Next Article in Journal
Complete Genome Sequence and Analysis of a ST573 Multidrug-Resistant Methicillin-Resistant Staphylococcus aureus SauR3 Clinical Isolate from Terengganu, Malaysia
Previous Article in Journal
The Global Expansion of LTBI Screening and Treatment Programs: Exploring Gaps in the Supporting Economic Evidence
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 12
Issue 3
10.3390/pathogens12030501
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Synergistic Inhibitory Effect of Honey and Lactobacillus plantarum on Pathogenic Bacteria and Their Promotion of Healing in Infected Wounds

by
Mei Li
1,†,
Hong Xiao
1,†,
Yongmei Su
2,
Danlin Cheng
3,
Yan Jia
1,
Yingli Li
1,
Qi Yin
1,
Jieying Gao
1,
Yong Tang
4,* and
Qunhua Bai
1,*
1
Department of Health Laboratory Technology, School of Public Health, Chongqing Medical University, Chongqing 401334, China
2
Chongqing College of Traditional Chinese Medicine, Chongqing 402760, China
3
The First Clinical School, Chongqing Medical University, Chongqing 400016, China
4
Chongqing Orthopedics Hospital of Traditional Chinese Medicine, Chongqing 400039, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Pathogens 2023, 12(3), 501; https://doi.org/10.3390/pathogens12030501
Submission received: 21 February 2023 / Revised: 14 March 2023 / Accepted: 14 March 2023 / Published: 22 March 2023
(This article belongs to the Section Bacterial Pathogens)
Browse Figures
Versions Notes

Abstract

:
Prevention and control of infections have become a formidable challenge due to the increasing resistance of pathogens to antibiotics. Probiotics have been discovered to have positive effects on the host, and it is well-known that some Lactobacilli are effective in treating and preventing inflammatory and infectious diseases. In this study, we developed an antibacterial formulation consisting of honey and Lactobacillus plantarum (honey–L. plantarum). The optimal formulation of honey (10%) and L. plantarum (1 × 109 CFU/mL) was used to investigate its antimicrobial effect and mechanism in vitro, and its healing effect on wound healing of whole skin infections in rats. Biofilm crystalline violet staining and fluorescent staining results indicated that the honey–L. plantarum formulation prevented the biofilm formation in Staphylococcus aureus and Pseudomonas aeruginosa and increased the number of dead bacteria in the biofilms. Further mechanism studies revealed that the honey–L. plantarum formulation may inhibit biofilm formation by upregulating biofilm-related genes (icaA, icaR, sigB, sarA, and agrA) and downregulating quorum sensing (QS) associated genes (lasI, lasR, rhlI, rhlR, and pqsR). Furthermore, the honey–L. plantarum formulation decreased the number of bacteria in the infected wounds of rats and accelerated the formation of new connective tissue to promote wound healing. Our study suggests that the honey–L. plantarum formulation provides a promising option for the treatment of pathogenic infections and wound healing.

1. Introduction

Bacterial infectious diseases pose a major threat to human health as they cause a significant burden of morbidity and mortality worldwide. Among common infectious diseases, Staphylococcus aureus (S. aureus) and Pseudomonas aeruginosa (P. aeruginosa) are the most common causative organisms detected in chronic wounds [1]. Usually, S. aureus is located on the surface of the infection and P. aeruginosa is located deeper in the infection [2] Because these bacteria have a high level of antibiotic resistance, treating wound infections can be difficult. Additionally, both bacteria produce biofilms, have high resistance to many antimicrobial medications [3,4], and are the leading causes of most chronic infections [5]. Pharmacological treatment for chronic wound infections involves the systemic administration of antibiotics. Still, the development of drug resistance has made more and more antibiotics lose their effectiveness of anti-infection. Various coping strategies have been investigated, particularly drug designs based on synthetic analogs that can inhibit virulence factors. However, these studies have not yielded promising results due to toxicity and low bioavailability. There remains a need to develop alternative therapies to manage wound bacterial infections effectively.
Lactic acid bacteria (LAB), a group of bacteria that use carbohydrates to produce lactic acid, have been used for thousands of years to ferment and preserve food [6]. They naturally control the microbial composition of many foods because these lactic acid bacteria have antagonistic and inhibitory properties by competing for nutrients or producing active antimicrobial metabolites such as organic acids, hydrogen peroxide, acetylacetone, diacetyl, and bacteriocins [7]. Lactobacilli can reduce the risk of infectious diseases, fight secondary infections with antibiotics [8], and reduce antibiotic therapy’s incidence and severity of diarrhea [9]. In addition, most Lactobacilli are generally considered safe by the US Food and Drug Administration [10]. Lactobacillus plantarum (L. plantarum) is one of the typical representatives of lactic acid bacteria, and topical application of L. plantarum has been demonstrated to reduce or eliminate the pathogenic bacterial load, reduce necrotic tissue, accelerate the appearance of granulation tissue, reduce wound area, and promote wound healing [11]. Moreover, topical administration of L. plantarum accelerated the healing of chronic diabetic foot ulcers and infected burn wounds by altering infection, angiogenesis, macrophage phenotype, and neutrophil response [12,13]. It was also found that L. plantarum supernatant has protective effects against bacterial infection, oxidative stress, and wound healing [14,15]. According to the studies mentioned above, probiotics and their metabolites may be able to treat bacteria that are resistant to antibiotics. To combat the significant worldwide danger posed by antimicrobial resistance, future research should be conducted on creating combinations of probiotics and their metabolites, which are promising alternatives to antibiotics to treat drug-resistant bacteria.
For many years, honey has been used as a folk medicine to treat wound infections. Honey’s healing and antimicrobial activity are partly attributed to its hygroscopic properties, high osmotic pressure, low pH, and hydrogen peroxide content [16,17,18]. A Lactobacillus (LAB) symbiotic community of nine Lactobacillus species and four Bifidobacterium species had been discovered in honeybee crops. Interestingly, these Lactobacillus symbionts have a role in the honey formation and are abundant in fresh honey. In addition, it was shown that these symbionts create a variety of extracellular proteins, including enzymes, bacteriocins, and lysozymes, as well as anti-microbial compounds such as formic acid, hydrogen peroxide, and free fatty acids [19,20]. Lactobacillus symbiosis is involved in honey production and plays a vital role in the antimicrobial action of honey by producing numerous antimicrobial metabolites and peptides [20].
Research has been conducted on the mechanisms of probiotic antibacterial action, although these studies have mostly looked at probiotic metabolites and their related active substances, such as bacteriocins [7]. Probiotics can produce metabolites and potent antibacterial capabilities, but little study has been carried out on how they interact with other agents to impact how they inhibit pathogenic bacteria. Although previous studies have reported the combined antibacterial effect of L. plantarum and honey, these studies only focused on single pathogenic bacteria and did not explore the synergistic effect of honey and L. plantarum in more depth and comprehensively. Therefore, in the present study, our main objective was to determine the inhibitory and antibacterial mechanisms of honey and L. plantarum against different species of pathogenic bacteria and their healing effect on infected wounds.
Many cell surface and secreted virulence factors are linked to the development of S. aureus biofilms, and the cell surface virulence factor polysaccharide intercellular adhesion protein (PIA) plays a key role in promoting adhesion contacts between bacterial cells [21,22]. Regulation of ica ADBC expression is mediated by a number of proteins, including sarA and sigB as well as IcaR, and it has been demonstrated that this regulation is necessary for biofilm formation [21,21,23]. Expression of sarA and agr has been shown to play a central role in the regulatory circuit of S. aureus, which includes important but often opposing roles in biofilm formation. It has been shown that acute virulence factors are regulated by bacterial intercellular communication mechanism quorum sensing (QS) systems [24,25,26], which consist of the acyl-homoserine lactone (AHL)-dependent las and rhl systems [27]. Therefore, we will also explore the relationship between the expression of honey–L. plantarum formulation and lasI, lasR, rhlI, rhlR, and pqsR genes.

2. Materials and Methods

2.1. Bacterial Strains and Materials

L. plantarum purchased from the China General Microbial Strain Collection Management Center (CGMCC 1.12974) was seeded in De Man, Rogosa, and Sharpe (MRS) broth and incubated for 24 h at 37 °C in facultative anaerobic conditions. The bacterial culture was centrifuged at 10,000× g for 5 min at 4 °C, and the pellet was washed three times and re-suspended with Phosphate buffer solution (PBS) buffer at pH 7.2 before use. P. aeruginosa strain PAO1, S. aureus, and E. coli were selected as indicator strains and grown in Luria–Bertani (LB) broth overnight at 37 °C with 200 rpm before use. PA01 is a laboratory from the School of Public Health, Chongqing Medical University, China. S. aureus and E. coli are clinical specimens which were isolated from Chongqing Sixth People’s Hospital. The antibiotic resistance profile of P. aeruginosa, S. aureus, and E. coli strains is shown in Supplementary Table S1.
The honey used in this study is bacopa honey, which contains three main types of honey: rape honey, acacia honey, and wattle honey. The honey was sterilized by 25 k Gray Cobalt-source irradiation before use and is free of microbial components.

2.2. Optimal Antibacterial Formulation of Honey and L. plantarum

A multilevel experimental design was used to optimize the honey–L. plantarum formulation. In brief, honey content (X1) and L. plantarum concentration (X2) were set as two independent variables and there were three levels of each variable according to the results of the preliminary pre-experiment (Table 1). When different ratios of honey and L. plantarum acted together with S. aureus (1 × 108 CFU/mL) for 12 h, the viable count of S. aureus (Y) was set as the dependent variable. Experimental trials were performed under all nine possible combinations, with three replicate experiments conducted simultaneously for each combination. Additionally, a blank control (containing only S. aureus, without honey and L. plantarum) was set. SPSS statistics analyzed the results to select the best antibacterial formulation for honey and L. plantarum.

2.3. In Vitro Antibacterial Activity of Honey–L. plantarum Formulation

The vitro antibacterial activity of honey–L. plantarum formulation against S. aureus, P. aeruginosa, and E. coli was evaluated. In brief, the honey–L. plantarum group (HL, pathogens + honey + L. plantarum), negative control (C, Pathogens), L. plantarum control (L, pathogens + L. plantarum), and honey control (H, pathogens + honey) were configured separately. Specifically, cells from overnight cultures were diluted in LB broth to achieve 1 × 108 CFU/mL. Diluted cultures with honey–L. plantarum formulation selected from the previous step were added (1 mL/well) into 24-well microplates and incubated at 37 °C. To obtain these viable culturable indicator cells, samples were collected at 6 h, 12 h, 18 h, and 24 h after incubation and diluted to a suitable concentration with PBS before being seeded on the LB agar plate. The CFU of bacteria on the LB agar plate was counted after being incubated for 24 h at 37 °C.

2.4. Biofilm Formation Inhibition Assay

The antibiofilm potential of honey–L. plantarum formulation was assayed using 24 well microtiter plates as described in a previous study with minor modifications [28]. Briefly, honey–L. plantarum formulation was mixed with S. aureus (5 × 105 CFU/mL) or P. aeruginosa (5 × 105 CFU/mL) in LB broth containing 0.1% glucose (HL). In addition, PBS, L. plantarum, and honey added with the bacterial culture were used as negative controls (S/P), L. plantarum control (L and honey control (H), respectively. Each bacterial solution was added to a 24-well microplate and incubated at 37 °C for 24 h. After incubation, the wells were rinsed twice with PBS to remove planktonic and non-adhering cells. The surface-bound cells were stained with 1 mL of 0.1% crystal violet (CV) solution for 10 min, followed by washing with PBS and destaining with 30% glacial acetic acid. The biofilm biomass was quantified by measuring the intensity of dissolved CV using a spectrophotometer at OD 595 nm by the Enzyme Markers (Thermo Scientific, Waltham, MA, USA).

2.5. Live/Dead Bacterial Staining

The effects were investigated of honey–L. plantarum formulation on biofilms of S. aureus and P. aeruginosa, which were stained with the SYTO9/PI Live/Dead Bacterial Double Stain Kit (MK Bio, Beijing, China). Biofilms were cultured on glass coverslips placed in a 24-well microplate with the honey–L. plantarum formulation. After incubation at 37 °C for 24 h, the biofilm specimens were gently washed twice with PBS to remove planktonic cells. The biofilm was stained for 15 min with the staining solution containing 3 µL of mixed staining solution (1.62 mM SYTO9 and 10 mM PI) in 1000 µL of 0.9% NaCl solution treated in the dark at room temperature for 15 min. Finally, the coverslips were gently fixed on the clean glass slides and observed under a fluorescence microscope (Olympus, Tokyo, Japan). Live bacteria were stained green and dead bacteria were stained red.

2.6. Quantitative Real-Time PCR Analysis

The overnight culture of S. aureus and P. aeruginosa were treated without (S/P) or with L. plantarum (L), honey (H), and honey–L. plantarum formulation (HL) at 37 °C for 24, and the cells were collected by washing three times with sterile PBS. Then, the total RNA was extracted using the Simply P Total RNA Extraction Kit (BioFIux, Beijing, China) according to the manufacturer’s protocol. Then, RNAs were converted to cDNA using PrimeScript™ RT (Takara, Tokyo, Japan). The LightCycler® System (Thermo Scientific, Waltham, MA, USA) was used to analyze the expression of biofilm-related genes for S. aureus (icaA, icaR, sigB, sarA, and agrA) and P. aeruginosa (lasI, lasR, rhlI, rhlR, and pqsR) for P. aeruginosa involved in the quorum sensing (QS) mechanism and biofilm formation. The CR reaction was performed at a predefined ratio using PCR Master Mix (SYBR Green kit, Takara, Japan). The qRT-PCR primers are displayed in Table 2, and the rpoB (S. aureus) and GAPDH (P. aeruginosa) were internal reference genes, as described earlier [29,30]. The relative expression levels were calculated using the relative quantitative (2−ΔΔCt) method [31].

2.7. Changes in the Growth of L. plantarum in the Formulation

In this part, changes in the growth of L. plantarum were evaluated to understand the antimicrobial mechanism of the formulation. The honey–L. plantarum group (HL) and L. plantarum group (L) from the step “Inhibition of S. aureus, P. aeruginosa and E. coli by honey–L. plantarum formulation” were incubated for 24 h. Then, the bacterial solution was diluted with PBS. Next, the diluted solution was coated with MRS agar plates, and the number of L. plantarum was counted after incubation at 37 °C for 24 h. On the other hand, 1 × 109 CFU/mL L. plantarum (L) and 10% honey–L. plantarum (HL) was added to the LB broth medium, and the growth of L. plantarum in it was detected using a Bioscreen Automated Microbial Growth Analyzer (Bioscreen C, Oy Growth Curves AB, Helsinki, Finland).

2.8. Antibacterial Effect of Honey–L. plantarum Culture Supernatant

To further investigate the antibacterial effect of honey–L. plantarum formulation, we tested the growth inhibition of S. aureus and P. aeruginosa by the cell-free supernatant (CFS) of honey–L. plantarum cultures and the effect of honey–L. plantarum on the pH value of the medium. Firstly, 10% honey and 1 × 107 CFU/mL L. plantarum were incubated in an MRS medium at 37 °C for 24 h. Then, the cultures were centrifuged (at 10,000× g, for 5 min at 4 °C) to extract the supernatant, and the pH of the medium was tested with a Mettler Toledo pH Mete. After filtering the supernatant through a 0.22-μm sterile membrane, it was (10–20%, v/v) added to LB containing 1 × 107 CFU/mL of S. aureus or P. aeruginosa and mixed well (HL). Meanwhile, cultured in LB broth, S. aureus or P. aeruginosa were also set as negative controls (C). Finally, the effect of the supernatant on the growth curves of the two bacteria (incubated) was measured at 37 °C for 24 h with a Bioscreen Automated Microbial Growth Analyzer.

2.9. In Vivo Animal Experiment

2.9.1. Wound Infection Model

Eight-week-old male Sprague–Dawley (SD) rats weighing 200 ± 20 g were bought from the Chongqing Medical University’s Animal Experiment Center. Rats were housed singly under standard conditions with food and water ad libitum. The experimental animal handling methods conformed to animal ethics standards and were approved by the Experimental Animal Ethics Committee of Chongqing Medical University.
The specific scheme of the experimental design is shown in Supplementary Figure S1. Twelve adult male Sprague–Dawley rats were randomly divided into two groups, six in each group: the control group (SA) and the treated group (HL). After one week of adaptation, the experiment followed previously reported methods with modifications [32,33]. After being anesthetized with 10% chloral hydrate (300 mg/kg), the back of each rat was shaved, depilated, and washed with 75% ethanol [34,35]. Following that, a circular wound with a diameter of 10 mm was created on the back of each rat, which was subsequently infected with 30 μL S. aureus (1 × 108 CFU/mL). Blank control (PBS) and honey–L. plantarum (HL) was applied to the wounds of the control group (SA) and the treated group (HL) of rats separately after an hour of drying. Afterward, the wounds were covered with commercially available transparent film dressings and secured with medical tape. On the zeroth, first, third, and fifth days, the formulation was changed once a day, and the wound healing was photographed. The rats were euthanized after five days.

2.9.2. Evaluation of the Antibacterial Effect of Honey–L. plantarum Formulation on the Wounds

The rats were euthanized on the 1st and 5th days after treatment to assess the formulation’s antibacterial effect. The skin tissue along the wound edge was collected and homogenized in 1 mL of PBS with a homogenizer. From that, the sample solution was diluted to the optimal concentration, and 100 μL of the diluted solution was placed on the Baird-Parker agar plate. The number of colonies on the Baird-Parker agar plates was counted after 24 h incubation at 37 °C.

2.9.3. Histological Analysis

For histological examination, excised wound skin tissue on days 1, 3, and 5 was fixed in 4% paraformaldehyde for at least 24 h, dehydrated in a graded series of ethanol, followed by xylene, and embedded in paraffin. Tissue sections were obtained from the center of the excised skin tissue and cut into five μm thick sections. Skin sections were stained with hematoxylin and eosin (H&E) to assess granulation tissue formation and wound maturity. Images were acquired using an inverted light microscope (Olympus, Tokyo, Japan).

2.10. Statistical Analysis

All data were analyzed and graphed using SPSS Statistics 25 (Armonk, NY, USA) and Graph Pad Prism 7 software (GraphPad Software, Inc., La Jolla, CA, USA), with quantitative results expressed as mean ± standard error (SEM). Statistical comparisons were performed using a t-test and one-way ANOVA, followed by Tukey’s Multiple Comparison test as the post-hoc test. A significant difference is marked as * (p < 0.05), ** (p < 0.01), *** (p < 0.001) and **** (p < 0.0001).

3. Results

3.1. Optimal Antibacterial Formulation of L. plantarum and Honey to Inhibit S. aureus

Previous experimental results suggest that there may be a synergistic antibacterial effect of L. plantarum and honey on S. aureus. To find the optimal antibacterial formulation of L. plantarum and honey, a two-factor, three-level analysis factor design experimental protocol was designed to determine the optimal concentration of L. plantarum and honey against S. aureus. As represented in Table 3, by analysis of variance, the main effects (H and L) show the inhibition of S. aureus by different concentrations of honey and L. plantarum. In contrast, the interaction term (X12) shows how the response changed when the concentrations of honey and L. plantarum were varied simultaneously. The result showed that there was an interaction between honey (H) and L. plantarum (L) (interaction term: H × L, p < 0.0001). Therefore, the antibacterial effect of honey and L. plantarum against pathogenic bacteria is mainly considered by the interaction between the two. Table 4 demonstrates that when the honey concentration in the formulation was 10% and the L. plantarum concentration was 1 × 109 CFU/mL, S. aureus growth was the least (had the maximum inhibition rate), indicating that this formula has the best effect on suppressing the growth of S. aureus.

3.2. Honey–L. plantarum Formulation Inhibited the Growth of S. aureus, P. aeruginosa, and E. coli

Based on the results of pre-experiments, we hypothesized that honey and L. plantarum have a synergistic inhibitory effect on S. aureus. We tested the formulation’s ability to inhibit the growth of S. aureus, P. aeruginosa, and E. coli from understanding better the antibacterial activity of this formulation against pathogenic bacteria. The results are depicted in Figure 1a–c, where the honey–L. plantarum formulation can be seen after 12 h of interaction to have significantly inhibited the growth of these three bacteria. Moreover, of these bacteria, honey alone inhibited only S. aureus, with no effect on P. aeruginosa and E. coli. This again suggests that honey and L. plantarum have a synergistic antibacterial effect. Moreover, this antibacterial effect became stronger when the honey–L. plantarum formulation acted on these pathogenic bacteria longer. When the duration of action reached 24 h, the growth inhibition of S. aureus, P. aeruginosa, and E. coli by honey–L. plantarum formulation could reach more than 80% (Figure 1d).

3.3. Honey–L. plantarum Formulation Inhibited the Biofilm Formation of S. aureus and P. aeruginosa

To investigate whether the honey–L. plantarum formulation affects the biofilm formation of pathogenic bacteria, we measured the biofilm expression of S. aureus and P. aeruginosa. As shown in Figure 2, L. plantarum alone did not inhibit the biofilm formation of S. aureus. In contrast, honey and L. plantarum alone can inhibit the biofilm formation of P. aeruginosa, respectively. However, when honey and L. plantarum were combined, the inhibitory effect on biofilm formation was much better (p < 0.01). After the honey–L. plantarum formulation was added to the culture system for 24 h, the biofilm formation of S. aureus and P. aeruginosa were inhibited to 70% and 80%, respectively (Figure 2c). This indicates that honey and L. plantarum have a synergistic inhibitory effect on bacterial biofilm formation, which is consistent with the previous results that these two components synergistically inhibit the growth of these bacteria.
A fluorescence microscope was applied to visualize the live and dead cells of the biofilms of S. aureus and P. aeruginosa. As shown in Figure 3, the living cells were labeled with SYTO9 (green fluorescence), whereas dead cells were stained with propidium iodide (red fluorescence). In the absence of the honey–L. plantarum formulation, the living cells appeared to be relatively intensive, and only a few dead cells could be observed in S. aureus and P. aeruginosa biofilms (C). Moreover, with L. plantarum treatment alone, the activity of the biofilm cells did not change, which could be observed by the increase in living cells and the few dead cells (L). However, many dead cells appeared in the field of vision when the biofilms were treated with honey alone (H) and honey–L. plantarum formulation (HL).

3.4. Honey–L. plantarum Formulation Increased the Transcription Level of icaA, icaR, sigB, sarA, and agrA, and Decreased the Transcription Level of lasI, lasR, rhlI, rhlR, and pqsR

To evaluate the effect of honey–L. plantarum formulation on S. aureus and P. aeruginosa at the molecular level, candidate genes expression analysis (involved in biofilm formation and virulence production) was performed by real-time PCR. In contrast to the controls of untreated (S) and L. plantarum treated (L), Figure 4 shows that the honey–L. plantarum formulation treatment upregulated the expression level of biofilm regulation-related genes (icaA, icaR, sarA, agrA, and sigB) for S. aureus (p < 0.05). However, after honey treatment (H) and honey–L. plantarum formulation treatment (HL), relative expression of the five critical QS-regulated genes (lasI, lasR, rhlI, rhlR, and pqsR) for P. aeruginosa were downregulated (Figure 5).

3.5. The Synergistic Antibacterial Activity of Honey–L. plantarum Formulation May Depend on the Honey Promotion Growth of L. plantarum

We sought to evaluate whether the synergistic antibacterial activity of honey–L. plantarum originates from the fact that honey has a promotive effect on the growth activity of L. plantarum. Thus, we first tested if the honey can promote the growth of L. plantarum and assayed the changes in the number of viable L. plantarum bacteria in the above antibacterial activity test. It showed that (Figure 6a) when there was no honey in the system (L) during the trial of the formulation’s inhibitory effect against S. aureus, the viable count of L. plantarum reduced by roughly 2% from the original level (L0). In contrast, the number increased by about 2% when honey was added to the cultures (HL), which showed that adding honey stimulated the growth of L. plantarum during the incubation. Then, the growth curves of L. plantarum alone and with honey in LB were further evaluated to investigate the growth-promoting effect of honey on L. plantarum. The experimental results showed that L. plantarum did not grow in the LB broth alone but grew and multiplied when co-cultured with honey (Figure 6b).
To find out if the metabolites of L. plantarum were antimicrobial, we also analyzed the honey–L. plantarum culture supernatant’s ability to inhibit S. aureus and P. aeruginosa growth, and we assessed the acid generation of L. plantarum. The results showed that honey–L. plantarum culture supernatant has an apparent inhibitory effect on S. aureus and P. aeruginosa. By measuring the growth curves of the two bacteria, as shown in Figure 6c, we found that 10% of honey–L. plantarum culture supernatant could significantly inhibit the growth of S. aureus and P. aeruginosa, and when the supernatant content reached 20%, it could completely inhibit the growth of both bacteria. Furthermore, we discovered that L. plantarum thrived in MRS medium for 24 h with a significant pH reduction in the medium, even if the pH reduction in the medium did not change noticeably when honey was present from that of L. plantarum alone (Figure 6d).

3.6. Honey–L. plantarum Formulation Promoted Wound Healing in Rats with Infections

Infection of the wound by pathogenic bacteria can worsen the wound and slow its healing. For the viable count in the tissue around the wound (Figure 7a), after 5 days of continuous application of honey–L. plantarum formulation to the infected wound, the bacterial count in the honey–L. plantarum formulation group (HL) was about 0.7 log units less than that in the infected control group (SA). Moreover, the wound re-epithelialization and tissue granulation formation were assessed by H&E staining further to evaluate the wound healing effect of the honey–L. plantarum formulation. As shown in Figure 7b,c, many inflammatory cells were visible in the tissues of both the control and the treated groups 1 day after treatment. On the third day after treatment, a complete crust was formed on the wound surface in the treated group, with active growth of new connective tissue under the crust and less inflammatory exudation. In contrast, the control group’s inflammatory exudate and inflammatory damage were broader and more profound. On the fifth day, the new connective tissue in the treated group was quite active, and the wound had significantly decreased, meaning the wound was essentially healed. Though the wounds were covered in the control group, it was not easy to see the new connective tissue.

