Next Article in Journal
Unusual Observations in Leishmaniasis—An Overview
Previous Article in Journal
East Coast Fever Carrier Status and Theileria parva Breakthrough Strains in Recently ITM Vaccinated and Non-Vaccinated Cattle in Iganga District, Eastern Uganda
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 12
Issue 2
10.3390/pathogens12020296
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Multiplex ddPCR: A Promising Diagnostic Assay for Early Detection and Drug Monitoring in Bovine Theileriosis

by
Shweta Murthy
1,†,
Akash Suresh
1,†,
Debabrata Dandasena
1,2,†,
Sakshi Singh
1,2,
Madhusmita Subudhi
1,2,
Vasundhra Bhandari
1,2,3,
Vandna Bhanot
4,
Jaspreet Singh Arora
5 and
Paresh Sharma
1,*
1
National Institute of Animal Biotechnology, Hyderabad 500032, India
2
Graduate Studies, Regional Centre for Biotechnology (RCB), Faridabad 121001, India
3
National Institute of Pharmaceutical Education and Research (NIPER), Hyderabad 500037, India
4
Disease Investigation Laboratory, LUVAS (Hisar), Haryana 125011, India
5
School of Animal Biotechnology, GADVASU, Chandigarh 141012, India
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Pathogens 2023, 12(2), 296; https://doi.org/10.3390/pathogens12020296
Submission received: 22 October 2022 / Revised: 26 December 2022 / Accepted: 29 December 2022 / Published: 10 February 2023
(This article belongs to the Section Parasitic Pathogens)
Browse Figures
Versions Notes

Abstract

:
Accurate quantification based on nucleic acid amplification is necessary to avoid the spread of pathogens, making early diagnosis essential. Droplet digital PCR (ddPCR) stands out for absolute parasite quantification because it combines microfluidics with the TaqMan test. This helps deliver maximum accuracy without needing a reference curve. This study assessed the efficacy of ddPCR as a detection tool for the bovine theileriosis (BT) caused by Theileria parasites. We developed and validated a duplex ddPCR method that detects and quantifies the Theileria genus (18S rRNA) and identifies clinically significant Theileria annulata parasites (TaSP) in experimental and clinical samples. ddPCR was shown to be as effective as qPCR throughout a 10-fold sample dilution range. However, ddPCR was more sensitive than qPCR at lower parasite DNA concentrations and reliably assessed up to 8.5 copies/µL of the TaSP gene in the infected DNA (0.01 ng) samples. The ddPCR was very accurate and reproducible, and it could follow therapeutic success in clinical cases of theileriosis. In conclusion, our ddPCR assays were highly sensitive and precise, providing a valuable resource for the study of absolute parasite quantification, drug treatment monitoring, epidemiological research, large-scale screening, and the identification of asymptomatic parasite reservoirs in the pursuit of BT eradication.

1. Introduction

Human and animal parasite diseases spread by vectors are potentially fatal and cause massive economic losses if not promptly treated. Bovine theileriosis (BT) is a vector-borne disease linked to fatalities in tropical and subtropical countries [1]. Even though several Theileria parasite species have been identified in the field, just two pathogenic species, Theileria annulata and Theileria parva, are responsible for most economic losses in the cattle industry [2,3]. In India, T. annulata is the primary cause of BT, costing the dairy industry an estimated loss of $1.29 billion per annum [4]. Resistance to buparvaquone (BPQ) in the field has impeded the management of this parasite, the treatment of which is entirely reliant on it [5,6,7,8]. It has been shown that early parasite detection is important for the BPQ to efficiently eliminate the Theileria parasite [5]. In cattle, delayed diagnosis might result in deadly lymphoproliferative disease. Because early parasite identification is critical for parasite management, precise and accurate quantification of T. annulata parasites is essential for mass screening and treatment protocols to be efficiently applied in the field.
The current gold standard for diagnosing T. annulata parasites is based on disease symptoms paired with light microscopy (LM) [9]. Low blood parasite numbers make early microscopy identification difficult, and the presence of identical parasites, such as Babesia, may lead to false conclusions [10,11]. Several molecular diagnostic techniques based on T. annulata-specific genes have been developed to identify Theileria parasites, enabling the disease to be diagnosed at low parasite counts and with greater sensitivity than the LM [11,12,13,14,15,16]. Our group had recently developed a real-time PCR method for determining the parasite-to-host ratio and parasitemia in clinical samples of BT [17]. Despite its superior sensitivity and accuracy compared to previous molecular or serological approaches used in the field, there are still areas where the quantitative test may be improved. One key disadvantage of existing qPCR techniques is their reliance on the reference standard curve, which makes comparing qPCR findings between labs challenging [17,18,19,20,21,22]. Developing an assay with higher performance at low doses without the requirement for a reference standard curve should increase the detection of infection, hence facilitating case identification and disease monitoring. ddPCR is a breakthrough DNA quantification technique that avoids dependence on the reference standard curve and is effective in diagnosing and quantifying various human and animal pathogens, including vector-borne infections [23,24,25,26,27,28,29,30,31,32,33,34,35]. With more consistent findings across technical replicates and higher sensitivity than qPCR, ddPCR has been gaining traction as a viable pathogen identification and quantification option.
We evaluated the sensitivity of ddPCR to identify and quantify T. annulata parasites in clinical and in vitro samples. The analytical and diagnostic sensitivity and specificity of ddPCR were compared to the qPCR iteration targeting the microschizont stage-specific parasite gene TaSP to evaluate the technique’s efficacy. In addition, we devised a multiplex test that can detect T. annulata parasites and other Theileria species in the field.

