The Role of luxS in the Middle Ear Streptococcus pneumoniae Isolate 947
Abstract
:1. Introduction
2. Results
2.1. The Otitis Media Isolate 947 Displays Differences in Expression of Quorum Sensing Associated Genes Compared to the Blood Isolate 4559
2.2. Exogenous AI-2 Has Different Effects on the Blood and Ear Isolates
2.3. luxS Is Critical for Adherence of 947 to Epithelial Cells, but Does Not Play a Role in In Vitro Biofilm Formation
2.4. luxS Does Not Influence Capsule Production, but Reduces the Capacity of the S. pneumoniae Middle Ear Isolate 947 to Cause Invasive Disease
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Culture Conditions
4.2. qRT-PCR Gene Expression Analyses
4.3. Construction of Mutants
4.4. Assessment of Biofilm Formation
4.5. Assessment of Capsule Production
4.6. Murine Infection Model
4.7. Adherence Assays
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Chaguza, C.; Senghore, M.; Bojang, E.; Gladstone, R.A.; Lo, S.W.; Tientcheu, P.-E.; Bancroft, R.E.; Worwui, A.; Foster-Nyarko, E.; Ceesay, F. Within-host microevolution of Streptococcus pneumoniae is rapid and adaptive during natural colonisation. Nat. Commun. 2020, 11, 3442. [Google Scholar] [CrossRef] [PubMed]
- Bogaert, D.; van Belkum, A.; Sluijter, M.; Luijendijk, A.; de Groot, R.; Rümke, H.; Verbrugh, H.; Hermans, P. Colonisation by Streptococcus pneumoniae and Staphylococcus aureus in healthy children. Lancet 2004, 363, 1871–1872. [Google Scholar] [CrossRef]
- O’brien, K.L.; Wolfson, L.J.; Watt, J.P.; Henkle, E.; Deloria-Knoll, M.; McCall, N.; Lee, E.; Mulholland, K.; Levine, O.S.; Cherian, T. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: Global estimates. Lancet 2009, 374, 893–902. [Google Scholar] [CrossRef]
- Bergenfelz, C.; Hakansson, A.P. Streptococcus pneumoniae otitis media pathogenesis and how it informs our understanding of vaccine strategies. Curr. Otorhinolaryngol. Rep. 2017, 5, 115–124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hall-Stoodley, L.; Hu, F.Z.; Gieseke, A.; Nistico, L.; Nguyen, D.; Hayes, J.; Forbes, M.; Greenberg, D.P.; Dice, B.; Burrows, A.; et al. Direct detection of bacterial biofilms on the middle-ear mucosa of children with chronic otitis media. JAMA 2006, 296, 202–211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chao, Y.; Marks, L.R.; Pettigrew, M.M.; Hakansson, A.P. Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease. Front. Cell. Infect. Microbiol. 2015, 4, 194. [Google Scholar] [CrossRef] [Green Version]
- Mukherjee, S.; Bassler, B.L. Bacterial quorum sensing in complex and dynamically changing environments. Nat. Rev. Microbiol. 2019, 17, 371–382. [Google Scholar] [CrossRef]
- Trappetti, C.; Potter, A.J.; Paton, A.W.; Oggioni, M.R.; Paton, J.C. LuxS mediates iron-dependent biofilm formation, competence, and fratricide in Streptococcus pneumoniae. Infect. Immun. 2011, 79, 4550–4558. [Google Scholar] [CrossRef] [Green Version]
- Stroeher, U.H.; Paton, A.W.; Ogunniyi, A.D.; Paton, J.C. Mutation of luxS of Streptococcus pneumoniae affects virulence in a mouse model. Infect. Immun. 2003, 71, 3206–3212. [Google Scholar] [CrossRef] [Green Version]
- Trappetti, C.; McAllister, L.J.; Chen, A.; Wang, H.; Paton, A.W.; Oggioni, M.R.; McDevitt, C.A.; Paton, J.C.J.M. Autoinducer 2 signaling via the phosphotransferase FruA drives galactose utilization by Streptococcus pneumoniae, resulting in hypervirulence. mBio 2017, 8, e02269-16. [Google Scholar] [CrossRef] [Green Version]
- Trappetti, C.; van der Maten, E.; Amin, Z.; Potter, A.J.; Chen, A.Y.; van Mourik, P.M.; Lawrence, A.J.; Paton, A.W.; Paton, J.C. Site of isolation determines biofilm formation and virulence phenotypes of Streptococcus pneumoniae serotype 3 clinical isolates. Infect. Immun. 2013, 81, 505–513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Armbruster, C.E.; Hong, W.; Pang, B.; Dew, K.E.; Juneau, R.A.; Byrd, M.S.; Love, C.F.; Kock, N.D.; Swords, W.E. LuxS promotes biofilm maturation and persistence of nontypeable Haemophilus influenzae in vivo via modulation of lipooligosaccharides on the bacterial surface. Infect. Immun. 2009, 77, 4081–4091. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Daines, D.A.; Bothwell, M.; Furrer, J.; Unrath, W.; Nelson, K.; Jarisch, J.; Melrose, N.; Greiner, L.; Apicella, M.; Smith, A.L. Haemophilus influenzae luxS mutants form a biofilm and have increased virulence. Microb. Pathog. 2005, 39, 87–96. [Google Scholar] [CrossRef] [PubMed]
- Minhas, V.; Harvey, R.M.; McAllister, L.J.; Seemann, T.; Syme, A.E.; Baines, S.L.; Paton, J.C.; Trappetti, C. Capacity to utilize raffinose dictates pneumococcal disease phenotype. mBio 2019, 10, e02596-18. [Google Scholar] [CrossRef] [Green Version]
- Minhas, V.; Aprianto, R.; McAllister, L.J.; Wang, H.; David, S.C.; McLean, K.T.; Comerford, I.; McColl, S.R.; Paton, J.C.; Veening, J.-W.; et al. In vivo dual RNA-seq reveals that neutrophil recruitment underlies differential tissue tropism of Streptococcus pneumoniae. Commun. Biol. 2020, 3, 293. [Google Scholar] [CrossRef]
- Paixão, L.; Oliveira, J.; Veríssimo, A.; Vinga, S.; Lourenço, E.C.; Ventura, M.R.; Kjos, M.; Veening, J.-W.; Fernandes, V.E.; Andrew, P.W.; et al. Host glycan sugar-specific pathways in Streptococcus pneumoniae: Galactose as a key sugar in colonisation and infection. PLoS ONE 2015, 10, e0121042. [Google Scholar] [CrossRef] [Green Version]
- Tikhomirova, A.; Trappetti, C.; Paton, J.C.; Watson-Haigh, N.; Wabnitz, D.; Jervis-Bardy, J.; Jardeleza, C.; Kidd, S.P. A single nucleotide polymorphism in an IgA1 protease gene determines Streptococcus pneumoniae adaptation to the middle ear during otitis media. Pathog. Dis. 2021, 79, ftaa077. [Google Scholar] [CrossRef]
- Hamaguchi, S.; Zafar, M.A.; Cammer, M.; Weiser, J.N. Capsule prolongs survival of Streptococcus pneumoniae during starvation. Infect. Immun. 2018, 86, e00802-17. [Google Scholar] [CrossRef] [Green Version]
- Vidal, J.E.; Howery, K.E.; Ludewick, H.P.; Nava, P.; Klugman, K.P. Quorum-Sensing Systems LuxS/Autoinducer 2 and Com regulate Streptococcus pneumoniae biofilms in a bioreactor with living cultures of human respiratory cells. Infect. Immun. 2013, 81, 1341–1353. [Google Scholar] [CrossRef] [Green Version]
- Kloosterman, T.G.; Bijlsma, J.J.; Kok, J.; Kuipers, O.P. To have neighbour’s fare: Extending the molecular toolbox for Streptococcus pneumoniae. Microbiology 2006, 152, 351–359. [Google Scholar] [CrossRef] [Green Version]
- Abrantes, P.M.; Africa, C.W.J. Measuring Streptococcus mutans, Streptococcus sanguinis and Candida albicans biofilm formation using a real-time impedance-based system. J. Microbiol. Methods 2020, 169, 105815. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence (5′–3′) |
---|---|
gyrA-RT-R | ACCTGATTTCCCCATGCAA |
gyrA-RT-F | ACTGGTATCGCGGTTGGGAT |
luxS-RT-F | CCCTATGTTCGCTTGATTGGGG |
luxS-RT-R | AGTCAATCATGCCGTCAATGCG |
fruA-RT-F | TCAATCGTCCAGTTGCTGAC |
fruA-RT-R | TTTGTACAAGGCACCACCAA |
luxS Janus down | CATTATCCATTAAAAATCAAACGGCTTTCGACAATAACTTCTTTTG |
luxS Janus forw | GGAAAGGGGCCAGGTCTCTGCCTTTGAACGTCATGTGATTTAA |
luxS forw | CAAATCAATGGCATCAAATCT |
luxS down | TGATAAGGTGACAGACTTC |
Janus forw | AGACCTGGGCCCCTTTCC |
Janus down | CCGTTTGATTTTTAATGGATA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tikhomirova, A.; Brazel, E.B.; McLean, K.T.; Agnew, H.N.; Paton, J.C.; Trappetti, C. The Role of luxS in the Middle Ear Streptococcus pneumoniae Isolate 947. Pathogens 2022, 11, 216. https://doi.org/10.3390/pathogens11020216
Tikhomirova A, Brazel EB, McLean KT, Agnew HN, Paton JC, Trappetti C. The Role of luxS in the Middle Ear Streptococcus pneumoniae Isolate 947. Pathogens. 2022; 11(2):216. https://doi.org/10.3390/pathogens11020216
Chicago/Turabian StyleTikhomirova, Alexandra, Erin B. Brazel, Kimberley T. McLean, Hannah N. Agnew, James C. Paton, and Claudia Trappetti. 2022. "The Role of luxS in the Middle Ear Streptococcus pneumoniae Isolate 947" Pathogens 11, no. 2: 216. https://doi.org/10.3390/pathogens11020216