4. Discussion

Probiotic-derived biologics, such as organic acids, antimicrobial peptides, extracellular polysaccharides, and biosurfactants, have antibacterial and antibiotic film potential against many pathogens, such as S. aureus, P. aeruginosa, and Salmonella enterica [36,37,38]. Moreover, honey has antibacterial and anti-biofilm activity against S. aureus and P. aeruginosa [39,40]. Therefore, this study tried to shed light on the synergistic effect of L. plantarum and honey on pathogenic bacteria and the healing impact on infected wounds. Honey is considered a potential prebiotic due to its richness in oligosaccharides, and it has been shown that honey oligosaccharides can promote the growth of Lactobacillus and Bifidobacterium. In the present study, L. plantarum alone affected the growth of S. aureus, P. aeruginosa, and E. coli. Still, the combination of honey and L. plantarum significantly hurt pathogenic bacteria’s reproduction and biofilm formation.
Probiotics not only inhibit the activity of pathogenic bacteria and their adhesion to surfaces, but they also prevent the formation and survival of pathogenic biofilms, interfere with biofilm integrity, and eventually lead to biofilm eradication [41]. It has been shown that L. plantarum can inhibit the formation of pathogenic bacterial biofilms on catheters when applied to catheters [42]. To verify the effects of honey–L. plantarum formulation in inhibiting biofilm formation, both absorbance measurements and microscopic observations were performed. The crystal violet staining results showed that honey–L. plantarum formulation inhibited S. aureus and P. aeruginosa biofilm formation, and mature biofilms were also destroyed (Figure 2a,b). This was also confirmed in the fluorescence microscope, where we found that the honey–L. plantarum formulation effectively decreased the number of viable cells, increased the dead cell counts, and destroyed the dense and complete structure of the biofilm. Similarly, a recent study described that metabolites of L. plantarum inhibited the Bacillus licheniformis biofilm development by reducing live/dead cell counts, metabolic activity, and EPS content of biofilm adhered on stainless steel and glass surfaces [43].
Biofilm formation is an important factor affecting bacteria drug resistance. Studies have found that the expression of ica, sarA, and agr genes can regulate the secretion of virulence factors and the formation of biofilms in S. aureus. The biofilm distribution of S. aureus is mainly controlled by the agr genes, which can enhance biofilm dispersion and inhibit biofilm formation when strongly expressed. sarA is a global regulatory protein that affects the expression of many genes in S. aureus, including many involved in pathogenesis, making sarA a major virulence factor. sarA expression has consistently been shown to promote biofilm formation in S. aureus and S. epidermidis [44]. The agr system is normally involved in the transition from cell surface protein synthesis during exponential growth to the transition from toxin and degradation protein synthesis during the post-exponential to stable growth phase. The agr expression can reduce the ability of S. aureus to form biofilms [45]. In a recent study, sarA and agrA gene expression was downregulated in S. aureus after treatment with oxalic acid [46]. Similarly, icaA, sarA, and sigB expression levels were all downregulated, and icaR expression levels, a negative regulator of icaA, were upregulated after treatment of S. aureus with Ginkgo biloba exfoliating extract [23,29]. In the present study, the biofilm formation of S. aureus was significantly reduced and biofilm-related gene (icrR, icrA, sarA, and agrA) expression was upregulated after the honey–L. plantarum formulation treatment. Noteworthy is that our experiment showed an upregulation of transcription factor sigB gene expression (Figure 4e), which is in contrast to the current findings, even though the majority of research indicates that downregulation of the sigB can limit biofilm formation [29] We speculate that the interaction of honey with L. plantarum may have increased the abnormal expression of this gene, and the exact mechanism needs to be further explored and studied.
Additionally, a mechanism that enables microbial communication is called quorum sensing (QS). The primary function of QS is the regulation of critical cellular functions such as the production of virulence factors or the formation of biofilms [47]. There are many ways to inhibit the QS system, and the critical QS-related genes include lasI, lasR, rhlI, rhlR, and pqsR. In this study, we examined the relationship between the expression of QS-related genes and the formation of biofilms. The expression of lasI, lasR, rhlI, rhlR, and pqsR in P. aeruginosa considerably decreased after treatment with honey–L. plantarum formulation, which was consistent with the earlier finding [30,48]. Moreover, we discovered that although L. plantarum alone affected the expression of specific genes, including the upregulated lasI gene (Figure 5b) and downregulated rhlR gene (Figure 5c), the expression levels of these genes were all decreased when L. plantarum interacted with honey, which was in accordance with our expectations and crystalline violet staining experiments. Furthermore, there was no observable difference in gene expression levels between samples treated with honey alone (H) and those treated with honey–L. plantarum formulation (HL). This is likely because the interaction between L. plantarum and honey did not lead to the expected reduction in gene expression levels. After treatment with the honey–L. plantarum formulation, it is likely that the expression levels of these genes in P. aeruginosa biofilms decreased. Since this has crucial scientific significance for exploring the specific mechanisms by which the honey–L. plantarum formulation inhibited the formation of biofilms, more experimental confirmation is required.
A related investigation discovered that L. plantarum culture supernatants (CFSs) contain high levels of lactic acid, which is crucial for antibacterial and anti-biofilm resistances [13,49]. The production of extracellular proteases, cell surface hydrophobicity, EPS production, and hemolysis in Streptococcus pyogenes were found to be modulated by L. plantarum cell-free supernatants in a study on the anti-biofilm and anti-virulence of L. plantarum against Streptococcus pyogenes. The reduction in cell surface hydrophobicity affects the initial adhesion step, which is critical to the biofilm formation cascade and is considered to be the main cause of biofilm inhibition [50]. Interestingly, a recent study found that the cell-free supernatant extract of Bifidobacterium thuringiensis contained various compounds structurally similar to known anti-biofilm compounds, such as squalene, cinnamic acid derivatives, and eicosapentaene, with synergistic effects on S. aureus biofilms [51]. Such findings indicate that the antimicrobial effect of L. plantarum cell-free supernatant is mainly derived from the production of key antimicrobial and anti-biofilm substances by L. plantarum itself.
The primary mechanism of probiotic bacteria to inhibit pathogens through the production of some substances such as organic acids, hydrogen peroxide, low molecular weight antimicrobial substances, and bacteriocins has been investigated [52]. L. plantarum had strong metabolic activity and significantly inhibited the growth of pathogenic bacteria during co-cultivation with Salmonella typhimurium. The mechanism of action may be related to the lowering of the pH value of the medium by L. plantarum [53]. In this investigation, honey served as a good carbon source for the growth and reproduction of L. plantarum (Figure 6a,b). The greater quantity of L. plantarum increases the possibility of co-aggregation, which allows bacteria to aggregate and produce essential metabolic products such as organic acids, lowering the pH of the medium to more effectively exert its antibacterial effect (Figure 6d).
Furthermore, probiotics have an active role in preventing and healing infected wounds [54]. They interfere with the wound healing process by affecting collagen synthesis, amplifying the expression of tight junction proteins, enhancing the migration of keratin-forming cells, and stimulating proliferation. On the other hand, honey can not only treat bacterial infections but also work as a good wound dressing because of its antibacterial qualities brought on by the creation of hydrogen peroxide by the enzyme glucose oxidase in honey. Thus, we chose honey as one of the media in our antimicrobial formulation to assist L. plantarum in healing infected wounds. Our results confirmed the effective part of honey–L. plantarum in infected wounds in rats. Moreover, L. plantarum grew and multiplied in large numbers with the assistance of honey (Figure 6b), which may reduce the risk of pathogen adhesion to wound cells or the replacement of pathogens.
Local wound infections can significantly affect healing because bacteria prolong the inflammation and interfere with the epithelial formation, contraction, and collagen deposition [55]. During the inflammatory phase of wound healing, neutrophils and macrophages enter the wound site to release and secrete large amounts of enzymes and cytokines to remove and digest invading bacteria and cellular debris to prevent infection [56]. In the group treated with the honey–L. plantarum formulation, the number of bacteria in the wound tissue was significantly reduced. Moreover, in the pre-healing phase, inflammatory cells increased dramatically, indicating that the honey–L. plantarum formulation could regulate the number of inflammatory cells in the wound area and reduce the negative effect of wound infection on healing. Skin tissue repair aims to restore the barrier function of the skin, for which granulation tissue is required to replace the defect to form new connective tissue and epithelial wound closure is necessary to restore the physical barrier [57]. In our histological results, scar remodeling at the neoplastic epithelium was achieved by significant accumulation and thickening of granulation tissue after epithelial wound closure, starting from an early phase dominated by inflammation. The healing process in the honey–L. plantarum formula treatment group followed the mentioned pattern. These results indicate that the honey–L. plantarum formulation effectively promoted wound healing in infected rats, confirming its positive role in treating infected wounds.
Based on the expression levels of quorum sensing key regulatory genes and biofilm-related genes, the possible mechanism of inhibition of biofilm formation by honey–L. plantarum formulation was deduced (Figure 8). The proposed graphical model is only a schematic and the exact role of the formula in the gene regulation mechanism needs further study.

5. Conclusions

In conclusion, in our study, the honey–L. plantarum formulation was used to investigate its antibacterial effect and mechanism against pathogenic bacteria and applied to a rat wound infection model. The formulation exhibited effective antibacterial activity in vivo and in vitro, and qRT-PCR results suggested that the honey–L. plantarum formulation may inhibit biofilm formation by regulating some genes related to biofilm formation. Importantly, this formulation could not only control pathogenic bacterial infections but also promote wound healing, playing a potential role in treating clinically relevant bacterial infections. Therefore, this study will provide a new practical reference for the clinical treatment of pathogenic bacterial infections, the promotion of wound healing, and changes in the management of pathogenic bacteria.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pathogens12030501/s1, Figure S1: Scheme of the experimental design; Table S1: Antibiotic resistance in S. aureus, P. aeruginosa and E. coli [58].