2. Materials and Methods

2.1. Sample Collection, DNA Isolation, and Theileria-Specific PCR

Bovine blood samples (N = 151) were collected from Haryana, India, which were suspected for BT based on symptoms and LM (Geimsa Staining). Approximately 2 mL of blood was collected into EDTA-coated vacutainer tubes (BD) with the assistance of veterinarians. The standard phenol-chloroform-isoamyl alcohol procedure was utilized to isolate DNA from blood. The DNA concentration and integrity were confirmed through nanodrop and agarose gel electrophoresis. The T. annulata infection was confirmed using polymerase chain reaction (PCR) by amplifying T. annulata specific primers for the TaSP gene. We used gDNA from an in vitro cultured strain of Theileria-infected bovine cells (TA) as a positive control from our lab.
The PCR conditions for the primers using NEB Taq Polymerase (M0273) mentioned in Table 1 were as follows:
TaSP: 95 °C for 3 min, followed by 35 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, and a final extension of 3 min at 72 °C.

2.2. In Vitro Culture of the T. annulata Infected Bovine Lymphocyte Cell Line (TA)

T. annulata-infected lymphocytes were cultured in RPMI 1640 medium with 10% FBS and Pen/Strep (100 µg/mL) solution at 37 °C and 5% CO2, as described earlier in Dandasena et al., 2018. The standard phenol-chloroform-isoamyl alcohol procedure was utilized to isolate DNA from the cell line. The DNA concentration and integrity were confirmed using nanodrop and agarose gel electrophoresis.

2.3. ddPCR

To detect Theileria infection, the ddPCR approach was optimized first in TA cells and then tested in field samples (N = 151). The primers and probes for this study were designed and obtained from Eurogentec, Belgium and their specificity was confirmed using NCBI BLAST.
The total volume of the ddPCR mixture was kept at 20 µL which included primers (0.9 µM forward and reverse primers), probes (0.2 µM), DNA (100 ng), and 1× ddPCR super mix (Bio-Rad, Hemel Hempstead, UK). The reaction was carried out in duplicate. Droplet creation, reading, and data analysis for ddPCR were performed using the Bio-Rad QX100, as previously reported [29].

2.4. qPCR

The TaSP gene was used in a qPCR test to assess the analytical and diagnostic performance of the ddPCR results [17]. The qPCR experiment was conducted on TA cell line DNA using a previously described technique [17]. Table 1 lists the primers that were utilized for the qPCR.

2.5. TaSP Quantification through qPCR

The amplified product of TaSP was cloned into a pBSK plasmid using the TA cloning method as described earlier (https://www.thermofisher.com/in/en/home/life-science/cloning/ta-cloning-kits.html (accessed on 22 March 2022)). Later, pBSK was transformed into the E. coli cells (Top10), and cloned plasmids were screened for the presence of TaSP genes. Following that, these cloned pBSK-TaSP plasmids were serially diluted and qPCR quantified for Cq values using SYBR green at corresponding copies/µL. Based on these values, a standard graph was generated from which the copies/µL of test samples were derived.

2.6. Monitoring Treatment Response

To assess the effectiveness of the anti-Theilerial therapy, we examined the usefulness of the ddPCR in monitoring the treatment. In a 6-well plate, TA cells were seeded at a density of 2 × 105 cells with and without treatment with BPQ for 72 h at a concentration of 200 ng/mL. DNA was extracted from treated and untreated samples and tested using ddPCR with the help of TaSP gene primers and probes. The experiment was carried out in triplicate.

2.7. Ethical Approval and Informed Consent

We initially acquired verbal permission from the owners before collecting blood from animals. In India, however, acquiring blood samples of less than 5 mL is not prohibited and does not need the consent of an ethical committee. Qualified veterinarians collected blood samples.

2.8. Statistical Analysis

GraphPad Prism 7.0 and Microsoft Excel 2019 were used for linear regression analysis of real-time PCR standard curves. Using QuantaSoftTM analysis software 1.7.4.0917 and a fluorescence amplitude threshold, positive and negative droplets were distinguished (Bio-Rad). Using the autofluorescence amplitude threshold mode, all observations were obtained. The retrieved ddPCR data were then analyzed in Microsoft Excel to provide means and standard deviations.

3. Results

3.1. Comparing the Sensitivity and Accuracy of ddPCR Assay for T. annulata Detection

We compared the sensitivity of ddPCR and qPCR for identifying T. annulata parasites by utilizing TaSP gene primers. TA cell DNA was serially diluted in water to assess the sensitivity of TaSP gene primers ranging from 100 ng to 0.01 ng (Figure 1A,B). Compared to qPCR (regression slope y = 8.7*x + 25.2 R2 = 0.987), ddPCR quantification precisely paralleled the dilution stages (regression slope y = 40.5*x + 31.1 R2 = 1) (Figure 1C). At 0.01 ng of DNA, qPCR found 2.5 TaSP gene copies/µL. However, 8.2 copies/µL were detected using ddPCR in the same sample. As shown by the correlation coefficient, the sensitivity of the ddPCR reaction is greater than that of the qPCR when the number of parasite DNA copies is low, as measured by the number of TaSP copies (R2). The repeatability of the ddPCR and qPCR assays was assessed by comparing their coefficient of variation (CV) over a range of parasite concentrations using TaSP gene quantification. Comparing the CV of ddPCR (3.4%) to that of qPCR (26.1%) readings of the same samples at lower concentrations (0.01 ng) demonstrates that ddPCR findings are more consistent and reproducible (Figure 1D). When the number of parasite DNA copies is low, linear regression analysis and CV demonstrate that ddPCR is preferable to qPCR.

3.2. Multiplex ddPCR Assay for Diagnosing Theileria Species and T. annulata Parasites from the Field

We established a duplex ddPCR test using TaSP and 18s rRNA to diagnose Theileria species and T. annulata parasites in field samples. Using 18s rRNA primers, the multiplex test can help identify all Theileria genera, whereas TaSP confirms T. annulata infections. The ddPCR assay for the two genes was optimized using TA cell DNA. To determine the diagnostic performance of the 18s rRNA and TaSP gene primers, 151 DNA samples from potentially infected animals were collected from the field (Figure 2A). In the ddPCR experiment using duplex primers, the optimal annealing temperature of 60 °C enabled a distinct separation between DNA-positive and DNA-negative droplets. The 18S rRNA gene was identified in 138 of these samples, whereas the TaSP gene was identified in 135. In 13 samples, earlier identified as positive for theileriosis based on symptoms or LM, no amplification was seen with any primer. In the ddPCR samples, the 18S rRNA and TaSP primers sensitivity was 100% and 97.8%, respectively (Figure 2C,D). Across all tests, 100% of all clinical samples were concordant. Both the positive and negative samples were accurately identified. Using the TaSP template, a Bland-Altman plot was used to compare the quantitative differences between ddPCR and qPCR (Figure 2B). When the number of copies of parasite DNA was minimal, there were no quantitative differences between ddPCR and qPCR. Nonetheless, quantitative differences between the two techniques became more evident when the number of parasites increased.

3.3. Treatment Efficiency of the ddPCR Assay

Identifying T. annulata infection in the field is challenging, making tracking the treatment response even more difficult. Since some of the treated animals carrying the parasites remain undetected, they become carriers for ticks, leading to further disease propagation. ddPCR was performed on DNA samples from treated and untreated Theileria-infected cell lines (TA) with BPQ to evaluate the treatment’s effectiveness. After 72 h of BPQ therapy, DNA was extracted from the cell lines to monitor the parasite growth based on the TaSP gene expression. Using ddPCR, the number of TaSP copies/µL before and after BPQ treatment was determined. The number of parasite DNA copies dramatically reduced in treated samples in contrast to untreated ones. After 72 h, TaSP gene copies in DNA were measured to be only 2643 copies/µL in treated samples in comparison to 8956 copies/µL in control cell lines. (Figure 3A,B).

4. Discussion

Domestic and wild animals carry several Theileria species in tropical and subtropical regions; however, T. annulata and T. parva pose the most significant concern due to their ability to cause severe sickness and high mortality in cattle. T. annulata is the most concerning Theileria species in Indian cattle and requires prompt diagnosis and treatment. Molecular techniques based on the PCR have been developed to detect and quantify Theileria species and the T. annulata parasite [11,12,15,16,17,18,19,20,21,22,36,37,38]. Although qPCR-based techniques have shown promise in detecting Theileria infections, absolute quantification of parasites remains challenging due to qPCR’s dependence on reference standard curves. Furthermore, because different laboratories use different reference standard curves, comparing qPCR results from varying locations is difficult. A novel, sensitive, absolute quantitative test for identifying and quantifying Theileria parasites at the genus and species levels is required for detecting early infection and asymptomatic carrier animals. In this study, multiplex droplet digital PCR was employed to offer a reference standard curve-free approach for detecting and quantifying Theileria parasites at the genus and T. annulata at the species levels. Multiplex PCR using 18s rRNA identified the Theileria genus, and TaSP suggests T. annulata infection. The decision to treat or not treat an animal based on a TaSP diagnosis will aid in the fight against antibiotic resistance. It is because, unlike T. annulata, other Theileria parasites are not life-threatening and may be eliminated without medical intervention.
To the best of our knowledge, this is the first study to use ddPCR to quantify livestock-related Theileria parasites. Our data show that ddPCR is sensitive and accurate in identifying T. annulata parasites. When comparing ddPCR with qPCR, the former proved to be more reliable and sensitive while measuring parasite DNA at low sample concentrations. At lower parasite DNA, ddPCR exhibited considerably less variance than qPCR between technical replicates. Because ddPCR does not need a standard curve, findings from different laboratories may be directly compared regarding parasite density. The multiplex ddPCR was successful in quantifying the Theileria genus and T. annulata species. Field investigations from many countries have shown drug resistance to BPQ [6,8,9,39]. Our ddPCR-based technique may also be used to track instances of drug resistance by monitoring treatment response in BPQ-treated animals.
Since the findings of ddPCR are absolute and can be compared across labs without repetition, it is particularly effective in detecting bacteria, viruses, and parasites. ddPCR outperformed qPCR in identifying pathogen DNA in E. coli, C. jejuni, CMV, C. trachomatis, Salmonella, and HIV [23,24,25,26,27]. In the case of parasites such as Plasmodium, ddPCR was shown to be more sensitive and accurate than qPCR; however, in Toxoplasma, Cryptosporidium, Leishmania, Trypanosoma, Theileria equi, Theileria cervi, Babesia, Bartonella, and Borrelia species, ddPCR was found to be equivalent to qPCR [28,29,30,31,32,33,34,35].

5. Conclusions

In conclusion, we provided the first evaluation of the ddPCR platform for detecting the Theileria genus and T. annulata species in infected animals. The ddPCR test is recommended over qPCR because of its superior sensitivity and precision. Our test will be beneficial as a research instrument for detecting early or mixed infections, monitoring treatment response in the field, epidemiological studies, mass screening, and identifying carrier animals. Due to the inherent costs, ddPCR may not be economically feasible as a standard diagnostic technique at present. Nonetheless, ddPCR provides significant advantages, such as the ability to quantify DNA without calibration curves, which enables reliable and reference-free sample-specific results.

Author Contributions

P.S, S.M., A.S., D.D. and V.B. (Vasundhra Bhandari) devised the study’s concept, designed the experiments, and analyzed and interpreted the findings. V.B. (Vandna Bhanot) and J.S.A. assisted with sample collection, research design, data analysis, and paper editing. P.S., A.S., S.S., M.S., D.D., S.M. and V.B. (Vasundhra Bhandari) wrote the manuscript. Each author was given the opportunity to discuss the results and provide feedback on the article. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financed by a core grant from the National Institute of Animal Biotechnology.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

D.D. thanks the Department of Biotechnology (DBT), New Delhi, for the DBT JRF fellowship and the Regional Centre for Biotechnology (RCB), Faridabad, India, for pursuing a PhD. S.M. thanks the DST-Women Scientist A program for providing the fellowship.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Agina, O.A.; Shaari, M.R.; Isa, N.M.M.; Ajat, M.; Zamri-Saad, M.; Hamzah, H. Clinical Pathology, Immunopathology and Advanced Vaccine Technology in Bovine Theileriosis: A Review. Pathogens 2020, 9, 697. [Google Scholar] [CrossRef] [PubMed]
  2. Pain, A.; Renauld, H.; Berriman, M.; Murphy, L.; Yeats, C.A.; Weir, W.; Kerhornou, A.; Aslett, M.; Bishop, R.; Bouchier, C.; et al. Genome of the Host-Cell Transforming Parasite Theileria annulata Compared with T. parva. Science 2005, 309, 131–133. [Google Scholar] [CrossRef] [PubMed]
  3. McKeever, D.J. Bovine Immunity—A Driver for Diversity in Theileria Parasites? Trends Parasitol. 2009, 25, 269–276. [Google Scholar] [CrossRef] [PubMed]
  4. Narladkar, B.W. Projected Economic Losses Due to Vector and Vector-Borne Parasitic Diseases in Livestock of India and Its Significance in Implementing the Concept of Integrated Practices for Vector Management. Vet. World 2018, 11, 151–160. [Google Scholar] [CrossRef] [PubMed]
  5. Mhadhbi, M.; Naouach, A.; Boumiza, A.; Chaabani, M.F.; BenAbderazzak, S.; Darghouth, M.A. In Vivo Evidence for the Resistance of Theileria annulata to Buparvaquone. Vet. Parasitol. 2010, 169, 241–247. [Google Scholar] [CrossRef]
  6. Marsolier, J.; Perichon, M.; DeBarry, J.D.; Villoutreix, B.O.; Chluba, J.; Lopez, T.; Garrido, C.; Zhou, X.Z.; Lu, K.P.; Fritsch, L.; et al. Theileria Parasites Secrete a Prolyl Isomerase to Maintain Host Leukocyte Transformation. Nature 2015, 520, 378–382. [Google Scholar] [CrossRef]
  7. Sharifiyazdi, H.; Namazi, F.; Oryan, A.; Shahriari, R.; Razavi, M. Point Mutations in the Theileria annulata Cytochrome b Gene Is Associated with Buparvaquone Treatment Failure. Vet. Parasitol. 2012, 187, 431–435. [Google Scholar] [CrossRef]
  8. Chatanga, E.; Mosssad, E.; Abdo Abubaker, H.; Amin Alnour, S.; Katakura, K.; Nakao, R.; Salim, B. Evidence of Multiple Point Mutations in Theileria annulata Cytochrome b Gene Incriminated in Buparvaquone Treatment Failure. Acta Trop. 2019, 191, 128–132. [Google Scholar] [CrossRef]
  9. Uilenberg, G. Theilerial Species of Domestic Livestock. In Advances in the Control of Theileriosis: Proceedings of an International Conference held at the International Laboratory for Research on Animal Diseases in Nairobi, 9–13th February, 1981; Irvin, A.D., Cunningham, M.P., Young, A.S., Eds.; Current Topics in Veterinary Medicine and Animal Science; Springer: Dordrecht, The Netherlands, 1981; pp. 4–37. ISBN 9789400983465. [Google Scholar]
  10. Criado-Fornelio, A.; Rey-Valeiron, C.; Buling, A.; Barba-Carretero, J.C.; Jefferies, R.; Irwin, P. New Advances in Molecular Epizootiology of Canine Hematic Protozoa from Venezuela, Thailand and Spain. Vet. Parasitol. 2007, 144, 261–269. [Google Scholar] [CrossRef]
  11. Mans, B.J.; Pienaar, R.; Latif, A.A. A Review of Theileria Diagnostics and Epidemiology. Int. J. Parasitol. Parasites Wildl. 2015, 4, 104–118. [Google Scholar] [CrossRef]
  12. Shayan, P.; Biermann, R.; Schein, E.; Gerdes, J.; Ahmed, J.S. Detection and Differentiation of Theileria annulata and Theileria parva Using Macroschizont-Derived DNA Probes. Ann. N. Y. Acad. Sci. 1998, 849, 88–95. [Google Scholar] [CrossRef]
  13. Ghosh, S.; Bansal, G.C.; Gupta, S.C.; Ray, D.; Khan, M.Q.; Irshad, H.; Shahiduzzaman, M.; Seitzer, U.; Ahmed, J.S. Status of Tick Distribution in Bangladesh, India and Pakistan. Parasitol. Res. 2007, 101, 207–216. [Google Scholar] [CrossRef]
  14. Bilgic, H.B.; Bakırcı, S.; Kose, O.; Unlu, A.H.; Hacılarlıoglu, S.; Eren, H.; Weir, W.; Karagenc, T. Prevalence of Tick-Borne Haemoparasites in Small Ruminants in Turkey and Diagnostic Sensitivity of Single-PCR and RLB. Parasites Vectors 2017, 10, 211. [Google Scholar] [CrossRef]
  15. Santos, M.; Soares, R.; Costa, P.; Amaro, A.; Inácio, J.; Gomes, J. Revisiting the Tams1-Encoding Gene as a Species-Specific Target for the Molecular Detection of Theileria annulata in Bovine Blood Samples. Ticks Tick-Borne Dis. 2013, 4, 72–77. [Google Scholar] [CrossRef]
  16. Kundave, V.R.; Patel, A.K.; Patel, P.V.; Hasnani, J.J.; Joshi, C.G. Qualitative and Quantitative Assessment of Theileria annulata in Cattle and Buffaloes Polymerase Chain Reaction. Trop. Biomed. 2014, 31, 728–735. [Google Scholar]
  17. Dandasena, D.; Bhandari, V.; Sreenivasamurthy, G.S.; Murthy, S.; Roy, S.; Bhanot, V.; Arora, J.S.; Singh, S.; Sharma, P. A Real-Time PCR Based Assay for Determining Parasite to Host Ratio and Parasitaemia in the Clinical Samples of Bovine Theileriosis. Sci. Rep. 2018, 8, 15441. [Google Scholar] [CrossRef]
  18. Ros-García, A.; Nicolás, A.; García-Pérez, A.L.; Juste, R.A.; Hurtado, A. Development and Evaluation of a Real-Time PCR Assay for the Quantitative Detection of Theileria annulata in Cattle. Parasites Vectors 2012, 5, 171. [Google Scholar] [CrossRef]
  19. Selim, A.M.; Das, M.; Senapati, S.K.; Jena, G.R.; Mishra, C.; Nath, I.; Senapati, S.; Sethi, M. Molecular Detection of Theileria annulata Infection in Cattle by Conventional PCR and Quantitative Real Time PCR in India. J. Parasit. Dis. 2021, 45, 72–77. [Google Scholar] [CrossRef]
  20. Chaisi, M.E.; Janssens, M.E.; Vermeiren, L.; Oosthuizen, M.C.; Collins, N.E.; Geysen, D. Evaluation of a Real-Time PCR Test for the Detection and Discrimination of Theileria Species in the African Buffalo (Syncerus caffer). PLoS ONE 2013, 8, e75827. [Google Scholar] [CrossRef]
  21. Hostettler, I.; Müller, J.; Stephens, C.E.; Haynes, R.; Hemphill, A. A Quantitative Reverse-Transcriptase PCR Assay for the Assessment of Drug Activities against Intracellular Theileria annulata Schizonts. Int. J. Parasitol. Drugs Drug Resist. 2014, 4, 201–209. [Google Scholar] [CrossRef] [PubMed]
  22. Ziam, H.; Kelanamer, R.; Aissi, M.; Ababou, A.; Berkvens, D.; Geysen, D. Prevalence of Bovine Theileriosis in North Central Region of Algeria by Real-Time Polymerase Chain Reaction with a Note on Its Distribution. Trop. Anim. Health Prod. 2015, 47, 787–796. [Google Scholar] [CrossRef] [PubMed]
  23. Rutsaert, S.; Bosman, K.; Trypsteen, W.; Nijhuis, M.; Vandekerckhove, L. Digital PCR as a Tool to Measure HIV Persistence. Retrovirology 2018, 15, 16. [Google Scholar] [CrossRef] [PubMed]
  24. Papić, B.; Pate, M.; Henigman, U.; Zajc, U.; Gruntar, I.; Biasizzo, M.; Ocepek, M.; Kušar, D. New Approaches on Quantification of Campylobacter Jejuni in Poultry Samples: The Use of Digital PCR and Real-Time PCR against the ISO Standard Plate Count Method. Front. Microbiol. 2017, 8, 331. [Google Scholar] [CrossRef]
  25. Hayden, R.T.; Gu, Z.; Ingersoll, J.; Abdul-Ali, D.; Shi, L.; Pounds, S.; Caliendo, A.M. Comparison of Droplet Digital PCR to Real-Time PCR for Quantitative Detection of Cytomegalovirus. J. Clin. Microbiol. 2013, 51, 540–546. [Google Scholar] [CrossRef]
  26. Wang, M.; Yang, J.; Gai, Z.; Huo, S.; Zhu, J.; Li, J.; Wang, R.; Xing, S.; Shi, G.; Shi, F.; et al. Comparison between Digital PCR and Real-Time PCR in Detection of Salmonella Typhimurium in Milk. Int. J. Food Microbiol. 2018, 266, 251–256. [Google Scholar] [CrossRef]
  27. Roberts, C.H.; Last, A.; Molina-Gonzalez, S.; Cassama, E.; Butcher, R.; Nabicassa, M.; McCarthy, E.; Burr, S.E.; Mabey, D.C.; Bailey, R.L.; et al. Development and Evaluation of a Next-Generation Digital PCR Diagnostic Assay for Ocular Chlamydia Trachomatis Infections. J. Clin. Microbiol 2013, 51, 2195–2203. [Google Scholar] [CrossRef]
  28. Mancusi, A.; Giordano, A.; Bosco, A.; Girardi, S.; Proroga, Y.T.R.; Morena, L.; Pinto, R.; Sarnelli, P.; Cringoli, G.; Rinaldi, L.; et al. Development of a Droplet Digital Polymerase Chain Reaction Tool for the Detection of Toxoplasma Gondii in Meat Samples. Parasitol. Res. 2022, 121, 1467–1473. [Google Scholar] [CrossRef]
  29. Ramírez, J.D.; Herrera, G.; Hernández, C.; Cruz-Saavedra, L.; Muñoz, M.; Flórez, C.; Butcher, R. Evaluation of the Analytical and Diagnostic Performance of a Digital Droplet Polymerase Chain Reaction (DdPCR) Assay to Detect Trypanosoma Cruzi DNA in Blood Samples. PLoS Negl. Trop. Dis. 2018, 12, e0007063. [Google Scholar] [CrossRef]
  30. Ramírez, J.D.; Herrera, G.; Muskus, C.; Mendez, C.; Duque, M.C.; Butcher, R. Development of a Digital Droplet Polymerase Chain Reaction (DdPCR) Assay to Detect Leishmania DNA in Samples from Cutaneous Leishmaniasis Patients. Int. J. Infect. Dis. 2019, 79, 1–3. [Google Scholar] [CrossRef]
  31. Yang, R.; Paparini, A.; Monis, P.; Ryan, U. Comparison of Next-Generation Droplet Digital PCR (DdPCR) with Quantitative PCR (QPCR) for Enumeration of Cryptosporidium Oocysts in Faecal Samples. Int. J. Parasitol. 2014, 44, 1105–1113. [Google Scholar] [CrossRef]
  32. Srisutham, S.; Saralamba, N.; Malleret, B.; Rénia, L.; Dondorp, A.M.; Imwong, M. Four Human Plasmodium Species Quantification Using Droplet Digital PCR. PLoS ONE 2017, 12, e0175771. [Google Scholar] [CrossRef] [PubMed]
  33. Koepfli, C.; Nguitragool, W.; Hofmann, N.E.; Robinson, L.J.; Ome-Kaius, M.; Sattabongkot, J.; Felger, I.; Mueller, I. Sensitive and Accurate Quantification of Human Malaria Parasites Using Droplet Digital PCR (DdPCR). Sci. Rep. 2016, 6, 39183. [Google Scholar] [CrossRef] [PubMed]
  34. Maggi, R.; Breitschwerdt, E.B.; Qurollo, B.; Miller, J.C. Development of a Multiplex Droplet Digital PCR Assay for the Detection of Babesia, Bartonella, and Borrelia Species. Pathogens 2021, 10, 1462. [Google Scholar] [CrossRef] [PubMed]
  35. Wilson, M.; Glaser, K.C.; Adams-Fish, D.; Boley, M.; Mayda, M.; Molestina, R.E. Development of Droplet Digital PCR for the Detection of Babesia microti and Babesia duncani. Exp. Parasitol. 2015, 149, 24–31. [Google Scholar] [CrossRef]
  36. Seitzer, U.; Bakheit, M.A.; Salih, D.E.A.; Ali, A.; Haller, D.; Yin, H.; Schnittger, L.; Ahmed, J. From Molecule to Diagnostic Tool: Theileria annulata Surface Protein TaSP. Parasitol. Res. 2007, 101, 217–223. [Google Scholar] [CrossRef]
  37. Bilgic, H.B.; Karagenç, T.; Shiels, B.; Tait, A.; Eren, H.; Weir, W. Evaluation of Cytochrome b as a Sensitive Target for PCR Based Detection of T. annulata Carrier Animals. Vet. Parasitol. 2010, 174, 341–347. [Google Scholar] [CrossRef]
  38. George, N.; Bhandari, V.; Reddy, D.P.; Sharma, P. Molecular and Phylogenetic Analysis Revealed New Genotypes of Theileria annulata Parasites from India. Parasites Vectors 2015, 8, 468. [Google Scholar] [CrossRef]
  39. Mhadhbi, M.; Chaouch, M.; Ajroud, K.; Darghouth, M.A.; BenAbderrazak, S. Sequence Polymorphism of Cytochrome b Gene in Theileria annulata Tunisian Isolates and Its Association with Buparvaquone Treatment Failure. PLoS ONE 2015, 10, e0129678. [Google Scholar] [CrossRef]
Pathogens 12 00296 g001 550
Figure 1. Quantification of TaSP gene using ddPCR and qPCR: The output generated by the (A) qPCR and (B) ddPCR instruments upon the usage of sample DNA at varying concentrations ranging from 0.01 ng to 100 ng, where the ddPCR output is based on the number of positive droplets denoted by blue dots, where each dot represents a droplet. (C) TaSP copies/µL was checked in Theileria infected sample’s DNA at varying concentrations ranging from 100 ng to 0.01 ng through 10-fold dilutions (p-value = 0.002). (D) Coefficient of variance (CV) comparison between ddPCR and qPCR values for copies/µL of TaSP gene.
Figure 1. Quantification of TaSP gene using ddPCR and qPCR: The output generated by the (A) qPCR and (B) ddPCR instruments upon the usage of sample DNA at varying concentrations ranging from 0.01 ng to 100 ng, where the ddPCR output is based on the number of positive droplets denoted by blue dots, where each dot represents a droplet. (C) TaSP copies/µL was checked in Theileria infected sample’s DNA at varying concentrations ranging from 100 ng to 0.01 ng through 10-fold dilutions (p-value = 0.002). (D) Coefficient of variance (CV) comparison between ddPCR and qPCR values for copies/µL of TaSP gene.
Pathogens 12 00296 g001
Pathogens 12 00296 g002 550
Figure 2. Screening of Theileria parasite in clinical bovine samples: (A) The scatter plot represents the copies/µL of TaSP and 18s rRNA in clinical samples (N = 151). (B) Bland-Altman plot comparing the efficiency of ddPCR-based diagnosis in comparison to qPCR across the samples (N = 151). The efficiency of both primers. (C,D) Sensitivity and specificity of TaSP and 18s rRNA primers when used in ddPCR for screening clinical samples.
Figure 2. Screening of Theileria parasite in clinical bovine samples: (A) The scatter plot represents the copies/µL of TaSP and 18s rRNA in clinical samples (N = 151). (B) Bland-Altman plot comparing the efficiency of ddPCR-based diagnosis in comparison to qPCR across the samples (N = 151). The efficiency of both primers. (C,D) Sensitivity and specificity of TaSP and 18s rRNA primers when used in ddPCR for screening clinical samples.
Pathogens 12 00296 g002
Pathogens 12 00296 g003 550
Figure 3. Detection of parasite DNA reduction upon BPQ treatment using ddPCR: (A) B01, B02, and B03 are the Ch1 amplitude of untreated samples while the B04, B05, and B06 are the same as BPQ treated samples. (B) Graph shows TaSP copies/µL in BPQ treated vs. untreated TA cells. Paired t-Test ** p < 0.01 (p-value = 0.0038).
Figure 3. Detection of parasite DNA reduction upon BPQ treatment using ddPCR: (A) B01, B02, and B03 are the Ch1 amplitude of untreated samples while the B04, B05, and B06 are the same as BPQ treated samples. (B) Graph shows TaSP copies/µL in BPQ treated vs. untreated TA cells. Paired t-Test ** p < 0.01 (p-value = 0.0038).
Pathogens 12 00296 g003
Table
Table 1. List of primers utilized for the study.
Table 1. List of primers utilized for the study.
PrimersSequence 5′-3′
Sense TaSP (F)AAACCATTCGTGCCCAAG
Antisense TaSP (R)CAGTCAAACGCTACAGTGA
Sense 18S rRNA (F)ACAGGGAGGTAGTGACAAGA
Antisense 18S rRNA (R)CGCTATTGGAGCCGGAATTA
ProbesSequence 5′-3′
TaSP FAMTCGCAATGTTGTGGATCATACTTCACA
18SRNA HEXTATCAATTGGAGGGCAAGTCTGGTGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Murthy, S.; Suresh, A.; Dandasena, D.; Singh, S.; Subudhi, M.; Bhandari, V.; Bhanot, V.; Arora, J.S.; Sharma, P. Multiplex ddPCR: A Promising Diagnostic Assay for Early Detection and Drug Monitoring in Bovine Theileriosis. Pathogens 2023, 12, 296. https://doi.org/10.3390/pathogens12020296

AMA Style

Murthy S, Suresh A, Dandasena D, Singh S, Subudhi M, Bhandari V, Bhanot V, Arora JS, Sharma P. Multiplex ddPCR: A Promising Diagnostic Assay for Early Detection and Drug Monitoring in Bovine Theileriosis. Pathogens. 2023; 12(2):296. https://doi.org/10.3390/pathogens12020296

Chicago/Turabian Style

Murthy, Shweta, Akash Suresh, Debabrata Dandasena, Sakshi Singh, Madhusmita Subudhi, Vasundhra Bhandari, Vandna Bhanot, Jaspreet Singh Arora, and Paresh Sharma. 2023. "Multiplex ddPCR: A Promising Diagnostic Assay for Early Detection and Drug Monitoring in Bovine Theileriosis" Pathogens 12, no. 2: 296. https://doi.org/10.3390/pathogens12020296

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop