Next Article in Journal
Proteomic Analysis of Sporothrix schenckii Exposed to Oxidative Stress Induced by Hydrogen Peroxide
Previous Article in Journal
Salivary miR-31-5p, miR-345-3p, and miR-424-3p Are Reliable Biomarkers in Patients with Oral Squamous Cell Carcinoma
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Escherichia coli Strains Responsible for Cystitis in Female Pediatric Patients with Normal and Abnormal Urinary Tracts Have Different Virulence Profiles

by
Marta de Oliveira Domingos
1,*,
Silvio Marciano da Silva Junior
1,
Wagner Milanello
2,†,
Shirley Sizue Nakamura Nakano
2,
Marcia Regina Franzolin
1,
Luis Fernando dos Santos
3,
Kamila Oliveira Nunes
1,
Vaniky Duarte Marques
1,
Waldir P. Elias
1,
Herbert Guimarães de Sousa Silva
1,
Bruna De Lucca Caetano
1 and
Roxane Maria Fontes Piazza
1
1
Laboratório de Bacteriologia, Instituto Butantan, Avenida Vital Brasil, 1500, São Paulo 05503-900, SP, Brazil
2
Hospital Infantil Darcy Vargas, Rua Seráfico de Assis Carvalho, 34, São Paulo 05614-040, SP, Brazil
3
Centro de Bacteriologia, Núcleo de Doenças Entéricas, Instituto Adolfo Lutz, Avenida Dr. Arnaldo, 355, São Paulo 01246-000, SP, Brazil
*
Author to whom correspondence should be addressed.
In memoriam.
Pathogens 2022, 11(2), 231; https://doi.org/10.3390/pathogens11020231
Submission received: 28 December 2021 / Revised: 27 January 2022 / Accepted: 8 February 2022 / Published: 10 February 2022
(This article belongs to the Section Bacterial Pathogens)

Abstract

:
The role of uropathogenic Escherichia coli (UPEC) in colonization and infection of female patients with anatomical and functional abnormalities of the urinary system is elusive. In this study, the phenotype, genotype and the phylogeny of UPEC strains isolated from the urine of pediatric female patients with cystitis of normal and abnormal urinary tract were determined. Multiplex PCR results demonstrated that 86% of the strains isolated from female patients with normal urinary tract (NUT), belonged to the phylo-groups B2 and D. Their prevalence decreased to 23% in strains isolated from patients with abnormal urinary tract (AUT). More of the isolates from AUT patients produced a biofilm on polystyrene and polyvinyl chloride (PVC), adhered to epithelial cells, and encoded pap and sfa genes than strains isolated from female patients with NUT. In contrast, a higher number of hemolysin-producing strains with serogroups associated with UPEC were isolated from patients with NUT. In summary, the results suggest that cystitis in female patients with NUT is associated with ExPEC, whereas cystitis in female patients with AUT is associated with pathogenic intestinal E. coli strains that have acquired the ability to colonize the bladder.

1. Introduction

After respiratory infection, urinary tract infection (UTI) is the most common infection in children [1]. Although it is considered a benign infection in healthy adults, UTI may raise the risk of pyelonephritis, fetal mortality and renal complications in pediatric patients.
Several bacterial species can cause urinary tract infection, however, the main etiological agents responsible for community-acquired UTI worldwide, and a large portion of nosocomial UTIs, are uropathogenic E. coli [2,3].
UPEC strains have developed along evolution several fimbrial adhesins that help them to colonize the urinary tract [4]. The primary adherence fimbriae of UPEC are type 1, P and S, encoded by the operons fimH, pap and sfa respectively [5].
The type 1 fimbria is associated to the bacterial process of colonization and invasion of the host cells, while P and S fimbriae enhance the establishment of E. coli infection in the urinary tract and significantly lower the number of colony forming-units (CFU) necessary to cause UTI [6].
UPEC strains can also produce a wide variety of virulence factors such as hemolysin, Pic, Pet Sat and cytotoxic necrotizing type 1 (CNF-1) factor among others [7,8]. However, the prevalence of these factors differs from one strain to another, which may influence the prognosis of the disease [9].
Classical UPEC strains belong to the phylogenetic groups B2 and D, which includes most virulent extraintestinal E. coli strains [10,11,12]. They are also predominant in the following serogroups: O2, O6, O7, O8, O15, O16, O18, O21, O22, O25, O75 and O83 [13,14].
The most common type of UTI encountered in women is cystitis. Despite the fact that most cases of cystitis can easily be cured in patients with a normal urinary tract, it is not the same in the case of patients with anatomical malformation or with abnormal functionality of the urinary tract.
The anomalies of the urinary tract can be divided into nephropaties and uropathies [15]. Nephropaties are associated with disfunction and/or mal-formation of the kidneys whereas uropathies represent pathologies of the urinary tract which depending on the site of the anomaly, they can be pyeloureteral and ureterovesical, or they can relate to the vesicoureteral reflux and to the posterior urethral valve [15].
The most common mal formation of the urinary tract described in children are vesicoureteral reflux, obstructive megaureter, posterior urethral valve and megaystis.
The anomalies can also affect the bladder and expose its mucosa to the external environment. Some patients can also present rectal prolapse and anal incontinence [15].
In these patients, a clinical picture of cystitis can become more severe, since bacteria have better conditions to ascend to the kidneys and induce pyelonephritis. The use of catheters can also contribute to the severity of the infection, since they can become a platform for bacterial biofilm formation and infection [16].
Other factors that influence the development of UTI in women are age, hormone levels and sexual intercourse. For instance, in female pediatric patients the incidence of UTI is 0.4–1% in early age, increases to 0.9–1.4% between the ages 1 and 5 years old and reaches its highest point in school-age girls [17].
Accordingly, the aim of this study was to investigate whether E. coli strains responsible for cystitis in teenage girls (10–16 years old) with normal urinary tract (NUT) have different phylogenetic and phenotypic patterns from E. coli strains isolated from patients with cystitis and an abnormal urinary tract (AUT). The results demonstrated that E. coli strains derived from these two groups of patients have distinct genetic and phenotypic profiles.

2. Results

2.1. Phylogenetic and Virulence Gene Profile

Phylogenetic analysis of the strains demonstrated that 57% of the isolates coming from patients with normal urinary tract (NUT) belonged to the phylo-group B2 and 29% to the phylo-group D (Figure 1, Table 1). In contrast, thirty six percent of the strains derived from patients with AUT belonged to the phylogroup E, 18% to the phylo-group C, 14% were B1 and 11% were characterized as F and CLADE I (Figure 1, Table 2). Only 23% of the strains derived from patients with AUT belonged to the phylogroups B2 and D. Strains isolated from the patients whose clinical picture developed to pyelonephritis were classified as B2 or D (Table 3).
All isolates were positive for fimH and fimA. Seventy seven percent of the strains derived from patients with AUT were positive for pap, however, its prevalence decreased to 42% in strains derived from patients with NUT (Figure 2, Table 1 and Table 2). The same was observed for sfa, whose prevalence was 59% in strains derived from patients with AUT but decreased to 21% in strains isolated from patients with NUT (Figure 2, Table 1 and Table 2). The prevalence of hemolysin was 57% in the isolates derived from patients with NUT, and 22% in the strains derived from patients with AUT. The prevalence of cnf-1 and pic genes was low in all groups of patients (Figure 2, Table 1 and Table 2).
The strain O16:H5 (derived from a patient with NUT), OR:H18 (derived from a patient with AUT) and the strain ONT:H31 (derived from a patient with pyelonephritis), carried aaiG and aaiA genes, whereas the strains O16:H6, ONT:H18 and O20:H9 derived from patients with abnormal urinary tract carried aggR genes (Table 1, Table 2 and Table 3).
Three out of four patients with pyelonephritis were positive for the papG gene and hemolysin, whereas two out of four were positive to sfa gene (Table 3).