Author Contributions

Conceptualization, M.L., H.X. and Q.Y.; methodology, H.X., Y.S., Q.Y., Y.L. and Y.J.; software, Y.T., D.C. and J.G.; validation, M.L. and Y.T.; formal analysis, M.L. and H.X.; resources, H.X. and Y.T.; data curation, H.X.; writing—original draft preparation, M.L.; writing—review and editing, M.L. and Q.B.; visualization, H.X.; supervision, Y.T. and Q.B.; project administration, Y.T. and Q.B.; and funding acquisition, H.X., Y.T. and Q.B. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Chongqing Yuzhong Nature Science Foundation (Grant Number 20190146), the Scientific Research and Innovation Experiment Program for College Students of Chongqing Medical University (Grant Number SRIEP202120), and Chongqing Science and Health Joint Traditional Chinese Medicine Technology Innovation and Application Development Project [Grant Number 2020ZY023699] of China.

Institutional Review Board Statement

The animal study protocol was approved by the Experimental Animal Ethics Committee of Chongqing Medical University, Chongqing, China (approval number was IACUC-CQMU-2023-01013).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Acknowledgments

We are grateful to researcher Qi Yin (Chongqing medical university, China) for providing Pseudomonas aeruginosa and Chongqing Sixth People’s Hospital for providing Staphylococcus aureus and Escherichia coli.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Serra, R.; Grande, R.; Butrico, L.; Rossi, A.; Settimio, U.F.; Caroleo, B.; Amato, B.; Gallelli, L.; de Franciscis, S. Chronic wound infections: The role of Pseudomonas aeruginosa and Staphylococcus aureus. Expert Rev. Anti-Infect. Ther. 2015, 13, 605–613. [Google Scholar] [CrossRef]
  2. Fazli, M.; Bjarnsholt, T.; Kirketerp-Møller, K.; Jørgensen, B.; Andersen, A.S.; Krogfelt, K.A.; Givskov, M.; Tolker-Nielsen, T. Nonrandom distribution of Pseudomonas aeruginosa and Staphylococcus aureus in chronic wounds. J. Clin. Microbiol. 2009, 47, 4084–4089. [Google Scholar] [CrossRef] [Green Version]
  3. Wolcott, R.D.; Rhoads, D.D. A study of biofilm-based wound management in subjects with critical limb ischaemia. J. Wound Care 2008, 17, 145–155. [Google Scholar] [CrossRef] [PubMed]
  4. Khan, M.S.A.; Ahmad, I. Antibiofilm activity of certain phytocompounds and their synergy with fluconazole against Candida albicans biofilms. J. Antimicrob. Chemother. 2012, 67, 618–621. [Google Scholar] [CrossRef] [Green Version]
  5. Lewis, K. Riddle of biofilm resistance. Antimicrob. Agents Chemother. 2001, 45, 999–1007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Niaz, T.; Shabbir, S.; Noor, T.; Imran, M.J.L. Antimicrobial and antibiofilm potential of bacteriocin loaded nano-vesicles functionalized with rhamnolipids against foodborne pathogens. LWT 2019, 116, 108583. [Google Scholar] [CrossRef]
  7. Furtado, D.N.; Favaro, L.; Nero, L.A.; de Melo Franco, B.D.G.; Todorov, S.D.J.P.; proteins, a. Nisin production by Enterococcus hirae DF105Mi isolated from Brazilian goat milk. Probiotics Antimicrob. Proteins 2019, 11, 1391–1402. [Google Scholar] [CrossRef]
  8. King, S.; Glanville, J.; Sanders, M.E.; Fitzgerald, A.; Varley, D. Effectiveness of probiotics on the duration of illness in healthy children and adults who develop common acute respiratory infectious conditions: A systematic review and meta-analysis. Br. J. Nutr. 2014, 112, 41–54. [Google Scholar] [CrossRef] [PubMed]
  9. Hempel, S.; Newberry, S.J.; Maher, A.R.; Wang, Z.; Miles, J.N.V.; Shanman, R.; Johnsen, B.; Shekelle, P.G. Probiotics for the prevention and treatment of antibiotic-associated diarrhea: A systematic review and meta-analysis. JAMA 2012, 307, 1959–1969. [Google Scholar] [CrossRef] [Green Version]
  10. Fusieger, A.; Perin, L.M.; Teixeira, C.G.; de Carvalho, A.F.; Nero, L.A.J.A.v.L. The ability of Lactococcus lactis subsp. lactis bv. diacetylactis strains in producing nisin. Antonie Van Leeuwenhoek 2020, 113, 651–662. [Google Scholar] [CrossRef] [PubMed]
  11. Peral, M.C.; Rachid, M.M.; Gobbato, N.M.; Huaman Martinez, M.A.; Valdez, J.C. Interleukin-8 production by polymorphonuclear leukocytes from patients with chronic infected leg ulcers treated with Lactobacillus plantarum. Clin. Microbiol. Infect. 2010, 16, 281–286. [Google Scholar] [CrossRef] [Green Version]
  12. Argañaraz Aybar, J.N.; Ortiz Mayor, S.; Olea, L.; Garcia, J.J.; Nisoria, S.; Kolling, Y.; Melian, C.; Rachid, M.; Torres Dimani, R.; Werenitzky, C.; et al. Topical Administration of Accelerates the Healing of Chronic Diabetic Foot Ulcers through Modifications of Infection, Angiogenesis, Macrophage Phenotype and Neutrophil Response. Microorganisms 2022, 10, 634. [Google Scholar] [CrossRef]
  13. Moraffah, F.; Kiani, M.; Abdollahi, M.; Yoosefi, S.; Vatanara, A.; Samadi, N. In Vitro-In Vivo Correlation for the Antibacterial Effect of Lactiplantibacillus plantarum as a Topical Healer for Infected Burn Wound. Probiotics Antimicrob. Proteins 2022, 14, 675–689. [Google Scholar] [CrossRef]
  14. Dubey, A.K.; Podia, M.; Priyanka; Raut, S.; Singh, S.; Pinnaka, A.K.; Khatri, N. Insight Into the Beneficial Role of Supernatant Against Bacterial Infections, Oxidative Stress, and Wound Healing in A549 Cells and BALB/c Mice. Front. Pharm. 2021, 12, 728614. [Google Scholar] [CrossRef]
  15. Ong, J.S.; Taylor, T.D.; Yong, C.C.; Khoo, B.Y.; Sasidharan, S.; Choi, S.B.; Ohno, H.; Liong, M.T. Lactobacillus plantarum USM8613 Aids in Wound Healing and Suppresses Staphylococcus aureus Infection at Wound Sites. Probiotics Antimicrob. Proteins 2020, 12, 125–137. [Google Scholar] [CrossRef] [PubMed]
  16. Gulfraz, M.; Iftikhar, F.; Imran, M.; Zeenat, A.; Asif, S.; Shah, I. Compositional analysis and antimicrobial activity of various honey types of Pakistan. Int. J. Food Sci. Tech. 2011, 46, 263–267. [Google Scholar] [CrossRef]
  17. El-Kased, R.F.; Amer, R.I.; Attia, D.; Elmazar, M.M. Honey-based hydrogel: In vitro and comparative In vivo evaluation for burn wound healing. Sci. Rep. 2017, 7, 9692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Alvarez-Suarez, J.M.; Gasparrini, M.; Forbes-Hernández, T.Y.; Mazzoni, L.; Giampieri, F. The Composition and Biological Activity of Honey: A Focus on Manuka Honey. Foods 2014, 3, 420–432. [Google Scholar] [CrossRef] [Green Version]
  19. Vasquez, A.; Forsgren, E.; Fries, I.; Paxton, R.J.; Flaberg, E.; Szekely, L.; Olofsson, T.C. Symbionts as major modulators of insect health: Lactic acid bacteria and honeybees. PLoS ONE 2012, 7, e33188. [Google Scholar] [CrossRef]
  20. Butler, E.; Alsterfjord, M.; Olofsson, T.C.; Karlsson, C.; Malmstrom, J.; Vasquez, A. Proteins of novel lactic acid bacteria from Apis mellifera mellifera: An insight into the production of known extra-cellular proteins during microbial stress. BMC Microbiol. 2013, 13, 235. [Google Scholar] [CrossRef] [Green Version]
  21. Selvaraj, A.; Jayasree, T.; Valliammai, A.; Pandian, S.K. Myrtenol Attenuates MRSA Biofilm and Virulence by Suppressing sarA Expression Dynamism. Front. Microbiol. 2019, 10, 2027. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Ahmadrajabi, R.; Layegh-Khavidaki, S.; Kalantar-Neyestanaki, D.; Fasihi, Y. Molecular analysis of immune evasion cluster (IEC) genes and intercellular adhesion gene cluster (ICA) among methicillin-resistant and methicillin-sensitive isolates of Staphylococcus aureus. J. Prev. Med. Hyg. 2017, 58, E308–E314. [Google Scholar] [CrossRef] [PubMed]
  23. Cue, D.; Lei, M.G.; Lee, C.Y. Genetic regulation of the intercellular adhesion locus in staphylococci. Front. Cell Infect. Microbiol. 2012, 2, 38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Yeung, A.T.Y.; Parayno, A.; Hancock, R.E.W. Mucin promotes rapid surface motility in Pseudomonas aeruginosa. mBio 2012, 3, e00073-12. [Google Scholar] [CrossRef] [Green Version]
  25. Williams, P.; Cámara, M. Quorum sensing and environmental adaptation in Pseudomonas aeruginosa: A tale of regulatory networks and multifunctional signal molecules. Curr. Opin. Microbiol. 2009, 12, 182–191. [Google Scholar] [CrossRef]
  26. Balasubramanian, D.; Schneper, L.; Kumari, H.; Mathee, K. A dynamic and intricate regulatory network determines Pseudomonas aeruginosa virulence. Nucleic Acids Res. 2013, 41, 1–20. [Google Scholar] [CrossRef] [PubMed]
  27. de Kievit, T.R.; Iglewski, B.H. Bacterial quorum sensing in pathogenic relationships. Infect. Immun. 2000, 68, 4839–4849. [Google Scholar] [CrossRef] [Green Version]
  28. Vijayakumar, K.; Bharathidasan, V.; Manigandan, V.; Jeyapragash, D. Quebrachitol inhibits biofilm formation and virulence production against methicillin-resistant Staphylococcus aureus. Microb. Pathog. 2020, 149, 104286. [Google Scholar] [CrossRef] [PubMed]
  29. Wang, B.; Wei, P.W.; Wan, S.; Yao, Y.; Song, C.R.; Song, P.P.; Xu, G.B.; Hu, Z.Q.; Zeng, Z.; Wang, C.; et al. Ginkgo biloba exocarp extracts inhibit S. aureus and MRSA by disrupting biofilms and affecting gene expression. J. Ethnopharmacol. 2021, 271, 113895. [Google Scholar] [CrossRef]
  30. Shi, N.; Gao, Y.; Yin, D.; Song, Y.; Kang, J.; Li, X.; Zhang, Z.; Feng, X.; Duan, J. The effect of the sub-minimal inhibitory concentration and the concentrations within resistant mutation window of ciprofloxacin on MIC, swimming motility and biofilm formation of Pseudomonas aeruginosa. Microb. Pathog. 2019, 137, 103765. [Google Scholar] [CrossRef]
  31. Kot, B.; Sytykiewicz, H.; Sprawka, I. Expression of the Biofilm-Associated Genes in Methicillin-Resistant Staphylococcus aureus in Biofilm and Planktonic Conditions. Int. J. Mol. Sci. 2018, 19, 3487. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Haidari, H.; Bright, R.; Strudwick, X.L.; Garg, S.; Vasilev, K.; Cowin, A.J.; Kopecki, Z. Multifunctional ultrasmall AgNP hydrogel accelerates healing of S. aureus infected wounds. Acta Biomater. 2021, 128, 420–434. [Google Scholar] [CrossRef]
  33. Khezri, K.; Farahpour, M.R.; Mounesi Rad, S. Accelerated infected wound healing by topical application of encapsulated Rosemary essential oil into nanostructured lipid carriers. Artif. Cells Nanomed Biotechnol. 2019, 47, 980–988. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Liu, W.; Ou-Yang, W.; Zhang, C.; Wang, Q.; Pan, X.; Huang, P.; Zhang, C.; Li, Y.; Kong, D.; Wang, W. Synthetic Polymeric Antibacterial Hydrogel for Methicillin-Resistant Infected Wound Healing: Nanoantimicrobial Self-Assembly, Drug- and Cytokine-Free Strategy. ACS Nano 2020, 14, 12905–12917. [Google Scholar] [CrossRef] [PubMed]
  35. Yan, X.; Fang, W.W.; Xue, J.; Sun, T.C.; Dong, L.; Zha, Z.; Qian, H.; Song, Y.H.; Zhang, M.; Gong, X.; et al. Thermoresponsive in Situ Forming Hydrogel with Sol-Gel Irreversibility for Effective Methicillin-Resistant Staphylococcus aureus Infected Wound Healing. ACS Nano 2019, 13, 10074–10084. [Google Scholar] [CrossRef] [PubMed]
  36. Squarzanti, D.F.; Zanetta, P.; Ormelli, M.; Manfredi, M.; Barberis, E.; Vanella, V.V.; Amoruso, A.; Pane, M.; Azzimonti, B. An animal derivative-free medium enhances Lactobacillus johnsonii LJO02 supernatant selective efficacy against the methicillin (oxacillin)-resistant Staphylococcus aureus virulence through key-metabolites. Sci. Rep. 2022, 12, 8666. [Google Scholar] [CrossRef] [PubMed]
  37. Fredua-Agyeman, M.; Gaisford, S. Assessing inhibitory activity of probiotic culture supernatants against Pseudomonas aeruginosa: A comparative methodology between agar diffusion, broth culture and microcalorimetry. World J. Microbiol. Biotechnol. 2019, 35, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Mariam, S.H.; Zegeye, N.; Tariku, T.; Andargie, E.; Endalafer, N.; Aseffa, A. Potential of cell-free supernatants from cultures of selected lactic acid bacteria and yeast obtained from local fermented foods as inhibitors of Listeria monocytogenes, Salmonella spp. and Staphylococcus aureus. BMC Res. Notes 2014, 7, 606. [Google Scholar] [CrossRef] [Green Version]
  39. Alandejani, T.; Marsan, J.; Ferris, W.; Slinger, R.; Chan, F. Effectiveness of honey on Staphylococcus aureus and Pseudomonas aeruginosa biofilms. Otolaryngol. Head Neck Surg. 2009, 141, 114–118. [Google Scholar] [CrossRef]
  40. Danilova, T.A.; Adzhieva, A.A.; Danilina, G.A.; Polyakov, N.B.; Soloviev, A.I.; Zhukhovitsky, V.G. Antimicrobial Activity of Supernatant of Lactobacillus plantarum against Pathogenic Microorganisms. Bull Exp. Biol. Med. 2019, 167, 751–754. [Google Scholar] [CrossRef]
  41. Barzegari, A.; Kheyrolahzadeh, K.; Hosseiniyan Khatibi, S.M.; Sharifi, S.; Memar, M.Y.; Zununi Vahed, S. The Battle of Probiotics and Their Derivatives Against Biofilms. Infect. Drug Resist. 2020, 13, 659–672. [Google Scholar] [CrossRef] [Green Version]
  42. Mekky, A.F.; Hassanein, W.A.; Reda, F.M.; Elsayed, H.M. Anti-biofilm potential of Lactobacillus plantarum Y3 culture and its cell-free supernatant against multidrug-resistant uropathogen Escherichia coli U12. Saudi J. Biol. Sci. 2022, 29, 2989–2997. [Google Scholar] [CrossRef] [PubMed]
  43. Wang, N.; Yuan, L.; Sadiq, F.A.; He, G. Inhibitory effect of Lactobacillus plantarum metabolites against biofilm formation by Bacillus licheniformis isolated from milk powder products. Food Control 2019, 106, 106721. [Google Scholar] [CrossRef]
  44. Kong, K.F.; Vuong, C.; Otto, M. Staphylococcus quorum sensing in biofilm formation and infection. Int. J. Med. Microbiol. IJMM 2006, 296, 133–139. [Google Scholar] [CrossRef] [PubMed]
  45. Beenken, K.E.; Mrak, L.N.; Griffin, L.M.; Zielinska, A.K.; Shaw, L.N.; Rice, K.C.; Horswill, A.R.; Bayles, K.W.; Smeltzer, M.S. Epistatic relationships between sarA and agr in Staphylococcus aureus biofilm formation. PLoS ONE 2010, 5, e10790. [Google Scholar] [CrossRef] [Green Version]
  46. Karuppiah, V.; Seralathan, M. Quorum sensing inhibitory potential of vaccenic acid against Chromobacterium violaceum and methicillin-resistant Staphylococcus aureus. World J. Microbiol. Biotechnol. 2022, 38, 146. [Google Scholar] [CrossRef] [PubMed]
  47. Paluch, E.; Rewak-Soroczyńska, J.; Jędrusik, I.; Mazurkiewicz, E.; Jermakow, K. Prevention of biofilm formation by quorum quenching. Appl. Microbiol. Biotechnol. 2020, 104, 1871–1881. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Hnamte, S.; Parasuraman, P.; Ranganathan, S.; Ampasala, D.R.; Reddy, D.; Kumavath, R.N.; Suchiang, K.; Mohanty, S.K.; Busi, S. Mosloflavone attenuates the quorum sensing controlled virulence phenotypes and biofilm formation in Pseudomonas aeruginosa PAO1: In vitro, in vivo and in silico approach. Microb. Pathog. 2019, 131, 128–134. [Google Scholar] [CrossRef] [PubMed]
  49. das Neves Selis, N.; de Oliveira, H.B.M.; Leão, H.F.; Dos Anjos, Y.B.; Sampaio, B.A.; Correia, T.M.L.; Almeida, C.F.; Pena, L.S.C.; Reis, M.M.; Brito, T.L.S.; et al. Lactiplantibacillus plantarum strains isolated from spontaneously fermented cocoa exhibit potential probiotic properties against Gardnerella vaginalis and Neisseria gonorrhoeae. BMC Microbiol. 2021, 21, 198. [Google Scholar] [CrossRef]
  50. Rather, I.A.; Wani, M.Y.; Kamli, M.R.; Sabir, J.S.M.; Hakeem, K.R.; Firoz, A.; Park, Y.H.; Hor, Y.Y. Lactiplantibacillus plantarum KAU007 Extract Modulates Critical Virulence Attributes and Biofilm Formation in Sinusitis Causing Streptococcus pyogenes. Pharmaceutics 2022, 14, 2702. [Google Scholar] [CrossRef]
  51. Ray, S.; Jin, J.O.; Choi, I.; Kim, M. Cell-Free Supernatant of Bacillus thuringiensis Displays Anti-Biofilm Activity Against Staphylococcus aureus. Appl. Biochem. Biotechnol. 2022, 1–15. [Google Scholar] [CrossRef] [PubMed]
  52. Pancheniak, E.D.E.F.R.; Soccol, C.R. Biochemical characterization and identification of probiotic lactobacillus for swine. Bol. Do Cent. De Pesqui. De Process. De Aliment. 2005, 23, 299–310. [Google Scholar] [CrossRef] [Green Version]
  53. Fonseca, H.C.; de Sousa Melo, D.; Ramos, C.L.; Dias, D.R.; Schwan, R.F. Probiotic Properties of Lactobacilli and Their Ability to Inhibit the Adhesion of Enteropathogenic Bacteria to Caco-2 and HT-29 Cells. Probiotics Antimicrob. Proteins 2021, 13, 102–112. [Google Scholar] [CrossRef] [PubMed]
  54. Argenta, A.; Satish, L.; Gallo, P.; Liu, F.; Kathju, S.J.P.o. Local application of probiotic bacteria prophylaxes against sepsis and death resulting from burn wound infection. PLoS ONE 2016, 11, e0165294. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Robson, M.C. Wound infection. A failure of wound healing caused by an imbalance of bacteria. Surg. Clin. N. Am. 1997, 77, 637–650. [Google Scholar] [CrossRef]
  56. Broughton, G.; Janis, J.E.; Attinger, C.E. Wound healing: An overview. Plast Reconstr. Surg. 2006, 117, 1e-S–32e-S. [Google Scholar] [CrossRef] [Green Version]
  57. Werner, S.; Krieg, T.; Smola, H. Keratinocyte-fibroblast interactions in wound healing. J. Invest. Derm. 2007, 127, 998–1008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Cockerill, F.R.; Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Third Informational Supplement; [... Provides Updated Tables for... M02-A11, M07-A9, and M11-A8]; National Committee for Clinical Laboratory Standards: Wayne, PA, USA, 2013. [Google Scholar]
Pathogens 12 00501 g001 550
Figure 1. In vitro antibacterial activity of honey–L. plantarum. (a) inhibition of each component of the formulation against S. aureus (SA) for 12 h; (b) inhibition of each component of the formulation against P. aeruginosa (PA) for 12 h; (c) inhibition of each component of the formulation against E. coli (EC) for 12 h; (d) inhibition rate of the formulation against the three bacteria at different times. SA/PA/EC: 1 × 108 CFU/mL; L. plantarum: 1 × 109 CFU/mL; honey: (10%). Data are expressed as mean ± standard error, **** indicates a significant difference (p < 0.0001) compared with the blank (C) control.
Figure 1. In vitro antibacterial activity of honey–L. plantarum. (a) inhibition of each component of the formulation against S. aureus (SA) for 12 h; (b) inhibition of each component of the formulation against P. aeruginosa (PA) for 12 h; (c) inhibition of each component of the formulation against E. coli (EC) for 12 h; (d) inhibition rate of the formulation against the three bacteria at different times. SA/PA/EC: 1 × 108 CFU/mL; L. plantarum: 1 × 109 CFU/mL; honey: (10%). Data are expressed as mean ± standard error, **** indicates a significant difference (p < 0.0001) compared with the blank (C) control.
Pathogens 12 00501 g001
Pathogens 12 00501 g002 550
Figure 2. Effect of honey–L. plantarum formulation on biofilm formation. (a) Effect of honey–L. plantarum formulation on biofilm of S. aureus; (b) effect of honey–L. plantarum formulation on biofilm of P. aeruginosa. (c) Inhibition of biofilm formation of S. aureus and P. aeruginosa by formulations. S: S. aureus (1 × 108 CFU/mL); P: P. aeruginosa (1 × 108 CFU/mL); L: S. aureus/P. aeruginosa + L. plantarum (1 × 109 CFU/mL); H: S. aureus/P. aeruginosa + honey (10% v/v); HL: S. aureus/P. aeruginosa + honey + L. plantarum. Data are expressed as mean ± standard error (SEM), * indicates a significant difference (p < 0.05) compared with the blank (S/P) control, ** indicates p < 0.01, and *** indicates p < 0.001.
Figure 2. Effect of honey–L. plantarum formulation on biofilm formation. (a) Effect of honey–L. plantarum formulation on biofilm of S. aureus; (b) effect of honey–L. plantarum formulation on biofilm of P. aeruginosa. (c) Inhibition of biofilm formation of S. aureus and P. aeruginosa by formulations. S: S. aureus (1 × 108 CFU/mL); P: P. aeruginosa (1 × 108 CFU/mL); L: S. aureus/P. aeruginosa + L. plantarum (1 × 109 CFU/mL); H: S. aureus/P. aeruginosa + honey (10% v/v); HL: S. aureus/P. aeruginosa + honey + L. plantarum. Data are expressed as mean ± standard error (SEM), * indicates a significant difference (p < 0.05) compared with the blank (S/P) control, ** indicates p < 0.01, and *** indicates p < 0.001.
Pathogens 12 00501 g002
Pathogens 12 00501 g003 550
Figure 3. The effect of honey–L. plantarum formulation on biofilm formation of S. aureus and P. aeruginosa as observed by fluorescence microscope. C: S. aureus (1 × 108 CFU/mL)/P. aeruginosa (1 × 108 CFU/mL); L: S. aureus/P. aeruginosa + L. plantarum; H: S. aureus/P. aeruginosa + honey; HL: S. aureus/P. aeruginosa + honey + L. plantarum. Live cells were shown in green and dead cells in red, and ×20 magnification was used to observe.
Figure 3. The effect of honey–L. plantarum formulation on biofilm formation of S. aureus and P. aeruginosa as observed by fluorescence microscope. C: S. aureus (1 × 108 CFU/mL)/P. aeruginosa (1 × 108 CFU/mL); L: S. aureus/P. aeruginosa + L. plantarum; H: S. aureus/P. aeruginosa + honey; HL: S. aureus/P. aeruginosa + honey + L. plantarum. Live cells were shown in green and dead cells in red, and ×20 magnification was used to observe.
Pathogens 12 00501 g003
Pathogens 12 00501 g004 550
Figure 4. The effects of honey–L. plantarum formulation on the expression levels of S. aureus biofilm-related genes. Relative mRNA expression of icaA (a), icaR (b), sarA (c), agrA (d), and sigB (e). S: S. aureus (1 × 108 CFU/mL); L: S. aureus + L. plantarum; H: S. aureus + honey; HL: S. aureus + honey + L. plantarum. Values are represented as mean ± standard error (SEM) (n = 3). The * indicates a statistically significant difference (p < 0.05), ** indicates p < 0.01, and **** indicates p < 0.001.
Figure 4. The effects of honey–L. plantarum formulation on the expression levels of S. aureus biofilm-related genes. Relative mRNA expression of icaA (a), icaR (b), sarA (c), agrA (d), and sigB (e). S: S. aureus (1 × 108 CFU/mL); L: S. aureus + L. plantarum; H: S. aureus + honey; HL: S. aureus + honey + L. plantarum. Values are represented as mean ± standard error (SEM) (n = 3). The * indicates a statistically significant difference (p < 0.05), ** indicates p < 0.01, and **** indicates p < 0.001.
Pathogens 12 00501 g004
Pathogens 12 00501 g005 550
Figure 5. The effects of honey–L. plantarum formulation on the expression levels of P. aeruginosa QS-related genes. Relative mRNA expression of lsaR (a), lasI (b), rhlR (c), rhlI (d), and pqsR (e). P: P. aeruginosa (1 × 108 CFU/mL); L: P. aeruginosa + L. plantarum; H: P. aeruginosa + honey; HL: P. aeruginosa + honey + L. plantarum. Values are represented as mean ± standard error (SEM) (n = 3). The ** indicates a statistically significant difference (p < 0.01), and **** indicates p < 0.001.
Figure 5. The effects of honey–L. plantarum formulation on the expression levels of P. aeruginosa QS-related genes. Relative mRNA expression of lsaR (a), lasI (b), rhlR (c), rhlI (d), and pqsR (e). P: P. aeruginosa (1 × 108 CFU/mL); L: P. aeruginosa + L. plantarum; H: P. aeruginosa + honey; HL: P. aeruginosa + honey + L. plantarum. Values are represented as mean ± standard error (SEM) (n = 3). The ** indicates a statistically significant difference (p < 0.01), and **** indicates p < 0.001.
Pathogens 12 00501 g005
Pathogens 12 00501 g006 550
Figure 6. Growth effect of honey on L. plantarum and honey–L. plantarum culture supernatant to S. aureus and P. aeruginosa. (a) Growth counts of L. plantarum in a co-culture system with S. aureus, L0: the initial amount of L. plantarum, L: 24 h live count of L. plantarum in S. aureus co-culture, HL: 24 h live count of L. plantarum in honey and S. aureus co-culture; (b) growth curve of L. plantarum, (1 × 109 CFU/mL), H (10%); (c) effect of honey–L. plantarum culture supernatant (CSF, v/v) on the growth of S. aureus (SA) and P. aeruginosa (PA) (1 × 107 CFU/mL); (d) effect of honey–L. plantarum formulation on the pH of the culture medium for 24 h. H:MRS + honey (10%); L: MRS + L. plantarum (1 × 107 CFU/mL); HL: MRS + L. plantarum (1 × 107 CFU/mL)+ honey (10%). Data are expressed as mean ± standard error (SEM), * indicates a statistically significant difference (p < 0.05), *** indicates p < 0.001. The ns indicates none statistically significant difference (p > 0.05).
Figure 6. Growth effect of honey on L. plantarum and honey–L. plantarum culture supernatant to S. aureus and P. aeruginosa. (a) Growth counts of L. plantarum in a co-culture system with S. aureus, L0: the initial amount of L. plantarum, L: 24 h live count of L. plantarum in S. aureus co-culture, HL: 24 h live count of L. plantarum in honey and S. aureus co-culture; (b) growth curve of L. plantarum, (1 × 109 CFU/mL), H (10%); (c) effect of honey–L. plantarum culture supernatant (CSF, v/v) on the growth of S. aureus (SA) and P. aeruginosa (PA) (1 × 107 CFU/mL); (d) effect of honey–L. plantarum formulation on the pH of the culture medium for 24 h. H:MRS + honey (10%); L: MRS + L. plantarum (1 × 107 CFU/mL); HL: MRS + L. plantarum (1 × 107 CFU/mL)+ honey (10%). Data are expressed as mean ± standard error (SEM), * indicates a statistically significant difference (p < 0.05), *** indicates p < 0.001. The ns indicates none statistically significant difference (p > 0.05).
Pathogens 12 00501 g006
Pathogens 12 00501 g007 550
Figure 7. Effect of honey–L. plantarum formulation on wound healing. (a) Representative graphs of wounds on days 0, 1, 3, and 5; (b) wound bacterial residue counts; (c) H&E staining of wound tissue on days 1, 3, and 5; ×7.5 and ×40 magnification were used to observe. SA: a group of S. aureus infected control, with wounds infected by S. aureus of 1 × 108 CFU/mL; HL: a group of treatment, with infected wounds treated by honey–L. plantarum formulation. Data are expressed as mean ± standard error (SEM), and the *** indicates a significant difference (p < 0.001) compared with the infected control (SA).
Figure 7. Effect of honey–L. plantarum formulation on wound healing. (a) Representative graphs of wounds on days 0, 1, 3, and 5; (b) wound bacterial residue counts; (c) H&E staining of wound tissue on days 1, 3, and 5; ×7.5 and ×40 magnification were used to observe. SA: a group of S. aureus infected control, with wounds infected by S. aureus of 1 × 108 CFU/mL; HL: a group of treatment, with infected wounds treated by honey–L. plantarum formulation. Data are expressed as mean ± standard error (SEM), and the *** indicates a significant difference (p < 0.001) compared with the infected control (SA).
Pathogens 12 00501 g007
Pathogens 12 00501 g008 550
Figure 8. A possible inhibition graphic model of the honey–L. plantarum in gene regulation. HL: honey–L. plantarum formulation.
Figure 8. A possible inhibition graphic model of the honey–L. plantarum in gene regulation. HL: honey–L. plantarum formulation.
Pathogens 12 00501 g008
Table
Table 1. 3 × 3 factorial design levels and factors.
Table 1. 3 × 3 factorial design levels and factors.
FactorsLevel 1Level 2Level 3
X1 (Honey ratio, %, v/v)102030
X2 (L. plantarum, CFU/mL)107108109
Table
Table 2. Gene-specific primers used in this study.
Table 2. Gene-specific primers used in this study.
GeneForward PrimerReverse Primer
rpoBCAGCTGACGAAGAAGATAGCTATGTACTTCATCATCCATGAAACGACCAT
icaACTGGCGCAGTCAATACTATTTCGGGTGTCTGACCTCCCAATGTTTCTGGAACCAACTCC
icaRTGCTTTCAAATACCAACTTTCAAGAACGTTCAATTATCTAATACGCCTGA
sigBAAGTGATTCGTAAGGACGTCTTCGATAACTATAACCAAAGCCT
agrATGATAATCCTTATGAGGTGCTTCACTGTGACTCGTAACGAAAA
sarACAAACAACCACAAGTTGTTAAAGCTGTTTGCTTCAGTGATTCGTTT
lasICGATACCACTGGCCCCTACAGGCTGAGTTCCCAGATGTGC
lasRAGGAAGTGTTGCAGTGGTGCGGAGGTCACACCGAACTTCC
rhlIGTCTCGCCCTTGACCTTCTGATTCTGGTCCAGCCTGCAAT
rhlRCGGGTGAAGGGAATCGTGTGACGGTTTGCGTAGCGAGATG
pqsRCTGCTCACCGTATCGCAGAACGCCTGATCCCTTACATGCG
GAPDHCACTCCAGCCGTTTCGAACTCGGCTTGAACACCACCGTAT
Table
Table 3. ANOVA table for the studied honey (H) and L. plantarum (L).
Table 3. ANOVA table for the studied honey (H) and L. plantarum (L).
Source of
Variation		Degrees of
Freedom		Sum of
Squares		Mean
Square		F-Valuep-Value
Model848.0526.0075115.985<0.001
H (X1)232.20216.10113,713.656<0.001
L (X2)25.0952.5482169.997<0.001
H × L (X12)410.7552.6892290.144<0.001
Residual180.0210.001
Cor Total2648.073
Table
Table 4. Honey and L. plantarum formulations and their antimicrobial activity.
Table 4. Honey and L. plantarum formulations and their antimicrobial activity.
FormulationsHoney
(%)		L. plantarum
(CFU/mL)		S. aureus
(Log10CFU/mL)		Inhibition
(%)
F0009.60 ± 0.04-
F1101079.39 ± 0.012.20 ± 0.09
F2101088.54 ± 0.0411.04 ± 0.37
F3101094.32 ± 0.1255.05 ± 1.23
F4201079.08 ± 0.025.40 ± 0.16
F5201088.64 ± 0.0310.01 ± 0.32
F6201096.70 ± 0.1030.26 ± 0.1.06
F7301079.16 ± 0.014.62 ± 0.13
F8301088.81 ± 0.028.25 ± 0.25
F9301097.95 ± 0.0517.23 ± 0.50
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, M.; Xiao, H.; Su, Y.; Cheng, D.; Jia, Y.; Li, Y.; Yin, Q.; Gao, J.; Tang, Y.; Bai, Q. Synergistic Inhibitory Effect of Honey and Lactobacillus plantarum on Pathogenic Bacteria and Their Promotion of Healing in Infected Wounds. Pathogens 2023, 12, 501. https://doi.org/10.3390/pathogens12030501

AMA Style

Li M, Xiao H, Su Y, Cheng D, Jia Y, Li Y, Yin Q, Gao J, Tang Y, Bai Q. Synergistic Inhibitory Effect of Honey and Lactobacillus plantarum on Pathogenic Bacteria and Their Promotion of Healing in Infected Wounds. Pathogens. 2023; 12(3):501. https://doi.org/10.3390/pathogens12030501

Chicago/Turabian Style

Li, Mei, Hong Xiao, Yongmei Su, Danlin Cheng, Yan Jia, Yingli Li, Qi Yin, Jieying Gao, Yong Tang, and Qunhua Bai. 2023. "Synergistic Inhibitory Effect of Honey and Lactobacillus plantarum on Pathogenic Bacteria and Their Promotion of Healing in Infected Wounds" Pathogens 12, no. 3: 501. https://doi.org/10.3390/pathogens12030501

APA Style

Li, M., Xiao, H., Su, Y., Cheng, D., Jia, Y., Li, Y., Yin, Q., Gao, J., Tang, Y., & Bai, Q. (2023). Synergistic Inhibitory Effect of Honey and Lactobacillus plantarum on Pathogenic Bacteria and Their Promotion of Healing in Infected Wounds. Pathogens, 12(3), 501. https://doi.org/10.3390/pathogens12030501

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop