Utilization of Recombinant Baculovirus Expression System to Produce the RBD Domain of SARS-CoV-2 Spike Protein
Abstract
:1. Introduction
2. Materials and Methods
2.1. Recombinant Virus Construction and Purification
2.2. Cell Culture
2.3. Western Blotting
2.4. Observation of Polyhedrin
3. Results
3.1. Construction of Recombinant Baculovirus
3.2. Verification of Polyhedron Formation
3.3. Expression of RBD Domain of S Protein
3.4. Higher Yield of Protein by Recombinant Baculovirus
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Belouzard, S.; Millet, J.K.; Licitra, B.N.; Whittaker, G.R. Mechanisms of coronavirus cell entry mediated by the viral spike protein. Viruses 2012, 4, 1011–1033. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Verdecchia, P.; Cavallini, C.; Spanevello, A.; Angeli, F. The pivotal link between ACE2 deficiency and SARS-CoV-2 infection. Eur. J. Intern. Med. 2020, 76, 14–20. [Google Scholar] [CrossRef] [PubMed]
- Seyran, M.; Takayama, K.; Uversky, V.N.; Lundstrom, K.; Palu, G.; Sherchan, S.P.; Attrish, D.; Rezaei, N.; Aljabali AA, A.; Ghosh, S.; et al. The structural basis of accelerated host cell entry by SARS-CoV-2dagger. FEBS J. 2021, 288, 5010–5020. [Google Scholar] [CrossRef] [PubMed]
- Walls, A.C.; Park, Y.J.; Tortorici, M.A.; Wall, A.; McGuire, A.T.; Veesler, D. Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein. Cell 2020, 181, 281–292.e286. [Google Scholar] [CrossRef]
- Wrapp, D.; Wang, N.; Corbett, K.S.; Goldsmith, J.A.; Hsieh, C.L.; Abiona, O.; Graham, B.S.; McLellan, J.S. Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science 2020, 367, 1260–1263. [Google Scholar] [CrossRef] [Green Version]
- Fujita, R.; Hino, M.; Ebihara, T.; Nagasato, T.; Masuda, A.; Lee, J.M.; Fujii, T.; Mon, H.; Kakino, K.; Nagai, R.; et al. Efficient production of recombinant SARS-CoV-2 spike protein using the baculovirus-silkworm system. Biochem. Biophys. Res. Commun. 2020, 529, 257–262. [Google Scholar] [CrossRef]
- Eckerle, L.D.; Lu, X.; Sperry, S.M.; Choi, L.; Denison, M.R. High fidelity of murine hepatitis virus replication is decreased in nsp14 exoribonuclease mutants. J. Virol. 2007, 81, 12135–12144. [Google Scholar] [CrossRef] [Green Version]
- Sanjuan, R.; Nebot, M.R.; Chirico, N.; Mansky, L.M.; Belshaw, R. Viral mutation rates. J. Virol. 2010, 84, 9733–9748. [Google Scholar] [CrossRef] [Green Version]
- Nikolaidis, M.; Markoulatos, P.; Van de Peer, Y.; Oliver, S.G.; Amoutzias, G.D. The Neighborhood of the Spike Gene Is a Hotspot for Modular Intertypic Homologous and Nonhomologous Recombination in Coronavirus Genomes. Mol. Biol. Evol. 2022, 39, msab292. [Google Scholar] [CrossRef]
- Nikolaidis, M.; Papakyriakou, A.; Chlichlia, K.; Markoulatos, P.; Oliver, S.G.; Amoutzias, G.D. Comparative Analysis of SARS-CoV-2 Variants of Concern, Including Omicron, Highlights Their Common and Distinctive Amino Acid Substitution Patterns, Especially at the Spike ORF. Viruses 2022, 14, 707. [Google Scholar] [CrossRef]
- Amoutzias, G.D.; Nikolaidis, M.; Tryfonopoulou, E.; Chlichlia, K.; Markoulatos, P.; Oliver, S.G. The Remarkable Evolutionary Plasticity of Coronaviruses by Mutation and Recombination: Insights for the COVID-19 Pandemic and the Future Evolutionary Paths of SARS-CoV-2. Viruses 2022, 14, 78. [Google Scholar] [CrossRef] [PubMed]
- Cameroni, E.; Bowen, J.E.; Rosen, L.E.; Saliba, C.; Zepeda, S.K.; Culap, K.; Pinto, D.; VanBlargan, L.A.; De Marco, A.; di Iulio, J.; et al. Broadly neutralizing antibodies overcome SARS-CoV-2 Omicron antigenic shift. Nature 2022, 602, 664–670. [Google Scholar] [CrossRef] [PubMed]
- Chambers, A.C.; Aksular, M.; Graves, L.P.; Irons, S.L.; Possee, R.D.; King, L.A. Overview of the Baculovirus Expression System. Curr. Protoc. Protein Sci. 2018, 91, 5.4.1–5.4.6. [Google Scholar] [CrossRef] [PubMed]
- Jarvis, D.L. Baculovirus-insect cell expression systems. Methods Enzymol. 2009, 463, 191–222. [Google Scholar]
- Sun, Z.; Lu, Y.; Zhang, H.; Kumar, D.; Liu, B.; Gong, Y.; Zhu, M.; Zhu, L.; Liang, Z.; Kuang, S.; et al. Effects of BmCPV Infection on Silkworm Bombyx mori Intestinal Bacteria. PLoS ONE 2016, 11, e0146313. [Google Scholar] [CrossRef]
- Mori, H.; Ito, R.; Nakazawa, H.; Sumida, M.; Matsubara, F.; Minobe, Y. Expression of Bombyx mori cytoplasmic polyhedrosis virus polyhedrin in insect cells by using a baculovirus expression vector, and its assembly into polyhedra. J. Gen. Virol. 1993, 74, 99–102. [Google Scholar] [CrossRef]
- Bernardino, T.C.; Astray, R.M.; Pereira, C.A.; Boldorini, V.L.; Antoniazzi, M.M.; Jared, S.G.S.; Nunez, E.G.F.; Jorge, S.A.C. Production of Rabies VLPs in Insect Cells by Two Monocistronic Baculoviruses Approach. Mol. Biotechnol. 2021, 63, 1068–1080. [Google Scholar] [CrossRef]
- Xiang, X.; Yang, R.; Yu, S.; Cao, C.; Guo, A.; Chen, L.; Wu, X.; Cui, W.; Cenis, J.L. Construction of a BmNPV polyhedrin-plus Bac-to-Bac baculovirus expression system for application in silkworm, Bombyx mori. Appl. Microbiol. Biotechnol. 2010, 87, 289–295. [Google Scholar] [CrossRef]
- Yue, W.F.; Li, X.H.; Wu, W.C.; Roy, B.; Li, G.L.; Liu, J.M.; Wu, X.F.; Zhou, J.Y.; Zhang, C.X.; David, W.C.; et al. Improvement of recombinant baculovirus infection efficiency to express manganese superoxide dismutase in silkworm larvae through dual promoters of Pph and Pp10. Appl. Microbiol. Biotechnol. 2008, 78, 651–657. [Google Scholar] [CrossRef]
- Possee, R.D.; Chambers, A.C.; Graves, L.P.; Aksular, M.; King, L.A. Recent Developments in the Use of Baculovirus Expression Vectors. Curr. Issues Mol. Biol. 2019, 34, 215–230. [Google Scholar]
- Pazmino-Ibarra, V.; Mengual-Marti, A.; Targovnik, A.M.; Herrero, S. Improvement of baculovirus as protein expression vector and as biopesticide by CRISPR/Cas9 editing. Biotechnol. Bioeng. 2019, 116, 2823–2833. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Hua, C.; Xia, S.; Li, W.; Lu, L.; Jiang, S. Combining a Fusion Inhibitory Peptide Targeting the MERS-CoV S2 Protein HR1 Domain and a Neutralizing Antibody Specific for the S1 Protein Receptor-Binding Domain (RBD) Showed Potent Synergism against Pseudotyped MERS-CoV with or without Mutations in RBD. Viruses 2019, 11, 31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tai, W.; Zhang, X.; Drelich, A.; Shi, J.; Hsu, J.C.; Luchsinger, L.; Hillyer, C.D.; Tseng, C.K.; Jiang, S.; Du, L. A novel receptor-binding domain (RBD)-based mRNA vaccine against SARS-CoV-2. Cell Res. 2020, 30, 932–935. [Google Scholar] [CrossRef] [PubMed]
- Premkumar, L.; Segovia-Chumbez, B.; Jadi, R.; Martinez, D.R.; Raut, R.; Markmann, A.; Cornaby, C.; Bartelt, L.; Weiss, S.; Park, Y.; et al. The RBD Of The Spike Protein Of SARS-Group Coronaviruses Is A Highly Specific Target Of SARS-CoV-2 Antibodies But Not Other Pathogenic Human and Animal Coronavirus Antibodies. medRxiv 2020. [Google Scholar] [CrossRef]
- Ma, X.L.; He, W.Y.; Wang, P.; You, M.S. Cell lines from diamondback moth exhibiting differential susceptibility to baculovirus infection and expressing midgut genes. Insect Sci. 2019, 26, 251–262. [Google Scholar] [CrossRef]
- Huang, Y.; Zou, Q.; Shen, X.J.; Yu, X.L.; Wang, Z.B.; Cheng, X.C. Construction of baculovirus expression vector of miRNAs and its expression in insect cells. Mol. Genet. Mikrobiol. Virusol. 2012, 2, 35–39. [Google Scholar] [CrossRef] [Green Version]
- Ohki, T.; Mikhailenko, S.V.; Arai, T.; Ishii, S.; Ishiwata, S. Improvement of the yields of recombinant actin and myosin V-HMM in the insect cell/baculovirus system by the addition of nutrients to the high-density cell culture. J. Muscle Res. Cell Motil. 2012, 33, 351–358. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence |
---|---|
>F-p10-poly | CCGCTCGAGATGGCAGACGTAGCAGGAACA |
>R-p10-poly | CGGGGTACCCTGACGGTTACTCAGAGCTAC |
>F-E2 | CTTTACTTCCAGGGAGGATCCATGGTTTCCAGGTTTTTAATA |
>R-E2 | ATGGTGATGGTGGTGAGCTTCTCATCATCCTCCTCTTC |
>F-CAP | CTTTACTTCCAGGGAGGATCCATGACGTATCCAAGGAGGC |
>R-CAP | ATGGTGATGGTGGTGAGCTTAGGGTTAAGTGGGGGGTCTTT |
>F-RBD | CTTTACTTCCAGGGAGGATCCATGACTGAATCTATCGTGAGA |
>R-RBD | ATGGTGATGGTGGTGAAGCTTTTCCAGAGTTTGTGGGTCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fan, Y.; Wei, J.; Wang, W.; Li, C.; Pan, G.; Keiffer, T.; Bao, J.; Zhou, Z. Utilization of Recombinant Baculovirus Expression System to Produce the RBD Domain of SARS-CoV-2 Spike Protein. Pathogens 2022, 11, 672. https://doi.org/10.3390/pathogens11060672
Fan Y, Wei J, Wang W, Li C, Pan G, Keiffer T, Bao J, Zhou Z. Utilization of Recombinant Baculovirus Expression System to Produce the RBD Domain of SARS-CoV-2 Spike Protein. Pathogens. 2022; 11(6):672. https://doi.org/10.3390/pathogens11060672
Chicago/Turabian StyleFan, Youpeng, Junhong Wei, Wei Wang, Chunfeng Li, Guoqing Pan, Timothy Keiffer, Jialing Bao, and Zeyang Zhou. 2022. "Utilization of Recombinant Baculovirus Expression System to Produce the RBD Domain of SARS-CoV-2 Spike Protein" Pathogens 11, no. 6: 672. https://doi.org/10.3390/pathogens11060672
APA StyleFan, Y., Wei, J., Wang, W., Li, C., Pan, G., Keiffer, T., Bao, J., & Zhou, Z. (2022). Utilization of Recombinant Baculovirus Expression System to Produce the RBD Domain of SARS-CoV-2 Spike Protein. Pathogens, 11(6), 672. https://doi.org/10.3390/pathogens11060672