2.2. Serogroups

Sixty four percent of the isolates derived from patients with NUT belonged to the serogroups O2, O6, O15 and O16, whereas only 32% of the strains derived from patients with AUT belonged to these serogroups (Figure 3, Table 1).
Thirty percent of all isolates were either ONT (O non-typable) or OR (O rough strains). The prevalence of the serogroups 033, O153 and O177, OR and ONT was 35% in the strains derived from patients with NUT, while 64% of the isolates derived from patients with AUT belong to the serogroups O11, O80, O153, O177, ONT and OR (Figure 3).

2.3. Biofilm Formation on Abiotic Surfaces and Cell Adherence

The ability of the isolates derived from patients with NUT to form biofilm on PVC and polysterene was 50% and 35% respectively (Table 1). This ability increased to 90% (PVC) and 86% (polysterene) in strains derived from patients with AUT (Figure 4, Table 2). Eighty two percent of the strains isolated from patients with AUT were able to adhere to Vero cells, this percentage decreased to 43% in strains derived from patients with NUT (Table 2). All the strains isolated from the patients with pyelonephritis were able to form biofilm on polystyrene and PVC and adhere to epithelial cells (Table 3).

2.4. Antimicrobial Profile—Presence of Int I

Antimicrobial analysis of the strains demonstrated that 50% of the isolates derived from patients with NUT were resistant to sulfonamide whereas 16% of theses samples were positive for the presence of int1 (Figure 4, Table 4).
Fifty nine percent of the samples isolated from patients with AUT were resistant to sulfonamide and 45% of these isolates tested were positive for the presence of int1 (Table 5).
The presence of int-1 in the strains was only correlated to sulfonamide resistance in the isolates derived from patients with AUT (Figure 4, Table 5). Twenty percent of all isolates were resistant to amikacin, 15% were resistant to CIP, 10% were resistant to NAL and 27.5% were sensitive to all antibiotics tested (Table 4 and Table 5).
Out of three isolates derived from patients with pyelonephritis were resistant to at least one of the antibiotics tested (Table 6).

3. Discussion

It has been demonstrated that besides ExPEC, pathogenic intestinal E. coli are also able to induce urinary tract intections (11, 12, 18). However, their association with the clinical picture of the patient is still unclear, especially in women, whose distance that separates the rectum from the urethra is very short, what makes them more exposed to infection by pathogenic intestinal microorganisms [18,19,20,21].
Although ExPEC are still responsible for most cases of UTI, the number of UTI caused by pathogenic intestinal E. coli has been increasing, but, the mechanism they use to induce infection in the urinary tract has not been elucidated.
In the present work, however, a correlation between abnormal urinary tract and pathogenic intestinal E. coli was found in female patients with cystitis. For instance, E. coli strains isolated from the urine of patients with abnormal urinary tract (AUT) were associated with the phylo-groups E, C, F and CLAD I which are related to pathogenic intestinal E. coli [4,10,11,12]. In contrast, the E. coli strains isolated from patients with normal urinary tract (NUT) were associated with the phylogroups B2 and D which are related to virulent ExPEC [10].
It was also observed that a higher number of strains able to produce hemolysis were rather isolated from patients with NUT. It is likely that, in the case of patients with NUT, the hemolytic activity of UPEC helped to overcome physical, chemical and immune barriers in the host, which are weakened in patients with abnormal urinary tract. Probably, the hemolytic activity of UPEC, has also helped the isolates to ascend to the kidneys and there develop pyelonephritis, a phenomenon that has been observed in other studies [21].
In addition, E. coli isolated from the urine of patients with NUT were related to serogroups associated with virulent ExPEC such as O2, O6, O15 and O16 [13,14] whereas E. coli isolated from patients with abnormal urinary tract (AUT) were highly adherent strains whose serotypes have been described among emergent diarrheagenic E. coli strains [22,23,24,25,26].
Conversely, studies have shown that UPEC strains can carry genes attributed to diarrheagenic E. coli. This is well illustrated by the work of Abe and co-workers [14] who demonstrated that UPEC strains can encode aggR genes that are characteristic of typical-EAEC (enteroaggregative E. coli). In the present work, UPEC strains presented aaiG, aaiA and aggR genes that are preferentially associated with EAEC.
In short, these data and several other studies suggest that the intestinal microbiota is a place where E. coli strains continuously exchange virulence factors between themselves, and by so doing, potentiates the emergence of intestinal hybrid pathogenic E. coli able to cause urinary tract infection [27,28,29,30].
The probability of intestinal pathogenic E. coli to cause urinary tract infection in patients with AUT is even greater in cases of dysbiosis where a direct link with the gut microbiota and the urethra is made [31]. In addition, the physical disabilities associated with these patients, such as urine retention and the necessity to use catheters make them more vulnerable to isolates able to form biofilm on these devices. The results demonstrated that more than 86% of the samples isolated from patients with AUT were able to produced biofilm on PVC and polystyrene, which are material used to produce catheters [16]. This is a very serious issue, since it has been demonstrated that the relapse of UTI in female patients aged >18 years old is associated with the ability of UPEC strains to form biofilm on these devices [32]. This situation can be aggravated by the fact that most of the strains isolated from patients with AUT were able to adhere to Vero cells, suggesting that they also have the potential to adhere to the kidneys.
This scenario becomes even more critical taking into consideration the fact that several isolates were resistant to sulfonamide, amikacin and nalidixic acid, which are first choice classes of antibiotics to treat cystitis in women and children [33,34,35].
It is worth noting, that in the case of the isolates derived from patients with AUT, the correlation between the presence of integron I and sufonamide resistance is very important in terms of clinical surveillance alert, since integrons are gene cassettes that favors the emergence of antimicrobial resistance in pathogens [36].
Finally, the results obtained with male patients with normal and abnormal urinary tract, were not significantly different from one another (see Supplementary Materials). These results suggest that the proximity of the urethra with the rectum in female pediatric patients with abnormal urinary tract makes them more vulnerable to intestinal uropathogens.

4. Material and Methods

4.1. Uropathogenic Escherichia coli—(UPEC) Strains

Seventy seven E. coli strains were isolated from the urine of female and male pediatric patients admitted to the “Hospital Infantil Darcy Vargas”, São Paulo, Brazil with a clinical profile of urinary tract infection. The age of the female patients ranged from 10 to 16 years old and the age of the male patients ranged from 0 to 4 years old. The study was reviewed and approved by the Ethics Committee of the Hospital Infantil Darcy Vargas (Certificate for Ethical Appreciation, CAAE 0005.0.350.3500-08) according to the 196/96 resolution and complementary resolutions (CONEP/CNS/MS). The strains were first identified by their biochemical profile in modified Rugai medium [37] as part of routine hospital procedures, and their identity subsequently confirmed by use of the API20E test (Biomerieux, France) at two different sites, the Instituto Adolfo Lutz, São Paulo Brazil and the Laboratory of Bacteriology of Instituto Butantan, São Paulo, Brazil.

4.2. Clinical Picture of the Patients

The clinical picture of the patients was classified as either cystitis of normal urinary tract (NUT), cystitis of abnormal urinary tract (AUT) or pyelonephritis. Patients with NUT were considered those with normal physiological and anatomical urinary tracts with infection of the lower urinary tract (bladder). Patients with AUT were considered those with either neurogenic bladder or any type of mal-formation or dysfunction of the urinary tract with infection of the lower urinary tract (bladder). Patients with pyelonephritis were considered those whose clinical picture had developed to kidney infection.

4.3. Serotyping

The identification of somatic (O) and flagellar (H) antigens was performed by standard agglutination techniques, using specific antisera against O1 to O181 serogroups and against H1 to H56 [38]. The antisera utilized in this study were prepared in the Instituto Adolfo Lutz (São Paulo, Brazil) using reference E. coli strains. Cross reacting antisera were absorbed to prevent nonspecific agglutination.

4.4. Determination of E. coli Phylogenetic Groups

The phylogenetic groups of the E. coli isolates were determined by a PCR-based technique using a combination of four DNA gene markers chuA, yjaA, arpA and the DNA fragment tspE4.C2 [10]. After amplification, the gene markers were analyzed by electrophoresis on agarose gel (0.7%) and visualized as DNA bands of 279, 211, 400 and 152-bp respectively. The phylogroups were determined based on the presence or absence of bands according to the criteria defined by Clermont et al., (2013) [10]. Accordingly, the isolates were classified as belonging to the phylogenetic groups A, B1, B2, C, D, E, F or CLADE-I. A 100 bp ladder was used as DNA molecular size pattern.

4.5. PCR Amplification of Virulence Genes

Genomic DNA was extracted from each E. coli isolate using DNA extraction and purification kits (Qiagen–DNA mini kit) from Qiagen Inc., California, CA, USA. Reactions were performed using the GeneAmp® PCR System 9700 (Applied Biosystems, Foster City, CA, USA). The genes pic, hly, fimA, fimH, pap, sfa, cnf1 and int1 were PCR amplified using the primers and the conditions described in Table 7. The amplified markers were analyzed by electrophoresis on 0.8% agarose gel (GE Healthcare, Trasadingen, Switzerland) and visualized as amplicons of 1175, 596, 161, 508, 328, 410, 498 and 483 respectively.
The genes pic, hly, fimA, fimH, pap, sfa, cnf1 and int1 are responsible for coding of the following factors Pic, Hemolysin A, type I fimbria (adherence site), type 1 fimbria (conservative site), Pap, S fimbria, CNF-1 virulence factor and Integrase I.
The presence of aggR, aaiG, aatA and aaiA genes was determined as described by Andrade et al. (2014) [39].

4.6. Antimicrobial Resistance Profile

The antimicrobial susceptibility of the E. coli isolates was determined by the standard disk diffusion method [46], utilizing commercially available sensitivity discs and Mueller-Hinton Agar. The results were evaluated according to the CCLS-M100-S27, 2017 guidelines [47].
The following antibiotics were tested: amikacin (AMI), amoxicillin/clavulanic acid (AMC), ceftazidime (CAZ), ciprofloxacin (CIP), trimethoprim/sulfamethoxazole (SUT), aztreonam (ATM), imipenem (IPM), cefepima (CPM), cefotaxime (CTX), meropenem (MER), fosfomicin (FOS), gentamicin (GEN), nalidixic acid (NAL), ertapenem (ERT). For quality control the test was run against the following ATCC strains: Escherichia coli 25922 and Pseudomonas aeruginosa 27853.

4.7. Bacterial Adhesion to Epithelial Cells

The bacterial adhesion test was performed utilizing Vero cell line (cell line derived from the epithelial cells of the kidney of green monkey). The cell line was obtained from the Instituto Adolfo Lutz, São Paulo, Brazil, which was previously acquired from the American Type Culture Collection (CCL 2). For maintenance, the cells were grown in Dulbecco’s Modified Eagle Mediem (DMEM) supplemented with 10% calf serum, 1 mM L-glutamine, and 50 IU/mL penicillin-streptomycin. Briefly, the cells were grown in DMEM to 70% confluence on circular glass coverslips in 24-well tissue culture plates. Subsequently, 40 µL of E. coli culture (105/mL) previously grown in Tryptic Soy Broth (TSB) for 18 h at 37 °C were added to the plates and incubated for 3 h. After incubation, the monolayers were washed six times with sterile PBS and then fixed with 100% methanol for 10 min, stained for 5 min with May-Grunwald stain (Merck) diluted 1:2 in Sorensen buffer, and finally stained for 20 min with Giemsa stain (Merck) diluted 1:3 in Sorensen buffer. The excess stain was discarded, and the coverslips with the stained cells were affixed to microscope slides for visualization by light microscopy (eyepiece, ×10; objective, ×100). This experiment was repeated twice with similar results.

4.8. Biofilm Formation on Abiotic Surfaces

The methodology utilized to determine the ability of the E. coli isolates to produce biofilm on abiotic surfaces was an adaptation of the methodology described by Sheikh et al. (2001) [48]. The experiment was performed in plates of polystyrene and PVC plates (Corning®, New York, NY, USA). Briefly, 190 µL of tryptic soy broth (TSB) were dispensed into each well of the plates and 10 µL of E. coli culture previously grown in LB (Luria Bertani) broth for 18 h at 37 °C were added in triplicate to the wells. After 24 h incubation, the plates were washed four times with PBS and the bacteria adhering to the plates were then fixed with 200 µL of 75% ethanol for 10 min. After incubation with ethanol, the plates were washed three times with PBS and the bacteria were stained with 0.5% crystal violet (CV) for 5 min, washed with PBS and then air-dried. The CV incorporated in the bacterial cells was solubilized by the addition of 95% ethanol (200 µL/well). After 2 min incubation at room temperature, 150 µL of the supernatant from each well were transferred to a microtiter plate and the extent of biofilm formation was determined by measuring the optical density at 595 nm in a Multiskan Ex type 355 (LabSystems, Vantaa, Finland). The UPEC prototype strain J96 was used as a positive control for biofilm formation. The strains were considered biofilm producers, when the absorbance was higher than 0.5. This experiment was repeated twice with similar results.

4.9. Identification of Hemolysin-Producing E. coli Strains

Blood-agar culture plates were prepared according to Beutin (1991) [49]. Briefly, 1.5 g of TSA (Tryptic Soy Agar) re-suspended in a 10 mM solution of CaCl2 was autoclaved. When the temperature of the agar fell to 45 °C, sheep red cells previously washed three times in PBS pH 7.2 were then added to the agar to give a final concentration of 5%. The agar was added to Petri dish plates (20 mL per plate), left to solidify and kept at 4 °C until use.
Subsequently, forty microliters of bacterial culture previously grown in TSB for 18 h at 37 °C were added to 3 mL of TSB and incubated overnight at 37 °C. After incubation, 100 µL of each bacterial culture were added in triplicate to the blood agar plates in aliquots of 10 µL each. The plates were then incubated for 18 h at 37 °C and the presence of hemolysin was determined by the formation of a halo of lysed erythrocytes around the bacterial growth. This experiment was repeated twice with similar results.

4.10. Statistic Analysis

Statistical analysis of the results (Figure 1, Figure 2, Figure 3 and Figure 4) was performed applying the unpaired two-tailed Student t test using Excel program software. The group of strains isolated from the urine of teenage female patients with cystitis and normal urinary tract (NUT) was used as a control. Results with p values lower than 0.05 (<0.05) were considered significant.

5. Conclusions

In summary, the results obtained in this study suggest that the acquisition of fimbrial adhesin genes, along with the capacity to adhere to epithelial cells, produce biofilm and resist to antibiotic therapy, allowed different intestinal pathogenic E. coli to successfully cause cystitis in teenage female patients with abnormal urinary tract. Conversely, the development of cystitis in female patients with normal urinary tract is induced mainly by classic extra intestinal virulent UPEC strains that have the potential to overcome the functional barriers imposed by their urinary system.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pathogens11020231/s1. Table S1: Serotype, phylogroup and virulence profile of E. coli strains derived from male patients with NUT. Table S2: Serotypes, phylogroup and virulence profile of E. coli strains derived from male patients with AUT. Table S3: Serotypes, phylogroup and virulence profile of E. coli strains derived from male patients with Pyelonepritis. Table S4: Antibiotic resistance profile of E. coli strains derived from male patients with NUT. Table S5: Antibiotic resistance profile of E. coli strains derived from male patients with AUT. Table S6: Serotypes, phylogroup and virulence profile of E. coli strains derived from male patients with Pyelonepritis.

Author Contributions

M.d.O.D. and R.M.F.P. were responsible for the conceptualization, organization, coordination, supervision, formal analysis, writing and editing the manuscript, S.M.d.S.J. was responsible for the isolation, identification, selection of the samples determination of biofilm formation and bacterial adherence to epithelial cells, M.R.F. was responsible for the antimicrobial analysis of the samples and biofilm determination, W.M. (in memoriam) and S.S.N.N. were responsible for the isolation of the uropathogenic E. coli strains from the urine of the patients and the first identification of the pathogens. L.F.d.S. was responsible for serotyping the isolates, K.O.N. and V.D.M. were responsible for the phylogenetic profile of the samples, W.P.E. was responsible for the detection of the aggregative genes and the review of the manuscript, H.G.d.S.S. and B.D.L.C. were responsible for the detection of the virulence genes. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by Fundação Butantan and FAPESP (2011/12928-2) R.M.F.P.

Institutional Review Board Statement

The study was reviewed and approved by the Ethics Committee of the Hospital Infantil Darcy Vargas (Certificate for Ethical Appreciation, CAAE 0005.0.350.3500-08).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The data are not available in the repository of the Butantan Institute (https://repositorio.butantan.gov.br (accessed on 23 December 2021).

Acknowledgments

We wish to thank Roger Randal Charles New for helping with the revision of the manuscript. We thank Wagner Milanello (in memoriam) for helping with the project planning steps and the identification and selection of the clinical samples in the Hospital Infantil Darcy Vargas. We wish to thank Marta Mariana Teixeira da Siva, Sergio Antonio Bantos Sarrubbo and Wanderley Tadey Sokolowsky for their help with the medical diagnosis of the patients and the regulatory procedures necessary to carry out this study. We Thank Tania Vaz for helping us with the determination of E. coli serotypes.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Reu, C.E.; Volanski, W.; Prediger, K.C.; Picheth, G.; Fade-Picheth, C.M.T. Epidemiology of pathogens causing urinary tract infections in an urban community in southern Brazil. Braz. J. Infect. Dis. 2018, 22, 505–507. [Google Scholar] [CrossRef] [PubMed]
  2. Foxman, B. Epidemiology Urinary Tract Infections: Incidence, morbidity and economic costs. Am. J. Med. 2002, 113, 5S–13S. [Google Scholar] [CrossRef]
  3. Heilberg, I.P.; Schor, N. Abordagem Diagnóstica e Terapêutica na Infecção do Trato Urinário–ITU. Rev. Assoc. Med. Bras. 2001, 49, 109–116. [Google Scholar] [CrossRef] [Green Version]
  4. Behzadi, P. Chapter 5: Uropathogenic Escherichia coli and fimbrial adhesins virulome. In Urinary Tract Infection: The Result of the Strength of the Pathogen, or the Weakness of the Host; IntechOpen: Rijeka, Croatia, 2017; pp. 66–83. [Google Scholar] [CrossRef]
  5. Mulvey, M.A. Adhesion and entry of uropathogenic Escherichia coli. Cell. Microbiol. 2002, 4, 257–271. [Google Scholar] [CrossRef]
  6. Wullt, B.; Bergsten, G.; Samuelsson, M.; Gebretsadik, N.; Hull, R. The Role of P Fimbriae for Colonization and Host Response Induction in the Human Urinary Tract. J. Infect. Dis. 2001, 183, S43–S46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Terlizzi, M.E.; Grilaudo, G.; Mafei, M. Uropathogenic Escherichia coli (UPEC) infections: Virulence factors, bladders responses, antibiotic, and non-antibiotic antimicrobial strategies. Front. Microbiol. 2017, 8, 1566. [Google Scholar] [CrossRef]
  8. Karam, M.R.A.; Habidi, M.; Bouzari, S. Urinary tract infection: Pathogenicity, antibiotic resistance and development of effective vacines against uropathogenic Escherichia coli. Mol. Immunol. 2019, 108, 56–67. [Google Scholar] [CrossRef]
  9. Johnson, J.R.; Stell, A.L. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis relation to phylogeny and host compromise. Infect. Dis. 2000, 181, 261–271. [Google Scholar] [CrossRef] [Green Version]
  10. Clermont, O.; Cristenson, J.K.; Denamur, E.; Gordon, D.M. The Clermont Escherichia coli phy-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef]
  11. Abdallah, K.S.; Wei, D.J. Epidemiologic Investigation of extra-intestinal pathogenic E. coli (EXpec) based on PCR phylogenetic group an fim H. sigle nucleotide polymorphisms. Int. J. Mol. Epidemiol. Genet. 2011, 2, 339–353. [Google Scholar]
  12. Chrakraborty, A.; Saralaya, V.; Adhikari, P.; Shenoy, S.; Baliga, S.; Hegde, A. Characterization of Escherichia coli phylogenetic groups associated with extraintestinal infections in South Indian population. Ann. Med. Health Sci. Res. 2015, 5, 241–246. [Google Scholar] [CrossRef]
  13. Sharma, S.; Kaaur, N.; Malhota, S.; Madan, P.; Ahmad, W.; Hans, C. Serotyping and antimicrobial susceptibility pattern of Escherichia coli isolates from urinary tract infections in pediatric population in a tertiary care hospital. J. Pathog. 2016, 2016, 2548517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Abe, C.M.; Salvador, F.A.; Falsetti, I.N.; Vieira, M.A.M.; Blanco, J.; Blanco, J.E.; Blanco, M.; Machado, A.M.O.; Elias, W.P.; Hernandes, R.T.; et al. Uropathogenic Escherichia coli (UPEC) strains may carry virulence properties of diarrhoeagenic. FEMS Immunol. Med. Microbiol. 2008, 52, 397–406. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Sandulescu, S.M.; Vicol, R.M.; Serban, A.; Carp, A.V.; Vaduva, C. Chapter 14: Congenital anomalies of urinary tract and anomalies of fetal genitalia. In Congenital Anomalies: From the Embryo to the Neonate; IntechOpen: Rijeka, Croatia, 2018; pp. 287–307. [Google Scholar] [CrossRef] [Green Version]
  16. Treter, J.; Macedo, A.J. Catheters: A suitable surface for biofilm formation. In Science against Microbial Pathogens: Communicating Current Research and Technological Advances; Mendez-Vilas, A., Ed.; FORMATEX: Badajoz, Spain, 2011; pp. 835–841. [Google Scholar]
  17. Clark, C.J.; Kennedy, W.A.; Shortliffe, L.D. Urinary Tract Infection in children: When to worry. Urol. Clin. N. Am. 2010, 37, 229–241. [Google Scholar] [CrossRef]
  18. Ahumada-Santos, Y.P.; Baez-Flores, M.E.; Diaz-Camacho, S.P.; Uribe-Beltran, M.J.; Eslava-Campos, C.A.; Parra-Unda, J.R.; Delgado-Vargas, F. Association of phylogenetic distribution and presence of integrons with multidrug resistance in Escherichia coli clinical isolates from children with diarrhea. J. Infect. Public Health 2020, 13, 767–772. [Google Scholar] [CrossRef]
  19. Yamamoto, S.; Tsukamoto, T.; Terai, A.; Kurazono, H.; Takeda, Y.; Yoshida, O. Genetic evidence supporting the fecal-perineal-urethral hypothesis in cystitis caused by Escherichia coli. J. Urol. 1997, 157, 1127–1129. [Google Scholar] [CrossRef]
  20. Magruder, M.; Sholi, A.N.; Gong, C.; Zhang, L.; Edusei, E.; Huang, J.; Albakry, S.; Satlin, M.J.; Westblade, L.F.; Crawfor, C.; et al. Gut uropathogen abundance is a risk factor for development of bacteriuria and urinary tract infection. Nat. Commun. 2019, 10, 5521. [Google Scholar] [CrossRef]
  21. Ristow, L.C.; Welch, R.A. Hemolysin of uropathogenic Escherichia coli: A cloak or a dagger? Biochim. Et Biophys. Acta 2016, 1858, 538–545. [Google Scholar] [CrossRef]
  22. Bielaszewska, M.; Friedrich, A.W.; Aldick, T.; Schurk-Bulgrin, R.; Karch, H. Shiga toxin activatable by intestinal mucus in Escherichia coli isolated from Humans: Predictor for a severe clinical outcome. Clin. Infect. Dis. 2006, 43, 1160–1167. [Google Scholar] [CrossRef] [Green Version]
  23. Guerra, J.A.; Romero-Herazo, Y.C.; Arzuza, O.; Gomez-Duarte, O.G. Phenotypic and genotypic characterization of enterotoxigenic Escherichia coli clinical isolates from Northern Colombia, South America. BioMed Res. Int. 2014, 2014, 236260. [Google Scholar] [CrossRef] [Green Version]
  24. Ori, E.L.; Takagi, E.H.; Andrade, T.S.; Miguel, M.T.; Cergole-Novella, M.C.; Guth, B.E.C.; Hernandes, R.T.; Dias, R.C.B.; Pineiro, S.R.S.; Camargo, C.H.; et al. Diarrhoeagenic Escherichia coli and Escherichia albertii in Brazil: Pathotypes and serotypes over a 6-year period of surveillance. Epidemiol. Infect. 2019, 147, E10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Diaz-Jimenez, D.; Garcia-Menino, I.; Herrera, A.; Garcia, V.; López-Beceiro, A.M.; Alonso, M.P.; Blanco, J.; Mora, A. Genomic characterization of Escherichia coli isolates belonging to a new hybrid a EPEC/ExPEC pathotype O153:H10-A-ST10 eae-beta 1 ocurred in meat, poultry, wildlife and human diarrheagenic samples. Antibiotics 2020, 9, 192. [Google Scholar] [CrossRef] [PubMed]
  26. Cointe, A.; Birgy, A.; Mariani-Kurkdjan, P.M.; Liguori, S.; Courroux, C.; Blanco, J.; Delanney, S.; Fach, P.; Loukiadis, E.; Bidet, P.; et al. Emerging Multidrug-Resistant hybrid pathotype shiga toxin-producing Escherichia coli O80 and related cloncal complex. Emerg. Infect. Dis. 2018, 12, 2262–2269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Gati, N.S.; Middendorf-Bauchart, B.; Bletz, S.; Dobrindt, U.; Melllman, A. Origin and evolution of hybrid shiga toxin-producing and uropathogenic Escherichia coli strains of sequence type 141. J. Clin. Microbiol. 2020, 58, e01309-19. [Google Scholar] [CrossRef] [PubMed]
  28. Lara, F.B.M.; Nery, D.R.; Oliveira, P.M.; Araujo, M.L.; Carvalho, F.R.Q.; Messias-Silva, L.C.F.; Ferreira, L.B.; Faria-Junior, C.; Pereira, A.L. Virulence markers and phylogenetic analysis of Escherichia coli strains with hybrid EAEC/UPEC genotypes recovered from sporadic cases of estraintestinal infections. Fraontiers Microbiol. 2017, 8, 146. [Google Scholar] [CrossRef] [Green Version]
  29. Santos, A.C.M.; Santos, F.F.; Silva, R.M.; Gomes, T.A.T. Diversity of Hybrid- and Hetero-Pathogenic Escherichia coli and Their Potential Implication in More Severe Diseases. Front. Cell. Infect. Microbiol. 2020, 10, 339. [Google Scholar] [CrossRef] [PubMed]
  30. Valiatt, T.N.; Santos, F.F.; Santos, A.C.M.; Nascimento, J.A.S.; Silva, R.M.; Carvalho, E.; Sinigaglia, R.; Gomes, T.A.T. Genetic and Virulence characteristics of hybrid atypical enteropathogenic and uropathogenic Escherichia coli (aEPEC/UPEC) strain. Front. Cell. Infect. Microbiol. 2020, 10, 492. [Google Scholar] [CrossRef]
  31. Mestrovic, T.; Matijasic, M.; Peric, M.; Paljetak, H.C.; Baresic, A. 2021. The role of gut, vaginal and urinary microbiome in urinary tract infections: From bench to bedside. Diagnostics 2021, 11, 7. [Google Scholar] [CrossRef]
  32. Soto, S.M.; Smithson, A.; Horcajada, J.P.; Martinez, J.A.; Mensa, J.P.; Vila, J. Implication of biofilm formation in the persistance of urinary tract infection caused by uropathogenic Escherichia coli. Clin. Microbiol. Infect. 2006, 12, 1021–1045. [Google Scholar] [CrossRef] [Green Version]
  33. Wu, T.H.; Huang, F.L.; Fu, L.; Chou, C.M.; Chien, Y.L.; Huang, C.M.; Lin, C.F.; Chen, P.Y. Treatment of recurrent complicated urinary tract infections in children with vesicoureteral reflux. J. Microbiol. Immunol. Infect. 2016, 5, 717–722. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Duicu, C.; Armean, I.; Aldea, C. New insights in treatment options in pediatric urinary tract infection. Acta Med. Marisiensis 2019, 65, 7–11. [Google Scholar] [CrossRef] [Green Version]
  35. Brusch, J.L.; Bronze, M.S. Urinary tarct infection (UTI) and cystitis (bladder infection) in females. Child. Urin. Tract Infect. 2020, 32, 1–5. [Google Scholar] [CrossRef]
  36. Najafi, M.; Omidvar-Panah, M.; Nikkhahi, F.; Paymani, A. Epidemiology of integrons among multigrug-resistant pathogens: An Asian update. Rev. Res. Med. Microbiol. 2021, 33, e33–e39. [Google Scholar] [CrossRef]
  37. Silva, P.; Carneiro, A.M.M.; Carloni, M.C.; Cazentini, M.I.; Medeiros, M.I.C.; Silva, J.O.; Reche, S.H.C.; Errera, M.C.; Neme, S.N. Isolation, characterization and antimicrobial resistance of Gram-negative aerobic and facultative anaerobic bacteria from soil samples. Rev. Inst. Adolfo Lutz 2005, 64, 245–251. [Google Scholar]
  38. Ewing, W.H. Edwards and Ewing’s Identification of Enterobacteriaceae; Elsevier: New York, NY, USA, 1986. [Google Scholar]
  39. Andrade, F.B.; Gomes, T.A.T.; Elias, W.P. A sensitive and specific molecular tool for detection of both typical and atypical enteroaggregative Escherichia coli. J. Microbiolocal Methods 2014, 106, 16–18. [Google Scholar] [CrossRef]
  40. Nowrouzian, F.L.; Monstein, H.J.; Wold, A.E.; Adlerberth, I. Effect of human milk on type 1 and P-fimbrial mRNA expression in intestinal Escherichia coli strains. Lett. Appl. Microbiol. 2005, 40, 74–80. [Google Scholar] [CrossRef]
  41. Yun, K.W.; Kim, H.Y.; Park, H.K.; Kim, W.; Lim, I.S. Virulence factors of uropathogenic Escherichia coli of urinary tract infections and asymptomatic bacteriuria in children. J. Mecrobiol Immunol Infect. 2014, 47, 455–461. [Google Scholar] [CrossRef] [Green Version]
  42. Le Bouguénec, C.; Archambaud, M.; Labigne, A. Rapid and specific detection of the pap, afa, and sfa adhesin-encoding operons in uropathogenic Escherichia coli strains by polymerase chain reaction. J. Clin. Microbiol. 1992, 30, 1189–1193. [Google Scholar] [CrossRef] [Green Version]
  43. Yamamoto, S.; Terai, A.; Yuri, K.; Kurazono, H.; Takeda, Y.; Yoshida, O. Detection of urovirulence factors in Escherichia coli by multiplex polymerase chain reaction. FEMS Immun. Med. Microbiol. 1995, 12, 85–90. [Google Scholar] [CrossRef]
  44. Mazel, D.; Dychinco, B.; Webb, V.A.; Davies, J. Antibiotic resistance in the ECOR collection: Integrons and identification of a novel aad gene. Antimicrob. Agents Chemother. 2000, 44, 1568–1574. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Henderson, I.R.; Czeczulin, J.; Eslava, C.; Noriega, F.; Nataro, J.P. Characterization of pic, a secreted protease of Shigella flexneri and enteroaggregative Escherichia coli. Infect. Immun. 1999, 67, 5587–5596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Bauer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. Antibiotic Susceptibility Testing by a Standardized Single Disk Method. Am. J. Clin. Pathol. 1965, 45, 493–496. [Google Scholar] [CrossRef]
  47. Clsi-Clinical And Laboratory Standards Institute. M100-S27: Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; Anvisa: Wayne, MI, USA, 2017. [Google Scholar]
  48. Sheikh, J.; Hicks, S.; Agnol, M.D.; Phillips, A.D.; Nataro, J.P. Roles for Fis and YafK in biofilm formation by enteroaggregative Escherichia coli. Mol. Microbiol. 2001, 5, 983–997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Beutin, L. The different hemolysins of Escherichia coli. Med. Microbiol. Immunol. 1991, 180, 167–182. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Distribution of phylogenetic groups among E. coli strains. The phylogenetic profile of E. coli strains isolated from the urine of teenage female patients with either normal or abnormal urinary tract was determined. NUT = Patients with normal urinary tract. AUT = Patients with abnormal urinary tract. ** Statistically significant (p ≤ 0.05) difference between experimental and control (strains isolated from patients with normal urinary tract) groups.
Figure 1. Distribution of phylogenetic groups among E. coli strains. The phylogenetic profile of E. coli strains isolated from the urine of teenage female patients with either normal or abnormal urinary tract was determined. NUT = Patients with normal urinary tract. AUT = Patients with abnormal urinary tract. ** Statistically significant (p ≤ 0.05) difference between experimental and control (strains isolated from patients with normal urinary tract) groups.
Pathogens 11 00231 g001
Figure 2. Distribution of virulence factors among E. coli strains. The presence of the virulence genes fimA, fimH, pap, sfa, hly, cnf1, pic, and were determined by PCR technique in E. coli strains isolated from the urine of teenage female patients with either normal or abnormal urinary tract. The ability of these strains to produce hemolysin was determined by the formation of a halo of lysed erythrocytes around the bacterial growth. NUT = Patients with normal urinary tract. AUT = Patients with abnormal urinary tract. Hem = hemolysin production. * Statistically significant (p ≤ 0.05) difference between experimental and control (strains isolated from patients with normal urinary tract) groups.
Figure 2. Distribution of virulence factors among E. coli strains. The presence of the virulence genes fimA, fimH, pap, sfa, hly, cnf1, pic, and were determined by PCR technique in E. coli strains isolated from the urine of teenage female patients with either normal or abnormal urinary tract. The ability of these strains to produce hemolysin was determined by the formation of a halo of lysed erythrocytes around the bacterial growth. NUT = Patients with normal urinary tract. AUT = Patients with abnormal urinary tract. Hem = hemolysin production. * Statistically significant (p ≤ 0.05) difference between experimental and control (strains isolated from patients with normal urinary tract) groups.
Pathogens 11 00231 g002
Figure 3. Serogroup determination of the E. coli strains. The serogroups of E. coli strains isolated from the urine of teenage female patients with either normal or abnormal urinary tract were determined. NUT = Patients with normal urinary tract. AUT = Patients with abnormal urinary tract. * Statistically significant (p ≤ 0.05) difference between experimental and control (strains isolated from patients with normal urinary tract) groups.
Figure 3. Serogroup determination of the E. coli strains. The serogroups of E. coli strains isolated from the urine of teenage female patients with either normal or abnormal urinary tract were determined. NUT = Patients with normal urinary tract. AUT = Patients with abnormal urinary tract. * Statistically significant (p ≤ 0.05) difference between experimental and control (strains isolated from patients with normal urinary tract) groups.
Pathogens 11 00231 g003
Figure 4. Determination of sulfonamide resistance and the presence of int1 in E. coli strains. The resistance to sulfonamide and the presence of int1 gene were determined in E. coli strains isolated from the urine of teenage female patients with either normal or abnormal urinary tract. NUT = Patients with normal urinary tract. AUT = Patients with abnormal urinary tract. SUL = sulfonamide. * Statistically significant (p ≤ 0.05) difference in the same experimental group (strains isolated from patients with normal urinary tract).
Figure 4. Determination of sulfonamide resistance and the presence of int1 in E. coli strains. The resistance to sulfonamide and the presence of int1 gene were determined in E. coli strains isolated from the urine of teenage female patients with either normal or abnormal urinary tract. NUT = Patients with normal urinary tract. AUT = Patients with abnormal urinary tract. SUL = sulfonamide. * Statistically significant (p ≤ 0.05) difference in the same experimental group (strains isolated from patients with normal urinary tract).
Pathogens 11 00231 g004
Table 1. Serotype, phylogroup and virulence profile of E. coli strains derived from female patients with NUT.
Table 1. Serotype, phylogroup and virulence profile of E. coli strains derived from female patients with NUT.
Female Patients with NUT
SerotypePhylo-GroupEAEC GenesVirulence Factors
fimAfimHpapsfacnf1pichlyHemBiofilmAdhesion
PLTPVC
1O33H:28B1 ++---+++---
2O2:H4D +++---++++-
3O177:H21B1 ++------+-+
4O6:H1B2 +++++--+++-
5O2:H6B2 ++-++-+++-+
6O16:H5B2 ++--nd--+--+
7O2:H-B2 +++-++++---
8ONT:HNTB2 ++++nd--+---
9O6:H-B2 ++-----+++-
10O16:H6B2 +++--------
11O16:H5B2aaiG, aaiA+++-----+++
12O153:H2D ++------++-
13O15:H1D ++---+----+
14OR:H2D ++--nd-----+
O:H (serotype); fimA (operon encoding for type 1 fimbriae—adhesion site); fimH (operon encoding for type 1 fimbriae, constitutive part); pap (operon encoding for pili associated with pyelonephritis—P fimbriae), sfa (S fimbria); cnf1 (operon encoding for cytotoxic necrotizing factor type I—CNF-1); pic (factor PIC); hly (operon encoding for hemolysin), Hem (hemolysin), biofilm production in polystyrene (PLT), polyvinyl chloride (PVC), adherent (+), not adherent (-), not done (nd). NUT: normal urinary tract.
Table 2. Serotypes, phylogroup and virulence profile of E. coli strains derived from female patients with AUT.
Table 2. Serotypes, phylogroup and virulence profile of E. coli strains derived from female patients with AUT.
Female Patients with AUT
SerotypePhylo-GroupEAEC GenesVirulence Factors
fimAfimHpapsfacnf1pichlyHemBiofilmAdhesion
PLTPVC
1ONT:HNTC ++++nd---+++
2ONT:H18EaggR++-+----+++
3O20:H9CLADE IaggR++-+----+++
4O80:H26C +++-----+++
5O177:H21B1 +++- --++++
6O2:H6B2 ++++nd-+++++
7O2:H1B2 ++++nd++-+-+
8O6:H-E +++++--+---
9O16:H6EaggR+++++---+++
10O6:H31B2 ++++nd-++---
11O16:H5E ++++----+++
12ONH:H-C +++-nd+--+++
13O2:H1C +++-+---++-
14ONT:HNTE ++-+----+++
15O11:H18E ++------+++
16OR:H18EaaiG, aaiA++++----+++
17O86:H18D ++++nd---++-
18OR:H18D ++++nd--+++
19O153:H10F +++-----+++
20O153:H18E +++-----+++
21ONT:H18B1 +++-----+++
22ONT:H18B1 ++--nd---+++
O:H (serotype); fimA (operon encoding for type I fimbriae—adhesion site); fimH (operon encoding for type 1 fimbriae, constitutive part); pap (operon encoding for pili associated with pyelonephritis—P fimbriae), sfa (S fimbria); cnf1 (operon encoding for cytotoxic necrotizing factor type I—CNF-1); pic (factor Pic); hly (operon encoding for hemolysin), Hem (hemolysin), biofilm production in polystyrene (PLT) or in polyninyl chloride (PVC), adherent (+), not adherent (-), not done (nd). AUT: abnormal urinary tract.
Table 3. Serotype, phylogroup and virulence profile of E. coli strains derived from female patients with pyelonephritis.
Table 3. Serotype, phylogroup and virulence profile of E. coli strains derived from female patients with pyelonephritis.
Female Patients with Pyelonephritis
SerotypePhylo-GroupEAEC GenesVirulence Factors
fimAfimHpapsfacnf1pichlyHemBiofilmAdhesion
PLTPVC
1ONT:H31B2aaiG, aaiA++++--++++-
2OR:H18D +++-nd-+++++
3O6:H-B2 ++++--++++-
4O80:H26B2 +++-----+++
O:H (serotype); fimA (operon encoding for type I fimbriae—adhesion site); fimH (operon encoding for type 1 fimbriae, constitutive part); pap (operon encoding for pili associated with pyelonephritis—P fimbriae), sfa (S fimbria); cnf1 (operon encoding for cytotoxic necrotizing factor type I—CNF-1); pic (factor Pic); hly (operon encoding for hemolysin), Hem (hemolysin), biofilm production in polystyrene (PLT) or in polyninyl chloride (PVC), adherent (+), not adherent (-), not done (nd).
Table 4. Antibiotic resistance profile of E. coli strains derived from female patients with NUT.
Table 4. Antibiotic resistance profile of E. coli strains derived from female patients with NUT.
Antibiotic Resistance-Female Patients with NUT
Serotypeint1SUTATMCAZCIPIPMAMCCTXCPMMERFOSGENAMINALERTTotal Antibiotic Resistance
1O33H:28-RSSSSSSSSSSSSSSUT
2O2:H4+RSSSSSSSSSSSSSSUT
3O177:H21+SSSRSSSSSSSSRSCIP, NAL
4O6:H1-RSSSSSSSSSSSSSSUT
5O2:H6-SSSSSSSSSSSSSSS
6O16:H5-RSSSSRSSSSSSSSSUT, AMC
7O2:H--RSSSSSSSSSSSSSSUT
8ONT:HNTndRSSRSndSSSndRSndndSUT, CIP, GEN
9O6:H--SSSSSSSSSSSSSSS
10O16:H6-RSSSSSSSSSSSSSSUT
11O16:H5-SSSSSSSSSSSSSSS
12O153:H2-SSSSSSSSSSSSSSS
13O15:H1-SSSSSndSSSndSSndndS
14OR:H2ndSRRRSndSRSndRRndndATM, CAZ, CIP, CPM, GEN, AMIC
The following antibiotics were tested: trimethoprim/sulfamethoxazole (SUT), aztreonam (ATM), ceftazidime (CAZ), ciprofloxacin (CIP), imipenem (IPM), amoxicillin/clavulanic acid (AMC), cefotaxime (CTX), cefepime (CPM), meropenem (MER), fosfomicin (FOS), gentamicin (GEN), amikacin (AMI), nalidixic acid (NAL), ertapenem (ERT), not done (nd), resistant (R), sensitive (S). int1 (operon encoding for integrase 1). For quality control the test was run against the following ATCC strains: Escherichia coli 25922 and Pseudomonas aeruginosa 27853. NUT: Patients with normal urinary tract.
Table 5. Antibiotic resistance profile of E. coli strains derived from patients with AUT.
Table 5. Antibiotic resistance profile of E. coli strains derived from patients with AUT.
Antibiotic Resistance–Female Patients with AUT
Serotypeint1SUTATMCAZCIPIPMAMCCTXCPMMERFOSGENAMINALERTTotal Antibiotic Resistance
1ONT:HNT-SSSSSSSSSSSSSSS
2ONT:H18+RSSSSSSSSSSSSSSUT
3O20:H9+RSSRSSSSSSSSRSSUT, CIP, NAL
4O80:H26-RSSSSSSSSSSSSSSUT
5O177:H21-SSSSSSSSSSSSRSNAL
6O2:H6ndSRRRRndSRSndRRndndATM, CAZ, CIP, IPM, CPM, GEN, AMI
7O2:H1ndRSSSSndSSSndSSndndSUT
8O6:H--SSSSSSSSSSSSSSS
9O16:H6+RSSSSSSSSSSSSSSUT
10O6:H31ndSRRRSndSSSndSSndndATM, CAZ, CIP
11O16:H5+RSSSSSSSSSSSSSSUT
12ONH:H-ndSSSSSndSSSndSRndndS
13O2:H1-RSSSSSSSSSSSSSSUT
14ONT:HNT-SSSSSSSSSSSSSSS
15O11:H18+RSSSSRSSSSSSSSSUT, AMC
16OR:H18+RSSSSRSSSSSSSSSUT, AMC
17O86:H18ndSSSSSndSSSndSSndndS
18OR:H18ndRSSSRndRSRndSRndndSUT, IPM, CTX, MER, AMI
19O153:H10-RSSSSRSSSSSSSSSUT
20O153:H18-RSSSSSSSSSSSSSSUT
21ONT:H18+RSSSSSSSSSSSRSSUT, NAL
22ONT:H18ndSSSSSndSSSndSSndndS
The following antibiotics were tested: trimethoprim/sulfamethoxazole (SUT), aztreonam (ATM), ceftazidime (CAZ), ciprofloxacin (CIP), imipenem (IPM), amoxicillin/clavulanic acid (AMC), cefotaxime (CTX), cefepime (CPM), meropenem (MER), fosfomicin (FOS), gentamicin (GEN), amikacin (AMI), nalidixic acid (NAL), ertapenem (ERT), not done (nd), resistant (R), sensitive (S). int1 (operon encoding for integrase 1). For quality control the test was run against the following ATCC strains: Escherichia coli 25922 and Pseudomonas aeruginosa 27853. AUT: Patients with abnormal urinary tract.
Table 6. Antibiotic resistance profile of E. coli strains derived from female patients with pyelonephritis.
Table 6. Antibiotic resistance profile of E. coli strains derived from female patients with pyelonephritis.
Antibiotic Resistance–Female Patients with Pyelonephritis
Serotypeint1SUTATMCAZCIPIPMAMCCTXCPMMERFOSGENAMINALERTTotal Antibiotic Resistance
1ONT:H31+RSSSSRSSSSSSSSSUT, AMC
2OR:H18ndRSSSRndRSRndSRndndSUT, IPM, CTX, MER, AMI
3O6:H--SSSSSSSSSSRSSSS
4O80:H26ndSSSSSndSSSndSSndndS
The following antibiotics were tested: trimethoprim/sulfamethoxazole (SUT), aztreonam (ATM), ceftazidime (CAZ), ciprofloxacin (CIP), imipenem (IPM), amoxicillin/clavulanic acid (AMC), cefotaxime (CTX), cefepime (CPM), meropenem (MER), fosfomicin (FOS), gentamicin (GEN),amikacin (AMI), nalidixic acid (NAL), ertapenem (ERT), not done (nd), resistant (R), sensitive (S). int1 (operon encoding for integrase 1). For quality control the test was run against the following ATCC strains: Escherichia coli 25922 and Pseudomonas aeruginosa 27853.
Table 7. Primers sequences of virulence genes, annealing temperatures, and size of PCR product.
Table 7. Primers sequences of virulence genes, annealing temperatures, and size of PCR product.
GenesPrimer Sequence (5′- 3′)Annealing Temperatures (°C)Amplicon Size (bp)References
fimACTGTCGGCTCTGTCCCTCAGT
GATGCGGTACGAACCTGTCCTAA
65161[40]
fimHTGCAGAACGGATAAGCCGTGG
GCAGTCACCTGCCCTCCGGTA
63508[41]
papGACGGCTGTACTGCAGGGTGTGGCG
ATATCCTTTCTGCAGGGATGCAATA
50328[42]
sfaCTCCGGAGAACTGGGTGCATCTTAC
CGGAGGAGTAATTACAAACCTGGCA
50410[42]
cnf1AAGATGGAGTTTCCTATGCAGGAG
CATTCAGAGTCCTGCCCTCATTATT
61498[43]
int1ACATGCGTGTAAATCATCGTCG
GGGTCAAGGATCTGGATTTCG
62483[44]
picGGGTATTGTCCGTTCCGAT
ACAACGATACCGTCTCCCG
551175[45]
hlyGGTGCAGCAGAAAAAGTTGTAG
TCTCGCCTGATAGTGTTTGGTA
57596M10133(hlyA)
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Domingos, M.d.O.; da Silva Junior, S.M.; Milanello, W.; Nakano, S.S.N.; Franzolin, M.R.; dos Santos, L.F.; Nunes, K.O.; Marques, V.D.; Elias, W.P.; Silva, H.G.d.S.; et al. Escherichia coli Strains Responsible for Cystitis in Female Pediatric Patients with Normal and Abnormal Urinary Tracts Have Different Virulence Profiles. Pathogens 2022, 11, 231. https://doi.org/10.3390/pathogens11020231

AMA Style

Domingos MdO, da Silva Junior SM, Milanello W, Nakano SSN, Franzolin MR, dos Santos LF, Nunes KO, Marques VD, Elias WP, Silva HGdS, et al. Escherichia coli Strains Responsible for Cystitis in Female Pediatric Patients with Normal and Abnormal Urinary Tracts Have Different Virulence Profiles. Pathogens. 2022; 11(2):231. https://doi.org/10.3390/pathogens11020231

Chicago/Turabian Style

Domingos, Marta de Oliveira, Silvio Marciano da Silva Junior, Wagner Milanello, Shirley Sizue Nakamura Nakano, Marcia Regina Franzolin, Luis Fernando dos Santos, Kamila Oliveira Nunes, Vaniky Duarte Marques, Waldir P. Elias, Herbert Guimarães de Sousa Silva, and et al. 2022. "Escherichia coli Strains Responsible for Cystitis in Female Pediatric Patients with Normal and Abnormal Urinary Tracts Have Different Virulence Profiles" Pathogens 11, no. 2: 231. https://doi.org/10.3390/pathogens11020231

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop