, A.; Mirzapour, A.; Foroutan, M.; Fakhri, Y.; Macpherson, C.N.L.; Gasser, R.B. Global Prevalence Estimates of Toxascaris leonina Infection in Dogs and Cats. Pathogens 2020, 9, 503. [Google Scholar] [CrossRef]
  62. Laatamna, A.; Baroudi, D.; Samari, H.; Ziane, H.; Alim, O.; Telibi, M.; Taoussi, D. First report on occurrence of zoonotic helminth Toxocara canis, Toxascaris leonina and Ancylostoma caninum in domestic dogs from province of Djelfa, Algeria. Ann. Parasitol. 2021, 67, 111–116. [Google Scholar]
  63. Rausch, R.L.; Fay, F.H. Toxascaris leonina in Rodents, and Relationship to Eosinophilia in a Human Population. Comp. Parasitol. 2011, 78, 236–244. [Google Scholar] [CrossRef]
  64. Parsons, J.C. Ascarid Infections of Cats and Dogs. Vet. Clin. N. Am. Small. Anim. Pract. 1987, 17, 1307–1339. [Google Scholar] [CrossRef]
  65. Conboy, G. Natural infections of Crenosoma vulpis and Angiostrongylus vasorum in dogs in Atlantic Canada and their treatment with milbemycin oxime. Vet. Rec. 2004, 155, 16–18. [Google Scholar] [CrossRef]
  66. Hanson, K.B. Tests of the efficacy of single treatments with trachéal brushes in the mechanical removal of lungworms from foxes. J. Am. Vet. Med. Assoc. 1933, 82, 12–33. [Google Scholar]
  67. Colella, V.; Mutafchiev, Y.; Cavalera, M.A.; Giannelli, A.; Lia, R.P.; Dantas-Torres, F.; Otranto, D. Development of Crenosoma vulpis in the common garden snail Cornu aspersum: Implications for epidemiological studies. Parasites Vectors 2016, 9, 208. [Google Scholar] [CrossRef] [Green Version]
  68. Nevárez, A.; López, A.; Conboy, G.; Ireland, W.; Sims, D. Distribution of Crenosoma vulpis and Eucoleus aerophilus in the lung of free-ranging red foxes (Vulpes vulpes). J. Vet. Diagn. Investig. 2005, 17, 486–489. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  69. Latrofa, M.S.; Lia, R.P.; Giannelli, A.; Colella, V.; Santoro, M.; D’Alessio, N.; Campbell, B.E.; Parisi, A.; Dantas-Torres, F.; Mutafchiev, Y.; et al. Crenosoma vulpis in wild and domestic carnivores from Italy: A morphological and molecular study. Parasitol. Res. 2015, 114, 3611–3617. [Google Scholar] [CrossRef] [PubMed]
  70. Tolnai, Z.; Szell, Z.; Sreter, T. Environmental determinants of the spatial distribution of Angiostrongylus vasorum, Crenosoma vulpis and Eucoleus aerophilus in Hungary. Vet. Parasitol. 2015, 207, 355–358. [Google Scholar] [CrossRef] [PubMed]
  71. Pereira, F.B.; Sousa, B.M.; Lima Sde, S. A new species of Pharyngodonidae (Nematoda) of Tropidurus torquatus (Squamata:Tropiduridae) from Brazil. J. Parasitol. 2011, 97, 311–317. [Google Scholar] [CrossRef]
  72. Setsuda, A.; Kato, E.; Sakaguchi, S.; Tamemasa, S.; Ozawa, S.; Sato, H. Chabaudstrongylus ninhae (Trichostrongylidae: Cooperiinae) and Oesophagostomum muntiacum (Chabertiidae: Oesophagostominae) in feral alien Reeves’s muntjacs on Izu-Oshima Island, Tokyo, Japan. J. Helminthol. 2019, 94, e48. [Google Scholar] [CrossRef]
  73. Medkour, H.; Amona, I.; Laidoudi, Y.; Davoust, B.; Bitam, I.; Levasseur, A.; Akiana, J.; Diatta, G.; Pacheco, L.; Gorsane, S.; et al. Parasitic Infections in African Humans and Non-Human Primates. Pathogens 2020, 9, 561. [Google Scholar] [CrossRef]
  74. Mustakdir, Z.; Akbari, R.A.; Retnani, E.B.; Tiuria, R. Aspiculuris tetraptera Infection in Mice: Parasite degree and Differential Leukocyte. J. Ris. Vet. Indones. 2022, 6, 86–91. [Google Scholar]
  75. Neupane, B.; Miller, A.L.; Evans, A.L.; Olsson, G.E.; Hoglund, J. Seasonal variation of Mastophorus muris (Nematoda: Spirurida) in the water vole Arvicola amphibius from southern Sweden. J. Helminthol. 2018, 94, e6. [Google Scholar] [CrossRef]
  76. Pybus, M.J.; Shave, H. Muellerius capillaris (Mueller, 1889) (Nematoda: Protostrongylidae): An unusual finding in Rocky Mountain bighorn sheep (Ovis canadensis canadensis Shaw) in South Dakota. J. Wild. Dis. 1984, 20, 284–288. [Google Scholar] [CrossRef]
  77. Foreyt, W.J.; Jenkins, E.J.; Appleyard, G.D. Transmission of lungworms (Muellerius capillaris) from domestic goats to bighorn sheep on common pasture. J. Wild. Dis. 2009, 45, 272–278. [Google Scholar] [CrossRef] [Green Version]
  78. Zalewski, A.; Kołodziej-Sobocińska, M.; Bartoń, K.A. A tale of two nematodes: Climate mediates mustelid infection by nematodes across the geographical range. Int. J. Parasitol. Parasites Wildl. 2022, 17, 218–224. [Google Scholar] [CrossRef] [PubMed]
  79. Vergles Rataj, A.; Posedi, J.; Zele, D.; Vengust, G. Intestinal parasites of the red fox (Vulpes vulpes) in Slovenia. Acta Vet. Hung. 2013, 61, 454–462. [Google Scholar] [CrossRef] [PubMed]
  80. Wang, Z.; Wang, X.; Lu, Q. Selection of land cover by the Tibetan fox Vulpes ferrilata on the eastern Tibetan Plateau, western Sichuan Province, China. Acta Theriol. 2007, 52, 215–223. [Google Scholar] [CrossRef]
  81. Shengwu, Z. Feeding information of Tibetan fox. Acta Terminol. Sin. 1985, 3, 222–240. (In Chinese) [Google Scholar]
  82. Liu, Q.; Harris, R.B.; Wang, X. Food habits of the Tibetan fox (Vulpes ferrilata) in the Kunlun Mountains, Qinghai Province, China. Mamm. Biol. 2010, 75, 283–286. [Google Scholar] [CrossRef]
  83. Wang, Z.-H.; Wang, X.-M.; Chmura, A. Den Habitat Characteristics of Tibetan Foxes (Vulpes ferrilata) in Shiqu County, Sichuan Province, China. Zool. Stud. 2008, 47, 445–454. [Google Scholar]
  84. Deng, Z.J. Analysis on Anim alHusbandry Status and the Feasibility of Developm ent Characteristic Breedingin GanziState. Mod. Agric. Sci. Technol 2012, 17, 312–314. (In Chinese) [Google Scholar]
  85. Craig, P.S.; Giraudoux, P.; Wang, Z.H.; Wang, Q. Echinococcosis transmission on the Tibetan Plateau. Adv. Parasitol. 2019, 104, 165–246. [Google Scholar]
  86. Walker, J.G.; Morgan, E.R. Generalists at the interface: Nematode transmission between wild and domestic ungulates. Int. J. Parasitol. Parasites Wildl. 2014, 3, 242–250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  87. Wells, K.; Gibson, D.I.; Clark, N.J.; Ribas, A.; Morand, S.; McCallum, H.I. Global spread of helminth parasites at the human-domestic animal-wildlife interface. Glob. Chang. Biol. 2018, 24, 3254–3265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  88. Fu, M.; Han, S.; Xue, C.; Wang, X.; Liu, B.; Wang, Y.; Wang, L.; Wei, S.; Cui, X.; Zhang, T.; et al. Contribution to the echinococcosis control programme in China by NIPD-CTDR. Adv. Parasitol. 2020, 110, 107–144. [Google Scholar] [PubMed]
  89. Lei, Z.L.; Wang, L.Y. Control situation and primary task of key parasitic diseases in China. Chin. J. Parasit. Dis. 2012, 30, 1–5. (In Chinese) [Google Scholar]
  90. Thompson, R.C. Parasite zoonoses and wildlife: One Health, spillover and human activity. Int. J. Parasitol. 2013, 43, 1079–1088. [Google Scholar] [CrossRef]
Pathogens 11 01520 g001 550
Figure 1. Results of 16S rRNA sequencing of fecal samples for host identification. Note: Vulpes sp. indicates that 16S rRNA gene fragments of both Vulpes ferrilata and Vulpes vulpes were detected in one sample.
Figure 1. Results of 16S rRNA sequencing of fecal samples for host identification. Note: Vulpes sp. indicates that 16S rRNA gene fragments of both Vulpes ferrilata and Vulpes vulpes were detected in one sample.
Pathogens 11 01520 g001
Pathogens 11 01520 g002 550
Figure 2. The haplotype network of Uncinaria stenocephala based on 122 ITS1 gene sequences and Toxascaris sp. based on 45 nad1 gene sequences. (a) Colors represent different hosts, the size of the circle is proportional to the number of sequences with that haplotype, the distances between circles are proportional to the base differences between haplotypes, and median vectors were inferred using NETWORK software. Hap-Us-1 differs from Hap-Us-16 by six bases, Hap-Us-3 differs from Hap-Us-11 by two bases, and Hap-Us-7 differs from Hap-Us-10 by two bases. (b) Median vectors3 differs from Hap-Ts-2 by three bases, Hap-Ts-2 differs from Hap-Ts-3 by three bases, Median vectors4 differs from Hap-Ts-11 by two bases, Median vectors4 differs from Hap-Ts-7 by two bases, Median vectors1 differs from Hap-Ts-16 by seven bases, and Hap-Ts-16 differs from Hap-Ts-12 by eight bases.
Figure 2. The haplotype network of Uncinaria stenocephala based on 122 ITS1 gene sequences and Toxascaris sp. based on 45 nad1 gene sequences. (a) Colors represent different hosts, the size of the circle is proportional to the number of sequences with that haplotype, the distances between circles are proportional to the base differences between haplotypes, and median vectors were inferred using NETWORK software. Hap-Us-1 differs from Hap-Us-16 by six bases, Hap-Us-3 differs from Hap-Us-11 by two bases, and Hap-Us-7 differs from Hap-Us-10 by two bases. (b) Median vectors3 differs from Hap-Ts-2 by three bases, Hap-Ts-2 differs from Hap-Ts-3 by three bases, Median vectors4 differs from Hap-Ts-11 by two bases, Median vectors4 differs from Hap-Ts-7 by two bases, Median vectors1 differs from Hap-Ts-16 by seven bases, and Hap-Ts-16 differs from Hap-Ts-12 by eight bases.
Pathogens 11 01520 g002
Pathogens 11 01520 g003 550
Figure 3. Bayesian phylogenetic trees for three nematodes detected in fox feces from Shiqu County and constructed using MrBayes 3.2.4. (a) Phylogenetic tree of 18 Toxascaris sp. haplotypes of the nad1 gene, with the nucleotide substitution model “HKY + I + G”. (b) Phylogenetic tree based on the Crenosoma vulpis 18S rRNA sequence, with the nucleotide substitution model “HKY + I”. (c) Phylogenetic tree of 17 Uncinaria stenocephala haplotypes of the ITS1 gene with the nucleotide substitution model “K80”. Bootstrap values are shown, and the sequences retrieved from the NCBI are shown with accession numbers.
Figure 3. Bayesian phylogenetic trees for three nematodes detected in fox feces from Shiqu County and constructed using MrBayes 3.2.4. (a) Phylogenetic tree of 18 Toxascaris sp. haplotypes of the nad1 gene, with the nucleotide substitution model “HKY + I + G”. (b) Phylogenetic tree based on the Crenosoma vulpis 18S rRNA sequence, with the nucleotide substitution model “HKY + I”. (c) Phylogenetic tree of 17 Uncinaria stenocephala haplotypes of the ITS1 gene with the nucleotide substitution model “K80”. Bootstrap values are shown, and the sequences retrieved from the NCBI are shown with accession numbers.
Pathogens 11 01520 g003
Pathogens 11 01520 g004 550
Figure 4. Overlap of nematode species detected using the three nematode universal primers (Nem A/B/C).
Figure 4. Overlap of nematode species detected using the three nematode universal primers (Nem A/B/C).
Pathogens 11 01520 g004
Table
Table 1. Information on polymerase chain reaction (PCR) primers used for molecular identification.
Table 1. Information on polymerase chain reaction (PCR) primers used for molecular identification.
PrimersClassificationNamesTarget GenesPrimer Sequences (From 5′ to 3′)Amplicon Length (bp)Annealing
Temperature (°C)		Reference
Parasitic universal primersNematodeNem A18S rRNAF/CACCCGTGAGGATTGACAG
R/CGATCACGGAGGATTTTCAA		320–33553[33]
NematodeNem B18S rRNAF/CGTCATTGCTGCGGTTAAAA
R/CCGTCCTTCGAACCTCTGAC		380–41055[33]
NematodeNem C18S rRNAF/AGTGGAGCATGCGGCTTAAT
R/TGCAATTCCCTRTCCCAGTC		380–44055[33]
Parasitic specific primersUncinariaITS1ITS1F/TTGAACCGGGTAAAAGTCG
R/CGTTTTTCATCGATACGCG		43254[34]
ToxascarisND1nad1F/TTCTTATGAGATTGCTTTT
R/TATCATAACGAAAACGAGG		37050[35]
Host universal primersVertebrate16S16S rRNAF/GAGAAGACCCTATGGAGC
R/ATAGAAACCGACCTGGAT		38055[36]
Table
Table 2. Detection rate of nematodes in 240 fecal samples from the study area in Shiqu County.
Table 2. Detection rate of nematodes in 240 fecal samples from the study area in Shiqu County.
NematodesDetection Rate % (No. Positive of Samples/No. Total Fecal Samples, 95% CI) Carnivores
Vulpes ferrilataVulpes vulpesχ2pCanis
lupus		Vulpes
sp.		Meles
leucurus		Mustela
altaica		Prionailurus
bengalensis		Total
Toxascaris sp.16.92
(33/195, 11.66–22.19)		5.26
(2/38, 0.64–17.75)		3.3870.060.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)14.58 (35/240, 10.12–19.05) a
Aspiculuris
tetraptera		0.51
(1/195, 0.00–1.52)		0.00
(0/38)		0.0001.000.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)0.42 (1/240, 0.00–1.23) b
Mastophorus
muris		2.56
(5/195, 0.35–4.78)		7.89
(3/38, 1.66–21.38)		2.7260.240.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)3.33 (8/240, 1.06–5.60) b
Uncinaria
stenocephala		40.00
(78/195, 33.12–46.88)		21.05
(8/38, 8.09–34.01)		4.903<0.050.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)35.83 (86/240, 29.77–42.25) c
Crenosoma
vulpis		0.51
(1/195, 0.00–1.52)		0.00
(0/38)		0.0001.000.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)0.42 (1/240, 0.00–1.23) b
Oesophagostomum
muntiacum		0.51
(1/195, 0.00–1.52)		2.63
(1/38, 0.07–13.81)		0.0000.300.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)0.83 (2/240, 0.00–1.98) b
Nematodirus
spathiger		0.51
(1/195, 0.00–1.52)		0.00
(0/38)		0.0000.050.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)0.42 (1/240, 0.00–1.23) b
Muellerius
capillaris		0.00
(0/195)		2.63
(1/38, 0.07–13.81)		0.0000.160.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)0.42 (1/240, 0.00–1.23) b
Molineus
patens		0.00
(0/195)		5.26
(2/38, 0.64–17.75)		0.000<0.050.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)0.83 (2/240, 0.00–1.98) b
Parapharyngodon
bainae		1.03
(2/195, 0.00–2.44)		0.00
(0/38)		0.0001.000.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)0.83 (2/240, 0.00–1.98) b
Total62.56
(122/195, 55.77–69.36)		44.74
(17/38, 28.62–61.70)		4.200<0.050.00 (0/2)0.00 (0/2)0.00 (0/1)0.00 (0/1)0.00 (0/1)57.92 (139/240, 51.67–64.16)
a, b, c represent results of the post-hoc tests; p values were adjusted by Bonferroni correction and compared with 0.05 level; values with the same superscript letter indicate no significant difference between the two groups.
Table
Table 3. Diversity and neutral indices of the Uncinaria stenocephala ITS1 gene and the Toxascaris sp. nad1 gene in Shiqu.
Table 3. Diversity and neutral indices of the Uncinaria stenocephala ITS1 gene and the Toxascaris sp. nad1 gene in Shiqu.
NematodesNo. of SequencesNo. of HaplotypesHaplotype DiversityNucleotide DiversityTajima’s DFu’s Fs
Uncinaria stenocephala122170.470 ± 0.0520.00249 ± 0.00037−2.20369,
p < 0.01		−12.411,
p < 0.01
Toxascaris sp.45180.836 ± 0.0480.01836 ± 0.00305−0.49277,
p > 0.10		−2.610,
p > 0.10
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Chen, Q.; Wang, X.; Li, C.; Wu, W.; Zhang, K.; Deng, X.; Xie, Y.; Guan, Y. Investigation of Parasitic Nematodes Detected in the Feces of Wild Carnivores in the Eastern Qinghai-Tibet Plateau, China. Pathogens 2022, 11, 1520. https://doi.org/10.3390/pathogens11121520

AMA Style

Chen Q, Wang X, Li C, Wu W, Zhang K, Deng X, Xie Y, Guan Y. Investigation of Parasitic Nematodes Detected in the Feces of Wild Carnivores in the Eastern Qinghai-Tibet Plateau, China. Pathogens. 2022; 11(12):1520. https://doi.org/10.3390/pathogens11121520

Chicago/Turabian Style

Chen, Qilu, Xu Wang, Chunyang Li, Weiping Wu, Kaige Zhang, Xueying Deng, Yi Xie, and Yayi Guan. 2022. "Investigation of Parasitic Nematodes Detected in the Feces of Wild Carnivores in the Eastern Qinghai-Tibet Plateau, China" Pathogens 11, no. 12: 1520. https://doi.org/10.3390/pathogens11121520

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop