Investigation of Parasitic Nematodes Detected in the Feces of Wild Carnivores in the Eastern Qinghai-Tibet Plateau, China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Sampling
2.3. Molecular Identification
2.4. Statistics
2.5. Phylogenetic Analyses
3. Results
3.1. Host Species Composition
3.2. Nematode Detections
3.3. Nucleotide Polymorphisms and Haplotype Network Graph Construction Results
3.4. Nucleotide Polymorphisms
3.5. Phylogenetic Tree Results
3.6. Primers Variability Comparison
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Poinar, G.J. Nematoda (Roundworms). In eLS.; John Wiley & Sons, Ltd.: Chichester, UK, 2012; pp. 1–5. [Google Scholar]
- Morand, S.; Bouamer, S.; Hugot, J.-P. Nematodes. In Micro Mammals and Macroparasites: From Evolutionary Ecology to Management; Serge, M., Salah, B., Jean-Pierre, H., Eds.; Springer: Berlin/Heidelberg, Germany, 2005; Chapter 4; pp. 63–80. [Google Scholar]
- Barry, M.A.; Simon, G.G.; Mistry, N.; Hotez, P.J. Global trends in neglected tropical disease control and elimination: Impact on child health. Arch. Dis. Child. 2013, 98, 635–641. [Google Scholar] [CrossRef] [PubMed]
- Knopp, S.; Steinmann, P.; Keiser, J.; Utzinger, J. Nematode infections: Soil-transmitted helminths and trichinella. Infect. Dis. Clin. N. Am. 2012, 26, 341–358. [Google Scholar] [CrossRef] [PubMed]
- Sorobetea, D.; Svensson-Frej, M.; Grencis, R. Immunity to gastrointestinal nematode infections. Mucosal. Immunol. 2018, 11, 304–315. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lustigman, S.; Prichard, R.K.; Gazzinelli, A.; Grant, W.N.; Boatin, B.A.; McCarthy, J.S.; Basáñez, M.G. A research agenda for helminth diseases of humans: The problem of helminthiases. PLoS Negl. Trop. Dis. 2012, 6, e1582. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Y.D.; Zhou, C.H.; Zhu, H.H.; Huang, J.L.; Duan, L.; Zhu, T.J.; Qian, M.B.; Li, S.Z.; Chen, H.G.; Cai, L.; et al. National survey on the current status of important human parasitic diseases in China in 2015. Chin. J. Parasitol. Parasit. Dis. 2020, 38, 5–12. (In Chinese) [Google Scholar]
- Otranto, D.; Deplazes, P. Zoonotic nematodes of wild carnivores. Int. J. Parasitol. Parasites Wildl. 2019, 9, 370–383. [Google Scholar] [CrossRef]
- Rostami, A.; Ma, G.; Wang, T.; Koehler, A.V.; Hofmann, A.; Chang, B.C.H.; Macpherson, C.N.; Gasser, R.B. Human toxocariasis—A look at a neglected disease through an epidemiological ‘prism’. Infect. Genet. Evol. 2019, 74, 104002. [Google Scholar] [CrossRef]
- Hotez, P.J.; Wilkins, P.P. Toxocariasis: America’s most common neglected infection of poverty and a helminthiasis of global importance? PLoS Negl. Trop. Dis. 2009, 3, e400. [Google Scholar] [CrossRef]
- Wang, S.; Li, H.; Yao, Z.; Li, P.; Wang, D.; Zhang, H.; Xie, Q.; Zhang, Z.; Li, X. Toxocara infection: Seroprevalence and associated risk factors among primary school children in central China. Parasite 2020, 27, 30. [Google Scholar] [CrossRef]
- Kong, L.; Peng, H.J. Current epidemic situation of human toxocariasis in China. Adv. Parasitol. 2020, 109, 433–448. [Google Scholar]
- Brooker, S.; Hotez, P.J.; Bundy, D.A. Hookworm-related anaemia among pregnant women: A systematic review. PLoS Negl. Trop. Dis. 2008, 2, e291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, C.H.; Lee, S.C.; Huang, S.S.; Chang, L.C. Hookworm infection in a healthy adult that manifested as severe eosinphilia and diarrhea. J. Microbiol. Immunol. Infect. 2011, 44, 484–487. [Google Scholar] [CrossRef] [PubMed]
- Zibaei, M.; Nosrati, M.R.C.; Shadnoosh, F.; Houshmand, E.; Karami, M.F.; Rafsanjani, M.K.; Majidiani, H.; Ghaffarifar, F.; Cortes, H.C.E.; Dalvand, S.; et al. Insights into hookworm prevalence in Asia: A systematic review and meta-analysis. Trans. R. Soc. Trop. Med. Hyg. 2020, 114, 141–154. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.D.; Qian, M.B.; Zhu, H.H.; Zhou, C.H.; Zhu, T.J.; Huang, J.L.; Li, Z.J.; Li, S.Z.; Zhou, X.N.; Group on National Survey of Important Human Parasitic Diseases in China. Soil-transmitted helminthiasis in China: A national survey in 2014–2015. PLoS Negl. Trop. Dis. 2021, 15, e0009710. [Google Scholar] [CrossRef]
- Cai, J.Z. Classification of Nematode in Ruminantfrom Qinghai Province. Chin. J. Parasitol. Parasit. Dis. 2006, 24, 68–72. (In Chinese) [Google Scholar]
- Eslahi, A.V.; Badri, M.; Khorshidi, A.; Majidiani, H.; Hooshmand, E.; Hosseini, H.; Taghipour, A.; Foroutan, M.; Pestehchian, N.; Firoozeh, F.; et al. Prevalence of Toxocara and Toxascaris infection among human and animals in Iran with meta-analysis approach. BMC Infect. Dis. 2020, 20, 20. [Google Scholar] [CrossRef] [Green Version]
- Waindok, P.; Raue, K.; Grilo, M.L.; Siebert, U.; Strube, C. Predators in northern Germany are reservoirs for parasites of One Health concern. Parasitol. Res. 2021, 120, 4229–4239. [Google Scholar] [CrossRef]
- Chang, Q.C.; Gao, J.F.; Sheng, Z.H.; Lou, Y.; Zheng, X.; Wang, C.R. Sequence variability in three mitochondrial genes among four roundworm species from wild animals in China. Mitochondrial DNA 2015, 26, 75–78. [Google Scholar] [CrossRef]
- Xie, Y.; Chen, Z.; Zhao, B.; Niu, L.; Gu, X.; Yang, G. Characterization of Roundworms from Eleven Species of Captive Wild Canin and Feline Animals, in Sichuan Provinces, China, Using Mitochondrial and Nuclear Genes. In Proceedings of the 11th China Symposium on Young Workers of Parasitology, Kunming, China, 10 August 2018. (In Chinese). [Google Scholar]
- Seguel, M.; Gottdenker, N. The diversity and impact of hookworm infections in wildlife. Int. J. Parasitol. Parasites Wildl. 2017, 6, 177–194. [Google Scholar] [CrossRef]
- Karamon, J.; Dabrowska, J.; Kochanowski, M.; Samorek-Pierog, M.; Sroka, J.; Rozycki, M.; Bilska-Zajac, E.; Zdybel, J.; Cencek, T. Prevalence of intestinal helminths of red foxes (Vulpes vulpes) in central Europe (Poland): A significant zoonotic threat. Parasites Vectors 2018, 11, 436. [Google Scholar] [CrossRef]
- Kimpston, C.N.; Hatke, A.L.; Castelli, B.; Otto, N.; Tiffin, H.S.; Machtinger, E.T.; Brown, J.D.; Van Why, K.R.; Marconi, R.T. High Prevalence of Antibodies against Canine Parvovirus and Canine Distemper Virus among Coyotes and Foxes from Pennsylvania: Implications for the Intersection of Companion Animals and Wildlife. Microbiol. Spectr. 2022, 10, e0253221. [Google Scholar] [CrossRef] [PubMed]
- Treves, A.; Karanth, K.U. Human-carnivore conflict and perspectives on carnivore management worldwide. Conserv. Biol. 2003, 17, 1491–1499. [Google Scholar] [CrossRef]
- Myers, N.; Mittermeier, R.A.; Mittermeier, C.G.; Fonseca, G.; Kent, J.M.J.N. Biodiversity hotspots for conservation priorities. Nature 2000, 403, 853–858. [Google Scholar] [CrossRef] [PubMed]
- Dai, Y.; Xue, Y.; Hacker, C.E.; Zhang, Y.; Zhang, Y.; Liu, F.; Li, D. Human-carnivore conflicts and mitigation options in Qinghai province, Chian. J. Nat. Conser. 2020, 53, 125776. [Google Scholar] [CrossRef]
- Li, W.; Cao, W.; Wang, J.; Li, X.; Xu, C.; Shi, S.J.E.E. Effects of grazing regime on vegetation structure, productivity, soil quality, carbon and nitrogen storage of alpine meadow on the Qinghai-Tibetan Plateau. Ecol. Eng. 2017, 98, 123–133. [Google Scholar] [CrossRef]
- Miao, F.; Guo, Z.; Xue, R.; Wang, X.; Shen, Y. Effects of grazing and precipitation on herbage biomass, herbage nutritive value, and yak performance in an alpine meadow on the Qinghai-Tibetan Plateau. PLoS ONE 2015, 10, e0127275. [Google Scholar] [CrossRef] [Green Version]
- Hao, L.; Yuan, D.; Guo, L.; Hou, W.; Mo, X.; Yin, J.; Yang, A.; Li, R. Molecular detection of Bartonella in ixodid ticks collected from yaks and plateau pikas (Ochotona curzoniae) in Shiqu County, China. BMC Vet. Res. 2020, 16, 235. [Google Scholar] [CrossRef]
- Wang, D.; Wu, J.; Wang, Y.; Ji, Y. Finding High-Quality Groundwater Resources to Reduce the Hydatidosis Incidence in the Shiqu County of Sichuan Province, China: Analysis, Assessment, and Management. Expos. Health 2020, 12, 307–322. [Google Scholar] [CrossRef]
- Shao Xinning, S.D.; Huang, Q.; Li, S.; Yao, M. Fast surveys and molecular diet analysis of carnivores based on fecal DNA and metabarcoding. Biodiv. Sci. 2019, 27, 543–556. (In Chinese) [Google Scholar] [CrossRef]
- Cannon, M.V.; Bogale, H.; Rutt, L.; Humphrys, M.; Korpe, P.; Duggal, P.; Ravel, J.; Serre, D. A high-throughput sequencing assay to comprehensively detect and characterize unicellular eukaryotes and helminths from biological and environmental samples. Microbiome 2018, 6, 195. [Google Scholar] [CrossRef] [Green Version]
- Catalano, S.; Lejeune, M.; van Paridon, B.; Pagan, C.A.; Wasmuth, J.D.; Tizzani, P.; Duignan, P.J.; Nadler, S.A. Morphological variability and molecular identification of Uncinaria spp. (Nematoda: Ancylostomatidae) from grizzly and black bears: New species or phenotypic plasticity? J. Parasitol. 2015, 101, 182–192. [Google Scholar] [CrossRef] [PubMed]
- Mikaeili, F.; Mirhendi, H.; Mohebali, M.; Hosseini, M.; Sharbatkhori, M.; Zarei, Z.; Kia, E.B. Sequence variation in mitochondrial cox1 and nad1 genes of ascaridoid nematodes in cats and dogs from Iran. J. Helminthol. 2015, 89, 496–501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiong, M.; Shao, X.; Long, Y.; Bu, H.; Zhang, D.; Wang, D.; Li, S.; Wang, R.; Yao, M. Molecular analysis of vertebrates and plants in scats of leopard cats (Prionailurus bengalensis) in southwest China. J. Mammal. 2016, 97, 1054–1064. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Green Version]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Green Version]
- Nadler, S.A.; Adams, B.J.; Lyons, E.T.; DeLong, R.L.; Melin, S.R. Molecular and morphometric evidence for separate species of Uncinaria (Nematoda: Ancylostomatidae) in California sea lions and northern fur seals: Hypothesis testing supplants verification. J. Parasitol. 2000, 86, 1099–1106. [Google Scholar] [CrossRef]
- Bowman, D.D.; Montgomery, S.P.; Zajac, A.M.; Eberhard, M.L.; Kazacos, K.R. Hookworms of dogs and cats as agents of cutaneous larva migrans. Trends Parasitol. 2010, 26, 162–167. [Google Scholar] [CrossRef]
- Postigo, I.; Martínez, J.; Cardona, G.; Fernández-Pérez, I.; Guisantes, J.A. Uncinaria stenocephala: Antigenic characterization of larvae and adults worms using sera from naturally infected dogs. Exp. Parasitol. 2003, 103, 171–173. [Google Scholar] [CrossRef]
- Rodan, I.; Sparkes, A.H. The Cat; Susan, E.L., Ed.; Saunders: Philadelphia, PA, USA, 2012; Chapter 8; pp. 151–180. [Google Scholar]
- Datz, C. Parasitic and Protozoal Diseases. In Small Animal Pediatrics; Peterson, M.E., Kutzler, M.A., Eds.; Elsevier: St. Louis, MO, USA, 2011; Chapter 19; pp. 154–160. [Google Scholar]
- Feldmeier, H.; Schuster, A. Mini review: Hookworm-related cutaneous larva migrans. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 915–918. [Google Scholar] [CrossRef] [PubMed]
- Heukelbach, J.; Feldmeier, H. Epidemiological and clinical characteristics of hookworm-related cutaneous larva migrans. Lancet Infec. Dis. 2008, 8, 302–309. [Google Scholar] [CrossRef] [PubMed]
- Matthews, M.; Vanlier, C.; Montjoye, L.; Baeck, M. A creeping holiday souvenir: About a misleading case of hookworm folliculitis J. Trave. Med. 2020, 27, taaa101. [Google Scholar] [CrossRef]
- Wu, J.; Chen, D.M.; Ma, F.H. Studies on the Tibetan fox and pig badger Uncinario stenocephala. Chin. J. Wild. 1982, 3, 53–55. (In Chinese) [Google Scholar]
- Zhang, Z.P.; Hu, G.W.; Zhao, Q.B.; Li, J.; Shen, Y.L.; Zhou, L.; Li, S.; Cai, J.S. Uncinaria stenocephala found in the Sanjiangyuan area. China Anim. Husb. Vet. Med. 2019, 11, 29–30. (In Chinese) [Google Scholar]
- Al-Sabi, M.N.; Halasa, T.; Kapel, C.M. Infections with cardiopulmonary and intestinal helminths and sarcoptic mange in red foxes from two different localities in Denmark. Acta Parasitol. 2014, 59, 98–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Criado-Fornelio, A.; Gutierrez-Garcia, L.; Rodriguez-Caabeiro, F.; Reus-Garcia, E.; Roldan-Soriano, M.A.; Diaz-Sanchez, M.A. A parasitological survey of wild red foxes (Vulpes vulpes) from the province of Guadalajara, Spain. Vet. Parasitol. 2000, 92, 245–251. [Google Scholar] [CrossRef]
- Hofer, S.; Gloor, S.; MÜLler, U.; Mathis, A.; Hegglin, D.; Deplazes, P. High prevalence of Echinococcus multilocularis in urban red foxes (Vulpes vulpes) and voles (Arvicola terrestris) in the city of Zürich, Switzerland. Parasitology 2000, 120, 135–142. [Google Scholar] [CrossRef] [Green Version]
- Reperant, L.A.; Hegglin, D.; Fischer, C.; Kohler, L.; Weber, J.-M.; Deplazes, P. Influence of urbanization on the epidemiology of intestinal helminths of the red fox (Vulpes vulpes) in Geneva, Switzerland. Parasitol. Res. 2007, 101, 605–611. [Google Scholar] [CrossRef] [Green Version]
- Di Cerbo, A.R.; Manfredi, M.T.; Bregoli, M.; Cova, M. Wild carnivores as source of zoonotic helminths in north-eastern Italy. Helminthologia 2008, 45, 13–19. [Google Scholar] [CrossRef] [Green Version]
- Stuart, P.; Golden, O.; Zintl, A.; de Waal, T.; Mulcahy, G.; McCarthy, E.; Lawton, C. A coprological survey of parasites of wild carnivores in Ireland. Parasitol. Res. 2013, 112, 3587–3593. [Google Scholar] [CrossRef] [PubMed]
- Ghadirian, E. Human Infection with Uncinaria in North of Iran. Iranian J. Parasitol. 2007, 2, 38–41. [Google Scholar]
- Alonso-Sanz, M.; Chaves, F.; Dronda, F.; Catalán, S.; González-López, A. Intestinal parasitoses in the prison population in the Madrid area (1991–1993). Enferm. Infecc. Microbiol. Clin. 1995, 13, 90–95. [Google Scholar] [PubMed]
- Baple, K.; Clayton, J. Hookworm-related cutaneous larva migrans acquired in the UK. BMJ Case. Rep. 2015, 2015, bcr2015210165. [Google Scholar] [CrossRef]
- Jin, Y.C.; Li, X.Y.; Liu, J.H.; Zhu, X.Q.; Liu, G.H. Comparative analysis of mitochondrial DNA datasets indicates that Toxascaris leonina represents a species complex. Parasites Vectors 2019, 12, 194. [Google Scholar] [CrossRef] [Green Version]
- Rostami, A.; Riahi, S.M.; Fallah Omrani, V.; Wang, T.; Hofmann, A.; Mirzapour, A.; Foroutan, M.; Fakhri, Y.; Macpherson, C.N.L.; Gasser, R.B. Global Prevalence Estimates of Toxascaris leonina Infection in Dogs and Cats. Pathogens 2020, 9, 503. [Google Scholar] [CrossRef]
- Laatamna, A.; Baroudi, D.; Samari, H.; Ziane, H.; Alim, O.; Telibi, M.; Taoussi, D. First report on occurrence of zoonotic helminth Toxocara canis, Toxascaris leonina and Ancylostoma caninum in domestic dogs from province of Djelfa, Algeria. Ann. Parasitol. 2021, 67, 111–116. [Google Scholar]
- Rausch, R.L.; Fay, F.H. Toxascaris leonina in Rodents, and Relationship to Eosinophilia in a Human Population. Comp. Parasitol. 2011, 78, 236–244. [Google Scholar] [CrossRef]
- Parsons, J.C. Ascarid Infections of Cats and Dogs. Vet. Clin. N. Am. Small. Anim. Pract. 1987, 17, 1307–1339. [Google Scholar] [CrossRef]
- Conboy, G. Natural infections of Crenosoma vulpis and Angiostrongylus vasorum in dogs in Atlantic Canada and their treatment with milbemycin oxime. Vet. Rec. 2004, 155, 16–18. [Google Scholar] [CrossRef]
- Hanson, K.B. Tests of the efficacy of single treatments with trachéal brushes in the mechanical removal of lungworms from foxes. J. Am. Vet. Med. Assoc. 1933, 82, 12–33. [Google Scholar]
- Colella, V.; Mutafchiev, Y.; Cavalera, M.A.; Giannelli, A.; Lia, R.P.; Dantas-Torres, F.; Otranto, D. Development of Crenosoma vulpis in the common garden snail Cornu aspersum: Implications for epidemiological studies. Parasites Vectors 2016, 9, 208. [Google Scholar] [CrossRef] [Green Version]
- Nevárez, A.; López, A.; Conboy, G.; Ireland, W.; Sims, D. Distribution of Crenosoma vulpis and Eucoleus aerophilus in the lung of free-ranging red foxes (Vulpes vulpes). J. Vet. Diagn. Investig. 2005, 17, 486–489. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Latrofa, M.S.; Lia, R.P.; Giannelli, A.; Colella, V.; Santoro, M.; D’Alessio, N.; Campbell, B.E.; Parisi, A.; Dantas-Torres, F.; Mutafchiev, Y.; et al. Crenosoma vulpis in wild and domestic carnivores from Italy: A morphological and molecular study. Parasitol. Res. 2015, 114, 3611–3617. [Google Scholar] [CrossRef] [PubMed]
- Tolnai, Z.; Szell, Z.; Sreter, T. Environmental determinants of the spatial distribution of Angiostrongylus vasorum, Crenosoma vulpis and Eucoleus aerophilus in Hungary. Vet. Parasitol. 2015, 207, 355–358. [Google Scholar] [CrossRef] [PubMed]
- Pereira, F.B.; Sousa, B.M.; Lima Sde, S. A new species of Pharyngodonidae (Nematoda) of Tropidurus torquatus (Squamata:Tropiduridae) from Brazil. J. Parasitol. 2011, 97, 311–317. [Google Scholar] [CrossRef]
- Setsuda, A.; Kato, E.; Sakaguchi, S.; Tamemasa, S.; Ozawa, S.; Sato, H. Chabaudstrongylus ninhae (Trichostrongylidae: Cooperiinae) and Oesophagostomum muntiacum (Chabertiidae: Oesophagostominae) in feral alien Reeves’s muntjacs on Izu-Oshima Island, Tokyo, Japan. J. Helminthol. 2019, 94, e48. [Google Scholar] [CrossRef]
- Medkour, H.; Amona, I.; Laidoudi, Y.; Davoust, B.; Bitam, I.; Levasseur, A.; Akiana, J.; Diatta, G.; Pacheco, L.; Gorsane, S.; et al. Parasitic Infections in African Humans and Non-Human Primates. Pathogens 2020, 9, 561. [Google Scholar] [CrossRef]
- Mustakdir, Z.; Akbari, R.A.; Retnani, E.B.; Tiuria, R. Aspiculuris tetraptera Infection in Mice: Parasite degree and Differential Leukocyte. J. Ris. Vet. Indones. 2022, 6, 86–91. [Google Scholar]
- Neupane, B.; Miller, A.L.; Evans, A.L.; Olsson, G.E.; Hoglund, J. Seasonal variation of Mastophorus muris (Nematoda: Spirurida) in the water vole Arvicola amphibius from southern Sweden. J. Helminthol. 2018, 94, e6. [Google Scholar] [CrossRef]
- Pybus, M.J.; Shave, H. Muellerius capillaris (Mueller, 1889) (Nematoda: Protostrongylidae): An unusual finding in Rocky Mountain bighorn sheep (Ovis canadensis canadensis Shaw) in South Dakota. J. Wild. Dis. 1984, 20, 284–288. [Google Scholar] [CrossRef]
- Foreyt, W.J.; Jenkins, E.J.; Appleyard, G.D. Transmission of lungworms (Muellerius capillaris) from domestic goats to bighorn sheep on common pasture. J. Wild. Dis. 2009, 45, 272–278. [Google Scholar] [CrossRef] [Green Version]
- Zalewski, A.; Kołodziej-Sobocińska, M.; Bartoń, K.A. A tale of two nematodes: Climate mediates mustelid infection by nematodes across the geographical range. Int. J. Parasitol. Parasites Wildl. 2022, 17, 218–224. [Google Scholar] [CrossRef] [PubMed]
- Vergles Rataj, A.; Posedi, J.; Zele, D.; Vengust, G. Intestinal parasites of the red fox (Vulpes vulpes) in Slovenia. Acta Vet. Hung. 2013, 61, 454–462. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wang, X.; Lu, Q. Selection of land cover by the Tibetan fox Vulpes ferrilata on the eastern Tibetan Plateau, western Sichuan Province, China. Acta Theriol. 2007, 52, 215–223. [Google Scholar] [CrossRef]
- Shengwu, Z. Feeding information of Tibetan fox. Acta Terminol. Sin. 1985, 3, 222–240. (In Chinese) [Google Scholar]
- Liu, Q.; Harris, R.B.; Wang, X. Food habits of the Tibetan fox (Vulpes ferrilata) in the Kunlun Mountains, Qinghai Province, China. Mamm. Biol. 2010, 75, 283–286. [Google Scholar] [CrossRef]
- Wang, Z.-H.; Wang, X.-M.; Chmura, A. Den Habitat Characteristics of Tibetan Foxes (Vulpes ferrilata) in Shiqu County, Sichuan Province, China. Zool. Stud. 2008, 47, 445–454. [Google Scholar]
- Deng, Z.J. Analysis on Anim alHusbandry Status and the Feasibility of Developm ent Characteristic Breedingin GanziState. Mod. Agric. Sci. Technol 2012, 17, 312–314. (In Chinese) [Google Scholar]
- Craig, P.S.; Giraudoux, P.; Wang, Z.H.; Wang, Q. Echinococcosis transmission on the Tibetan Plateau. Adv. Parasitol. 2019, 104, 165–246. [Google Scholar]
- Walker, J.G.; Morgan, E.R. Generalists at the interface: Nematode transmission between wild and domestic ungulates. Int. J. Parasitol. Parasites Wildl. 2014, 3, 242–250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wells, K.; Gibson, D.I.; Clark, N.J.; Ribas, A.; Morand, S.; McCallum, H.I. Global spread of helminth parasites at the human-domestic animal-wildlife interface. Glob. Chang. Biol. 2018, 24, 3254–3265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, M.; Han, S.; Xue, C.; Wang, X.; Liu, B.; Wang, Y.; Wang, L.; Wei, S.; Cui, X.; Zhang, T.; et al. Contribution to the echinococcosis control programme in China by NIPD-CTDR. Adv. Parasitol. 2020, 110, 107–144. [Google Scholar] [PubMed]
- Lei, Z.L.; Wang, L.Y. Control situation and primary task of key parasitic diseases in China. Chin. J. Parasit. Dis. 2012, 30, 1–5. (In Chinese) [Google Scholar]
- Thompson, R.C. Parasite zoonoses and wildlife: One Health, spillover and human activity. Int. J. Parasitol. 2013, 43, 1079–1088. [Google Scholar] [CrossRef]
Primers | Classification | Names | Target Genes | Primer Sequences (From 5′ to 3′) | Amplicon Length (bp) | Annealing Temperature (°C) | Reference |
---|---|---|---|---|---|---|---|
Parasitic universal primers | Nematode | Nem A | 18S rRNA | F/CACCCGTGAGGATTGACAG R/CGATCACGGAGGATTTTCAA | 320–335 | 53 | [33] |
Nematode | Nem B | 18S rRNA | F/CGTCATTGCTGCGGTTAAAA R/CCGTCCTTCGAACCTCTGAC | 380–410 | 55 | [33] | |
Nematode | Nem C | 18S rRNA | F/AGTGGAGCATGCGGCTTAAT R/TGCAATTCCCTRTCCCAGTC | 380–440 | 55 | [33] | |
Parasitic specific primers | Uncinaria | ITS1 | ITS1 | F/TTGAACCGGGTAAAAGTCG R/CGTTTTTCATCGATACGCG | 432 | 54 | [34] |
Toxascaris | ND1 | nad1 | F/TTCTTATGAGATTGCTTTT R/TATCATAACGAAAACGAGG | 370 | 50 | [35] | |
Host universal primers | Vertebrate | 16S | 16S rRNA | F/GAGAAGACCCTATGGAGC R/ATAGAAACCGACCTGGAT | 380 | 55 | [36] |
Nematodes | Detection Rate % (No. Positive of Samples/No. Total Fecal Samples, 95% CI) Carnivores | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Vulpes ferrilata | Vulpes vulpes | χ2 | p | Canis lupus | Vulpes sp. | Meles leucurus | Mustela altaica | Prionailurus bengalensis | Total | |
Toxascaris sp. | 16.92 (33/195, 11.66–22.19) | 5.26 (2/38, 0.64–17.75) | 3.387 | 0.06 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 14.58 (35/240, 10.12–19.05) a |
Aspiculuris tetraptera | 0.51 (1/195, 0.00–1.52) | 0.00 (0/38) | 0.000 | 1.00 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 0.42 (1/240, 0.00–1.23) b |
Mastophorus muris | 2.56 (5/195, 0.35–4.78) | 7.89 (3/38, 1.66–21.38) | 2.726 | 0.24 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 3.33 (8/240, 1.06–5.60) b |
Uncinaria stenocephala | 40.00 (78/195, 33.12–46.88) | 21.05 (8/38, 8.09–34.01) | 4.903 | <0.05 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 35.83 (86/240, 29.77–42.25) c |
Crenosoma vulpis | 0.51 (1/195, 0.00–1.52) | 0.00 (0/38) | 0.000 | 1.00 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 0.42 (1/240, 0.00–1.23) b |
Oesophagostomum muntiacum | 0.51 (1/195, 0.00–1.52) | 2.63 (1/38, 0.07–13.81) | 0.000 | 0.30 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 0.83 (2/240, 0.00–1.98) b |
Nematodirus spathiger | 0.51 (1/195, 0.00–1.52) | 0.00 (0/38) | 0.000 | 0.05 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 0.42 (1/240, 0.00–1.23) b |
Muellerius capillaris | 0.00 (0/195) | 2.63 (1/38, 0.07–13.81) | 0.000 | 0.16 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 0.42 (1/240, 0.00–1.23) b |
Molineus patens | 0.00 (0/195) | 5.26 (2/38, 0.64–17.75) | 0.000 | <0.05 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 0.83 (2/240, 0.00–1.98) b |
Parapharyngodon bainae | 1.03 (2/195, 0.00–2.44) | 0.00 (0/38) | 0.000 | 1.00 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 0.83 (2/240, 0.00–1.98) b |
Total | 62.56 (122/195, 55.77–69.36) | 44.74 (17/38, 28.62–61.70) | 4.200 | <0.05 | 0.00 (0/2) | 0.00 (0/2) | 0.00 (0/1) | 0.00 (0/1) | 0.00 (0/1) | 57.92 (139/240, 51.67–64.16) |
Nematodes | No. of Sequences | No. of Haplotypes | Haplotype Diversity | Nucleotide Diversity | Tajima’s D | Fu’s Fs |
---|---|---|---|---|---|---|
Uncinaria stenocephala | 122 | 17 | 0.470 ± 0.052 | 0.00249 ± 0.00037 | −2.20369, p < 0.01 | −12.411, p < 0.01 |
Toxascaris sp. | 45 | 18 | 0.836 ± 0.048 | 0.01836 ± 0.00305 | −0.49277, p > 0.10 | −2.610, p > 0.10 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Q.; Wang, X.; Li, C.; Wu, W.; Zhang, K.; Deng, X.; Xie, Y.; Guan, Y. Investigation of Parasitic Nematodes Detected in the Feces of Wild Carnivores in the Eastern Qinghai-Tibet Plateau, China. Pathogens 2022, 11, 1520. https://doi.org/10.3390/pathogens11121520
Chen Q, Wang X, Li C, Wu W, Zhang K, Deng X, Xie Y, Guan Y. Investigation of Parasitic Nematodes Detected in the Feces of Wild Carnivores in the Eastern Qinghai-Tibet Plateau, China. Pathogens. 2022; 11(12):1520. https://doi.org/10.3390/pathogens11121520
Chicago/Turabian StyleChen, Qilu, Xu Wang, Chunyang Li, Weiping Wu, Kaige Zhang, Xueying Deng, Yi Xie, and Yayi Guan. 2022. "Investigation of Parasitic Nematodes Detected in the Feces of Wild Carnivores in the Eastern Qinghai-Tibet Plateau, China" Pathogens 11, no. 12: 1520. https://doi.org/10.3390/pathogens11121520