Novel Insights into the Wattle and Daub Model of Entamoeba Cyst Wall Formation and the Importance of Actin Cytoskeleton
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Reagents
2.2. Antibody Production against E. invadens
Chitin Synthase 1
2.3. Plasmid Construction and Transfection
2.4. Encystation
2.5. Estimation of Encystation Efficiency
2.6. Cell Staining
2.7. Microscopy
2.8. RNA Isolation and RT-PCR
3. Results and Discussion
3.1. Chitin Wall Is Assembled on the Surface of Encysting Cells Starting from Distinct Point(s)
3.2. Localization of the Chitin Synthase on the Cyst Surface Guides Chitin Deposition
3.3. Revisiting the Wattle and Daub Model of the Cyst Wall (Chitin, Chitinase, and Jessie Lectin Assemble into the Cyst Wall from One Starting Point on the Foundation Made of Jacob Lectin)
3.4. During Encystation, F-Actin Was Reorganized into the Cortical Region Where It Remained until the Completion of the Chitin Wall
3.5. 2,3-Butanedione Monoxime Treatment Inhibited Cortical Actin Formation and Produced Wall-Less Cysts and Cysts with Defective Walls
3.6. Cytochalasin D Treatment Inhibited Cortical Actin Formation and Produced Wall-Less Cysts and Cysts with Defective Walls
3.7. Silencing of TALE Homeobox Transcription Factor EiHbox1 Inhibits Cortical Actin Formation
3.8. Inhibition of Cortical Actin Formation Affected Both Localization and Activity of Chitin Synthase
3.9. Modified Cyst Wall Synthesis Pathways during Entamoeba Encystation
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO/PAHO/UNESCO report. A consultation with experts on amoebiasis. Mexico City, Mexico 28–29 January, 1997. Epidemiol. Bull. 1997, 18, 13–14. [Google Scholar]
- Wassmann, C.; Hellberg, A.; Tannich, E.; Bruchhaus, I. Metronidazole resistance in the protozoan parasite entamoeba histolytica is associated with increased expression of iron-containing superoxide dismutase and peroxiredoxin and decreased expression of ferredoxin 1 and flavin reductase. J. Biol. Chem. 1999, 274, 26051–26056. [Google Scholar] [CrossRef]
- Orozco, E.; Gómez, C.; Pérez, D. Physiology and molecular genetics of multidrug resistance in Entamoeba histolytica. Drug Resist. Updat. 1999, 2, 188–197. [Google Scholar] [CrossRef] [PubMed]
- Larocque, R.; Nakagaki, K.; Lee, P.; Abdul-Wahid, A.; Faubert, G.M. Oral Immunization of BALB/c Mice with Giardia duodenalis Recombinant Cyst Wall Protein Inhibits Shedding of Cysts. Infect. Immun. 2003, 71, 5662–5669. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.-M.; Zheng, W.-Y.; Zhang, H.-M.; Shi, W.-Y.; Li, Y.; Cui, B.-J.; Wang, H.-Y. Vaccination with Bivalent DNA Vaccine of α1-Giardin and CWP2 Delivered by Attenuated Salmonella typhimurium Reduces Trophozoites and Cysts in the Feces of Mice Infected with Giardia lamblia. PLoS ONE 2016, 11, e0157872. [Google Scholar] [CrossRef]
- Wesel, J.; Shuman, J.; Bastuzel, I.; Dickerson, J.; Ingram-Smith, C. Encystation of Entamoeba histolytica in Axenic Culture. Microorganisms 2021, 9, 873. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, L.; Enea, V.; Eichinger, D. Identification of a developmentally regulated transcript expressed during encystation of Entamoeba invadens. Mol. Biochem. Parasitol. 1994, 67, 125–135. [Google Scholar] [CrossRef]
- Chia, M.-Y.; Jeng, C.-R.; Hsiao, S.-H.; Lee, A.-H.; Chen, C.-Y.; Pang, V.F. Entamoeba invadens Myositis in a Common Water Monitor Lizard (Varanus salvator). Veter-Pathol. 2009, 46, 673–676. [Google Scholar] [CrossRef]
- Wang, Z.; Samuelson, J.; Clark, C.; Eichinger, D.; Paul, J.; Van Dellen, K.; Hall, N.; Anderson, I.; Loftus, B. Gene discovery in the Entamoeba invadens genome. Mol. Biochem. Parasitol. 2003, 129, 23–31. [Google Scholar] [CrossRef]
- Mousa, E.A.A.; Sakaguchi, M.; Nakamura, R.; Abdella, O.H.; Yoshida, H.; Hamano, S.; Mi-Ichi, F. The dynamics of ultrastructural changes during Entamoeba invadens encystation. Parasitology 2020, 147, 1305–1312. [Google Scholar] [CrossRef]
- Ehrenkaufer, G.M.; Haque, R.; Hackney, J.A.; Eichinger, D.J.; Singh, U. Identification of developmentally regulated genes in Entamoeba histolytica: Insights into mechanisms of stage conversion in a protozoan parasite. Cell. Microbiol. 2007, 9, 1426–1444. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.K.; Van Dellen, K.L.; Chatterjee, A.; Dey, T.; Haque, R.; Robbins, P.W.; Samuelson, J. The Jacob2 Lectin of the Entamoeba histolyticacyst wall binds chitin and is polymorphic. PLoS Negl. Trop. Dis. 2010, 4, e750. [Google Scholar] [CrossRef] [PubMed]
- Gow, N.A.R.; Latge, J.-P.; Munro, C.A. The Fungal Cell Wall: Structure, Biosynthesis, and Function. Microbiol. Spectr. 2017, 5, 10–1128. [Google Scholar] [CrossRef] [PubMed]
- Arroyo-Begovich, A.; Carabez-Trejo, A.; Ruiz-Herrera, J. Identification of the Structural Component in the Cyst Wall of Entamoeba invadens. J. Parasitol. 1980, 66, 735–741. [Google Scholar] [CrossRef] [PubMed]
- Van Dellen, K.L.; Chatterjee, A.; Ratner, D.M.; Magnelli, P.E.; Cipollo, J.F.; Steffen, M.; Robbins, P.W.; Samuelson, J. Unique posttranslational modifications of chitin-binding lectins of Entamoeba invadens Cyst Walls. Eukaryot. Cell 2006, 5, 836–848. [Google Scholar] [CrossRef] [PubMed]
- Frisardi, M.; Ghosh, S.K.; Field, J.; Van Dellen, K.; Rogers, R.; Robbins, P.; Samuelson, J. The most abundant glycoprotein of amebic cyst walls (jacob) is a lectin with five cys-rich, chitin-binding domains. Infect. Immun. 2000, 68, 4217–4224. [Google Scholar] [CrossRef] [PubMed]
- Van Dellen, K.; Ghosh, S.K.; Robbins, P.W.; Loftus, B.; Samuelson, J. Entamoeba histolytica Lectins Contain Unique 6-Cys or 8-Cys Chitin-Binding Domains. Infect. Immun. 2002, 70, 3259–3263. [Google Scholar] [CrossRef]
- Samuelson, J.; Robbins, P. A simple fibril and lectin model for cyst walls of Entamoeba and perhaps Giardia. Trends Parasitol. 2011, 27, 17–22. [Google Scholar] [CrossRef]
- Chatterjee, A.; Ghosh, S.K.; Jang, K.; Bullitt, E.; Moore, L.; Robbins, P.W.; Samuelson, J. Evidence for a “Wattle and Daub” Model of the Cyst Wall of Entamoeba. PLoS Pathog. 2009, 5, e1000498. [Google Scholar] [CrossRef]
- Nayak, S.; Ghosh, S.K. Nucleotide sugar transporters of Entamoeba histolytica and Entamoeba invadens involved in chitin synthesis. Mol. Biochem. Parasitol. 2019, 234, 111224. [Google Scholar] [CrossRef]
- Das, S.; Van Dellen, K.; Bulik, D.; Magnelli, P.; Cui, J.; Head, J.; Robbins, P.W.; Samuelson, J. The cyst wall of Entamoeba invadens contains chitosan (deacetylated chitin). Mol. Biochem. Parasitol. 2006, 148, 86–92. [Google Scholar] [CrossRef] [PubMed]
- De Cádiz, A.E.; Jeelani, G.; Nakada-Tsukui, K.; Caler, E.; Nozaki, T. Transcriptome Analysis of Encystation in Entamoeba invadens. PLoS ONE 2013, 8, e74840. [Google Scholar] [CrossRef] [PubMed]
- Ehrenkaufer, G.M.; Weedall, G.D.; Williams, D.; Lorenzi, H.A.; Caler, E.; Hall, N.; Singh, U. The genome and transcriptome of the enteric parasite Entamoeba invadens, a model for encystation. Genome Biol. 2013, 14, R77. [Google Scholar] [CrossRef] [PubMed]
- Harris, S.D.; Morrell, J.L.; E Hamer, J. Identification and characterization of Aspergillus nidulans mutants defective in cytokinesis. Genetics 1994, 136, 517–532. [Google Scholar] [CrossRef] [PubMed]
- Gabriel, M.; Kopecká, M.; Svoboda, A. Structural rearrangement of the actin cytoskeleton in regenerating protoplasts of budding yeasts. J. Gen. Microbiol. 1992, 138, 2229–2234. [Google Scholar] [CrossRef]
- Vayssié, L.; Vargas, M.; Weber, C.; Guillén, N. Double-stranded RNA mediates homology-dependant gene silencing of γ-tubulin in the human parasite Entamoeba histolytica. Mol. Biochem. Parasitol. 2004, 138, 21–28. [Google Scholar] [CrossRef] [PubMed]
- Makioka, A.; Kumagai, M.; Ohtomo, H.; Kobayashi, S.; Takeuchi, T. Effect of cytochalasin D on the growth, encystation, and multinucleation of Entamoeba invadens. Parasitol. Res. 2000, 86, 599–602. [Google Scholar] [CrossRef]
- Makioka, A.; Kumagai, M.; Ohtomo, H.; Kobayashi, S.; Takeuchi, T. Effect of Jasplakinolide on the Growth, Encystation, and Actin Cytoskeleton of Entamoeba histolytica and Entamoeba invadens. J. Parasitol. 2001, 87, 399–405. [Google Scholar] [CrossRef]
- Clark, C.G.; Diamond, L.S. Methods for Cultivation of Luminal Parasitic Protists of Clinical Importance. Clin. Microbiol. Rev. 2002, 15, 329–341. [Google Scholar] [CrossRef]
- Dey, T.; Basu, R.; Ghosh, S.K. Entamoeba invadens: Cloning and molecular characterization of chitinases. Exp. Parasitol. 2009, 123, 244–249. [Google Scholar] [CrossRef]
- Meenakshi; Balbhim, S.S.; Sarkar, S.; Vasudevan, M.; Ghosh, S.K. Three-amino acid loop extension homeodomain proteins regulate stress responses and encystation in Entamoeba. Mol. Microbiol. 2023, 120, 276–297. [Google Scholar] [CrossRef] [PubMed]
- Krishnan, D.; Ghosh, S.K. Morphological and Motility Features of the Stable Bleb-Driven Monopodial Form of Entamoeba and Its Importance in Encystation. Infect. Immun. 2020, 88, e00903-19. [Google Scholar] [CrossRef] [PubMed]
- Hahne, G.; Herth, W.; Hoffmann, F. Wall formation and cell division in fluorescence-labelled plant protoplasts. Protoplasma 1983, 115, 217–221. [Google Scholar] [CrossRef]
- Osumiab, M.; Satoc, M.; Ishijima, S.A.; Konomib, M.; Takagic, T.; Yaguchid, H. Dynamics of Cell Wall Formation in Fission Yeast, Schizosaccharomyces pombe. Fungal Genet. Biol. 1998, 24, 178–206. [Google Scholar] [CrossRef] [PubMed]
- Kobori, H.; Yamada, N.; Taki, A.; Osumi, M. Actin is associated with the formation of the cell wall in reverting protoplasts of the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 1989, 94 Pt 4, 635–646. [Google Scholar] [CrossRef] [PubMed]
- Kimura, S.; Laosinchai, W.; Itoh, T.; Cui, X.; Linder, C.R.; Brown, R.M. Immunogold labeling of rosette terminal cellulose-synthesizing complexes in the vascular plant Vigna angularis. Plant Cell 1999, 11, 2075–2085. [Google Scholar] [CrossRef] [PubMed]
- Campos-Góngora, E.; Ebert, F.; Willhoeft, U.; Said-Fernández, S.; Tannich, E. Characterization of Chitin Synthases from Entamoeba. Protist 2004, 155, 323–330. [Google Scholar] [CrossRef]
- Maue, L.; Meissner, D.; Merzendorfer, H. Purification of an active, oligomeric chitin synthase complex from the midgut of the tobacco hornworm. Insect Biochem. Mol. Biol. 2009, 39, 654–659. [Google Scholar] [CrossRef]
- Weiss, I.M.; Lüke, F.; Eichner, N.; Guth, C.; Clausen-Schaumann, H. On the function of chitin synthase extracellular domains in biomineralization. J. Struct. Biol. 2013, 183, 216–225. [Google Scholar] [CrossRef]
- McMurrough, I.; Flores-Carreon, A.; Bartnicki-Garcia, S. Pathway of chitin synthesis and cellular localization of chitin synthetase in Mocor rouxii. J. Biol. Chem. 1971, 246, 3999–4007. [Google Scholar] [CrossRef]
- Ruiz-Herrera, J.; Xoconostle-Cázares, B.; Reynaga-Peña, C.G.; León-Ramírez, C.; Cárabez-Trejo, A. Immunolocalization of chitin synthases in the phytopathogenic dimorphic fungus Ustilago maydis. FEMS Yeast Res. 2006, 6, 999–1009. [Google Scholar] [CrossRef] [PubMed]
- Kang, M.S.; Elango, N.; Mattia, E.; Au-Young, J.; Robbins, P.W.; Cabib, E. Isolation of chitin synthetase from Saccharomyces cerevisiae. Purification of an enzyme by entrapment in the reaction product. J. Biol. Chem. 1984, 259, 14966–14972. [Google Scholar] [CrossRef] [PubMed]
- Chávez-Munguía, B.; Cristóbal-Ramos, A.R.; González-Robles, A.; Tsutsumi, V.; Martínez-Palomo, A. Ultrastructural study of Entamoeba invadens encystation and excystation. J. Submicrosc. Cytol. Pathol. 2003, 35, 235–243. [Google Scholar] [PubMed]
- Garajová, M.; Mrva, M.; Vaškovicová, N.; Martinka, M.; Melicherová, J.; Valigurová, A. Cellulose fibrils formation and organisation of cytoskeleton during encystment are essential for Acanthamoeba cyst wall architecture. Sci. Rep. 2019, 9, 4466. [Google Scholar] [CrossRef] [PubMed]
- Lenardon, M.D.; Whitton, R.K.; Munro, C.A.; Marshall, D.; Gow, N.A. Individual chitin synthase enzymes synthesize microfibrils of differing structure at specific locations in the Candida albicans cell wall. Mol. Microbiol. 2007, 66, 1164–1173. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.K.; Field, J.; Frisardi, M.; Rosenthal, B.; Mai, Z.; Rogers, R.; Samuelson, J. Chitinase secretion by encysting Entamoeba invadens and transfected Entamoeba histolytica trophozoites: Localization of secretory vesicles, endoplasmic reticulum, and Golgi apparatus. Infect Immun. 1999, 67, 3073–3081. [Google Scholar] [CrossRef] [PubMed]
- Frederick, J.R.; Petri, W.A. Roles for the galactose-/N-acetylgalactosamine-binding lectin of Entamoeba in parasite virulence and differentiation. Glycobiology 2005, 15, 53R–59R. [Google Scholar] [CrossRef]
- Stewart, M.P.; Helenius, J.; Toyoda, Y.; Ramanathan, S.P.; Muller, D.J.; Hyman, A.A. Hydrostatic pressure and the actomyosin cortex drive mitotic cell rounding. Nature 2011, 469, 226–230. [Google Scholar] [CrossRef]
- Paredez, A.R.; Somerville, C.R.; Ehrhardt, D.W. Visualization of Cellulose Synthase Demonstrates Functional Association with Microtubules. Science 2006, 312, 1491–1495. [Google Scholar] [CrossRef]
- Paredez, A.R.; Assaf, Z.J.; Sept, D.; Timofejeva, L.; Dawson, S.C.; Wang, C.-J.R.; Cande, W.Z. An actin cytoskeleton with evolutionarily conserved functions in the absence of canonical actin-binding proteins. Proc. Natl. Acad. Sci. USA 2011, 108, 6151–6156. [Google Scholar] [CrossRef]
- Steinberg, G.; McIntosh, J.R. Effects of the myosin inhibitor 2,3-butanedione monoxime on the physiology of fission yeast. Eur. J. Cell Biol. 1998, 77, 284–293. [Google Scholar] [CrossRef] [PubMed]
- Rivera-Molina, F.E.; González-Crespo, S.; la Cruz, Y.M.-D.; Ortiz-Betancourt, J.M.; Rodríguez-Medina, J.R. 2,3-Butanedione monoxime increases sensitivity to Nikkomycin Z in the budding yeast Saccharomyces cerevisiae. World J. Microbiol. Biotechnol. 2006, 22, 255–260. [Google Scholar] [CrossRef] [PubMed]
- Sambrano, G.R.; Fraser, I.; Han, H.; Ni, Y.; O’Connell, T.; Yan, Z.; Stull, J.T. Navigating the signalling network in mouse cardiac myocytes. Nature 2002, 420, 712–714. [Google Scholar] [CrossRef] [PubMed]
- Manning-Cela, R.; Marquez, C.; Franco, E.; Talamas-Rohana, P.; Meza, I. BFA-sensitive and insensitive exocytic pathways in Entamoeba histolytica trophozoites: Their relationship to pathogenesis. Cell. Microbiol. 2003, 5, 921–932. [Google Scholar] [CrossRef]
- Coppi, A.; Merali, S.; Eichinger, D. The Enteric Parasite Entamoeba Uses an Autocrine Catecholamine System during Differentiation into the Infectious Cyst Stage. J. Biol. Chem. 2002, 277, 8083–8090. [Google Scholar] [CrossRef] [PubMed]
- Garza, M.D.L.; Gallegos, B.; Meza, I. Characterization of a Cytochalasin D-Resistant Mutant of Entamoeba histolytica. J. Protozool. 1989, 36, 556–560. [Google Scholar] [CrossRef] [PubMed]
- Makioka, A.; Kumagai, M.; Kobayashi, S.; Takeuchi, T. Different effects of cytochalasins on the growth and differentiation of Entamoeba invadens. Parasitol. Res. 2004, 93, 68–71. [Google Scholar] [CrossRef]
- Takagi, T.; Ishijima, S.A.; Ochi, H.; Osumi, M. Ultrastructure and behavior of actin cytoskeleton during cell wall formation in the fission yeast Schizosaccharomyces pombe. J. Electron Microsc. 2003, 52, 161–174. [Google Scholar] [CrossRef]
- Gabriel, M.; Kopecká, M. Disruption of the actin cytoskeleton in budding yeast results in formation of an aberrant cell wall. Microbiology 1995, 141, 891–899. [Google Scholar] [CrossRef]
- Sánchez-León, E.; Verdín, J.; Freitag, M.; Roberson, R.W.; Bartnicki-Garcia, S.; Riquelme, M. Traffic of Chitin Synthase 1 (CHS-1) to the Spitzenkörper and Developing Septa in Hyphae of Neurospora crassa: Actin Dependence and Evidence of Distinct Microvesicle Populations. Eukaryot. Cell 2011, 10, 683–695. [Google Scholar] [CrossRef]
- Takeshita, N.; Ohta, A.; Horiuchi, H. CsmA, a Class V Chitin Synthase with a Myosin Motor-like Domain, Is Localized through Direct Interaction with the Actin Cytoskeleton in Aspergillus nidulans. Mol. Biol. Cell 2005, 16, 1961–1970. [Google Scholar] [CrossRef] [PubMed]
Gene/ID | Primers (5′-3′) |
---|---|
ADP Ribosylation Factor EIN_268250 | EiARF F: 5′ CCATCATCTTTGTAGTTGATTCCA 3′ |
EiARF R: 5′ TCACTTGAGAGTGTCAGCAAGC 3′ | |
Jacob EIN_230100 | EiJac F: 5′ TACTGAAACGTCCAAAGAAGAGTC 3′ |
EiJac R: 5′ TTAATTCTTCTTTGCCCAGGTT 3′ | |
Chitinase EIN_096870 | Ei Chi3 F: 5′ GATGGCAAACATCGAAATCG 3′ |
Ei Chi3 R: 5′ TTAGTTTTTCAACTCATCG 3′ | |
Jessie EIN_066080 | EiJes3a F: 5′ CTTGCTGTGCCTTGCTTTAA 3′ |
Ei Jes3a R: 5′ CCCCAAATACTTCCC TGGT 3′ | |
Chitin Synthase 1 EIN_066020 | Ei CHS1 F: 5′ TAATGATATTGGGTGTCGTTCA3′ |
Ei CHS1 R: 5′ TATACACCACCACGAGTCCC 3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Krishnan, D.; Pandey, M.; Nayak, S.; Ghosh, S.K. Novel Insights into the Wattle and Daub Model of Entamoeba Cyst Wall Formation and the Importance of Actin Cytoskeleton. Pathogens 2024, 13, 20. https://doi.org/10.3390/pathogens13010020
Krishnan D, Pandey M, Nayak S, Ghosh SK. Novel Insights into the Wattle and Daub Model of Entamoeba Cyst Wall Formation and the Importance of Actin Cytoskeleton. Pathogens. 2024; 13(1):20. https://doi.org/10.3390/pathogens13010020
Chicago/Turabian StyleKrishnan, Deepak, Meenakshi Pandey, Santoshi Nayak, and Sudip K. Ghosh. 2024. "Novel Insights into the Wattle and Daub Model of Entamoeba Cyst Wall Formation and the Importance of Actin Cytoskeleton" Pathogens 13, no. 1: 20. https://doi.org/10.3390/pathogens13010020