A Conservative Mutant Version of the Mrr1 Transcription Factor Correlates with Reduced Sensitivity to Fludioxonil in Botrytis cinerea
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Isolates, Culture Media, and Fungicide
2.2. Assessment of Survival Structures Development
2.3. RNA Extraction, cDNA Synthesis, and Relative Quantification of atrB Gene Expression
2.4. DNA Extraction, Amplification, and Sequencing of mrr1 Coding Region and atrB Intergenic and Coding Regions
2.5. Structural Alignment and Molecular Docking Simulations
2.6. Statistical Analysis
3. Results
3.1. Botrytis Isolates with Reduced Sensitivity to Fludioxonil Presented Unaltered Survival Structure Production
3.2. Botrytis cinerea Isolates with Reduced Sensitivity to Fludioxonil Exhibit Higher Endogenous Levels of atrB Expression
3.3. B. cinerea Isolates with Reduced Sensitivity to Fludioxonil Carry a Unique mrr1 Version Divergent from Fludioxonil-Sensitive Isolates
3.4. High Variability in atrB Does Not Correlate with Changes in the Function of the ABC Transporter AtrB
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Elad, Y.; Pertot, I.; Cotes, A.M.; Stewart, A. Plant hosts of Botrytis spp. In Botrytis—The Fungus, the Pathogen and Its Management in Agricultural Systems; Fillinger, S., Elad, Y., Eds.; Springer: Cham, Switzerland, 2016; pp. 413–486. [Google Scholar] [CrossRef]
- Hao, Y.; Cao, X.; Ma, C.; Zhang, Z.; Zhao, N.; Ali, A.; Hou, T.; Xiang, Z.; Zhuang, J.; Wu, S.; et al. Potential applications and antifungal activities of engineered nanomaterials against gray mold disease agent Botrytis cinerea on rose petals. Front. Plant Sci. 2017, 8, 1332. [Google Scholar] [CrossRef]
- McClellan, W.; Hewitt, W. Early Botrytis rot of grapes: Time of infection and latency of Botrytis cinerea Pers. In Vitis vinifera L. Phytopatology 1973, 63, 1151–1157. [Google Scholar] [CrossRef]
- Pezet, R.; Viret, O.; Perret, C.; Tabacchi, R. Latency of Botrytis cinerea Pers.: Fr. and biochemical studies during growth and ripening of two grape berry cultivars, respectively susceptible and resistant to grey mould. J. Phytopathol. 2003, 151, 208–214. [Google Scholar] [CrossRef]
- Keller, M.; Viret, O.; Cole, F.M. Botrytis cinerea infection in grape flowers: Defense reaction, latency, and disease expression. Phytopathology 2003, 93, 316–322. [Google Scholar] [CrossRef] [PubMed]
- Viret, O.; Keller, M.; Jaudzems, V.G.; Cole, F.M. Botrytis cinerea infection of grape flowers: Light and electron microscopical studies of infection sites. Phytopathology 2004, 94, 850–857. [Google Scholar] [CrossRef]
- Mehari, Z.H.; Pilati, S.; Sonego, P.; Malacarne, G.; Vrhovsek, U.; Engelen, K.; Tudzunsky, P.; Zottini, M.; Baraldi, E.; Moser, C. Molecular analysis of the early interaction between the grapevine flower and Botrytis cinerea reveals that prompt activation of specific host pathways leads to fungus quiescence. Plant Cell Environ. 2017, 40, 1409–1428. [Google Scholar] [CrossRef]
- Emmanuel, C.J.; van Kan, J.A.L.; Shaw, M.W. Differences in the gene transcription state of Botrytis cinerea between necrotic and symptom- less infections of lettuce and Arabidopsis thaliana. Plant Pathol. 2018, 67, 1865–1873. [Google Scholar] [CrossRef]
- Elmer, P.A.G.; Michailides, T.J. Epidemiology of Botrytis cinerea in orchard and vine crops. In Botrytis: Biology, Pathology and Control; Elad, Y., Williamson, B., Tudzynski, P., Delen, N., Eds.; Springer: Dordrecht, The Netherlands, 2007; pp. 243–272. [Google Scholar] [CrossRef]
- Esterio, M.; Copier, C.; Román, A.; Araneda, M.J.; Rubilar, M.; Pérez, I.; Auger, J. Frequency of fungicide-resistant Botrytis cinerea populations isolated from ’Thompson Seedless’ table grapes in the Central Valley of Chile. Cienc. Investig. Agrar. 2017, 44, 295–306. [Google Scholar] [CrossRef]
- Esterio, M.; Auger, J.; Ramos, C.; García, H. First report of fenhexamid resistant isolates of Botrytis cinerea Pers. on grapevine in Chile. Plant Dis. 2007, 91, 768. [Google Scholar] [CrossRef]
- Esterio, M.; Ramos, C.; Walker, A.S.; Fillinger, S.; Leroux, P.; Auger, J. Phenotypic and genetic characterization of B. cinerea Chilean isolates of different levels of fenhexamid sensitivity. Phytopathol. Mediterr. 2011, 50, 414–420. [Google Scholar] [CrossRef]
- Esterio, M.; Araneda, M.J.; Roman, A.; Pizzaro, L.; Copier, C.; Auger, J. First report of boscalid resistant Botrytis cinerea isolates carrying the mutations H272R, H272Y, P225L, and P225H from table grape in Chile. Plant Dis. 2015, 99, 891. [Google Scholar] [CrossRef]
- Latorre, B.; Spadaro, I.; Rioja, M. Occurrence of resistant strains of Botrytis cinerea to anilinopyrimidine fungicides in table grapes in Chile. Crop Prot. 2002, 21, 957–961. [Google Scholar] [CrossRef]
- Piqueras, C.; Latorre, B.; Torres, R. Effectiveness of isofetamid, a new succinate dehydrogenase inhibitor fungicide, in the control of grapevine gray mold. Cienc. Investig. Agrar. 2014, 41, 365–374. [Google Scholar] [CrossRef]
- Arima, K.; Imanaka, H.; Kousaka, M.; Fukuta, A.; Tamura, G. Pyrrolnitrin, a new antibiotic substance, produced by Pseudomonas. Agric. Biol. Chem. 1964, 28, 575–576. [Google Scholar] [CrossRef]
- Kilani, J.; Fillinger, S. Phenylpyrroles: 30 Years, Two Molecules and (Nearly) No Resistance. Front. Microbiol. 2016, 7, 2014. [Google Scholar] [CrossRef]
- Howell, C.R.; Stipanovic, R.D. Control of Rhizoctonia solani on cotton seedlings with Pseudomonas fluorescens and with an antibiotic produced by the bacterium. Phytopathology 1979, 69, 480–482. [Google Scholar] [CrossRef]
- Leadbitter, N.J.; Nyfeler, R.; Elmsheuser, H. The phenylpyrroles: The history of their development at Ciba. In Proceedings of the Symposium Held at the University of Kent, Canterbury, UK, 5–7 January 1994; pp. 129–134. [Google Scholar]
- Pillonel, C.; Meyer, T. Effect of phenylpyrroles on glycerol accumulation and protein kinase activity of Neurospora crassa. Pestic. Sci. 1997, 49, 229–236. [Google Scholar] [CrossRef]
- Motoyama, T.; Ohira, T.; Kadokura, K.; Ichiishi, A.; Fujimura, M.; Yamaguchi, I.; Kudo, T. An Os-1 family histidine kinase from a filamentous fungus confers fungicide-sensitivity to yeast. Curr. Genet. 2005, 47, 298–306. [Google Scholar] [CrossRef]
- Fujimura, M.; Ochiai, N.; Ichiichi, A.; Usami, R.; Horikoshi, K.; Yamaguchi, I. Sensitivity to phenylpyrrole fungicides and abnormal glycerol accumulation in os and cut mutant strains of Neurospora crassa. J. Pestic. Sci. 2000, 25, 31–36. [Google Scholar] [CrossRef]
- Ochiai, N.; Fujimura, M.; Motoyama, T.; Ichiishi, A.; Usami, R.; Horikoshi, K.; Yamaguchi, I. Characterization of mutations in the two-component histidine kinase gene that confer fludioxonil resistance and osmotic sensitivity in the os-1 mutants of Neurospora crassa. Pest Manag. Sci. 2001, 57, 437–442. [Google Scholar] [CrossRef]
- Oshima, M.; Fujimura, M.; Banno, S.; Hashimoto, C.; Motoyama, T.; Ichiishi, A.; Yamaguchi, I.; Fujimura, M. A point mutation in the two-component histidine kinase BcOS-1 gene confers dicarboximide resistance in field isolates of Botrytis cinerea. Phytopathology 2002, 92, 75–80. [Google Scholar] [CrossRef] [PubMed]
- Fillinger, S.; Ajouz, S.; Nicot, P.C.; Leroux, P.; Bardin, M. Functional and structural comparison of pyrrolnitrin and iprodione induced modifications in the class III histidine-kinase Bos1 of Botrytis cinerea. PLoS ONE 2012, 7, 42520. [Google Scholar] [CrossRef]
- Ren, W.; Shao, W.; Han, X.; Zhou, M.; Chen, C. Molecular and biochemical characterization of laboratory and field mutants of Botrytis cinerea resistant to fludioxonil. Plant Dis. 2016, 100, 1414–1423. [Google Scholar] [CrossRef] [PubMed]
- Zhou, F.; Hu, H.Y.; Song, Y.L.; Gao, Y.Q.; Liu, Q.L.; Song, P.W.; Chen, E.; Yu, Y.; Li, D.; Li, C. Biological characteristics and molecular mechanism of fludioxonil resistance in Botrytis cinerea from Henan Province of China. Plant Dis. 2020, 104, 1041–1047. [Google Scholar] [CrossRef]
- Brandhorst, T.T.; Kean, I.R.L.; Lawry, S.M.; Wiesner, D.L.; Klein, B.S. Phenylpyrrole fungicides act on triosephosphate isomerase to induce methylglyoxal stress and alter hybrid histidine kinase activity. Sci. Rep. 2019, 9, 5047. [Google Scholar] [CrossRef]
- Ajouz, S.; Bardin, M.; Nicot, P.C.; El Maataoui, M. Comparison of the development in planta of a pyrrolnitrin-resistant mutant of Botrytis cinerea and its sensitive wild-type parent isolate. Eur. J. Plant Pathol. 2011, 129, 31–42. [Google Scholar] [CrossRef]
- Malandrakis, A.A.; Apostolidou, Z.A.; Markoglou, A.; Flouri, F. Fitness and cross-resistance of Alternaria alternata field isolates with specific or multiple resistance to single site inhibitors and mancozeb. Eur. J. Plant Pathol. 2015, 142, 489–499. [Google Scholar] [CrossRef]
- Pérez-Tomás, R. Multidrug resistance: Retrospect and prospects in anticancer drug treatment. Curr. Med. Chem. 2006, 13, 1859–1876. [Google Scholar] [CrossRef]
- Nikaido, H. Multidrug resistance in bacteria. Annu. Rev. Biochem. 2009, 78, 119–146. [Google Scholar] [CrossRef]
- Kretschmer, M. Emergence of multi-drug resistance in fungal pathogens: A potential threat to fungicide performance in agriculture. In Fungicide Resistance in Crop Protection: Risk and Management; Thind, T.S., Ed.; CABI: Oxfordshire, UK, 2012; pp. 251–267. [Google Scholar] [CrossRef]
- Kretschmer, M.; Leroch, M.; Mosbach, A.; Walker, A.S.; Fillinger, S.; Mernke, D.; Schoonbeek, H.J.; Pradier, J.M.; Leroux, P.; de Waard, M.A.; et al. Fungicide-driven evolution and molecular basis of multidrug resistance in the field populations of the grey mould fungus Botrytis cinerea. PLoS Pathog. 2009, 5, e1000696. [Google Scholar] [CrossRef]
- Paul, S.; Moye-Rowley, W.S. Multidrug resistance in fungi: Regulation of transporter-encoding gene expression. Front. Physiol. 2014, 5, 143. [Google Scholar] [CrossRef] [PubMed]
- Sofianos, G.; Samaras, A.; Karaoglanidis, G. Multiple and multidrug resistance in Botrytis cinerea: Molecular mechanisms of LR/MDR strains in Greece and effects of co-existence of different resistance mechanisms on fungicide sensitivity. Front. Plant Sci. 2023, 14, 1273193. [Google Scholar] [CrossRef]
- Li, X.; Fernández-Ortuño, D.; Grabke, A.; Schnabel, G. Resistance to fludioxonil in Botrytis cinerea isolates from blackberry and strawberry. Phytopathology 2014, 104, 724–732. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Ortuño, D.; Grabke, A.; Li, X.; Schnabel, G. Independent emergence of resistance to seven chemical classes of fungicides in Botrytis cinerea. Phytopathology 2015, 105, 424–432. [Google Scholar] [CrossRef] [PubMed]
- Leroch, M.; Plesken, C.; Weber, R.W.S.; Kauff, F.; Scalliet, G.; Hahn, M. Gray mold populations in German strawberry fields show multiple fungicide resistance and are dominated by a novel clade close to Botrytis cinerea. Appl. Environ. Microbiol. 2013, 79, 159–167. [Google Scholar] [CrossRef]
- Hahn, M. The rising threat of fungicide resistance in plant pathogenic fungi: Botrytis as a case study. J. Chem. Biol. 2014, 7, 133–141. [Google Scholar] [CrossRef] [PubMed]
- Esterio, M.; Osorio-Navarro, C.; Rodríguez, D.; Copier, C.; Azócar, M.; Rubilar, M.; Estrada, V.; Auger, J. Chilean Botrytis cinerea isolates with reduced sensitivity to fludioxonil exhibit low to null fitness penalties. Plant Dis. 2024. [Google Scholar] [CrossRef]
- Wang, Y.F.; Hao, F.M.; Zhou, H.H.; Chen, J.B.; Su, H.C.; Yang, F.; Cai, Y.Y.; Li, G.L.; Zhang, M.; Zhou, F. Exploring potential mechanisms of fludioxonil resistance in Fusarium oxysporum f. sp. melonis. J. Fungi 2022, 8, 839. [Google Scholar] [CrossRef]
- Wang, W.; Fang, Y.; Imran, M.; Hu, Z.; Zhang, S.; Huang, Z.; Liu, X. Characterization of the field fludioxonil resistance and its molecular basis in Botrytis cinerea from Shanghai province in China. Microorganisms 2021, 9, 266. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Lu, G.; Moriyama, E.N. Vector NTI, a balanced all-in-one sequence analysis suite. Brief Bioinform. 2005, 5, 378–388. [Google Scholar] [CrossRef]
- Paysan-Lafosse, T.; Blum, M.; Chuguransky, S.; Grego, T.; Pinto, B.L.; Salazar, G.A.; Bileschi, M.L.; Bork, P.; Bridge, A.; Colwell, L.; et al. InterPro in 2022. Nucleic Acids Res. 2022, 51, D418–D427. [Google Scholar] [CrossRef] [PubMed]
- Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J.E. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef]
- Roberts, E.; Eargle, J.; Wright, D.; Luthey-Schulten, Z. Multiseq: Unifying sequence and structure data for evolutionary analysis. BMC Bioinform. 2006, 7, 382. [Google Scholar] [CrossRef] [PubMed]
- Morris, G.M.; Huey, R.; Lindstrom, W.; Sanner, M.F.; Belew, R.K.; Goodsell, D.S.; Olson, D.J. AutoDock4 and AutoDocksTools4: Automated docking with selective receptor flexibility. J. Comput. Chem. 2009, 30, 2785–2791. [Google Scholar] [CrossRef] [PubMed]
- Di Rienzo, J.A.; Casanoves, F.; Balzarini, M.G.; Gonzalez, L.; Tablada, M.; Robledo, C.W. InfoStat: Manual del Usuario. Grupo InfoStat, FCA, Universidad Nacional de Córdoba, Argentina. 2008. Available online: https://www.infostat.com.ar/ (accessed on 20 March 2022).
- Dowling, M.; Gelain, J.; De Mio, L.; Schnabel, G. Characterization of high fludioxonil resistance in Botrytis cinerea isolates from calibrachoa flowers. Phytopathology 2021, 111, 478–484. [Google Scholar] [CrossRef]
- Sang, C.; Ren, W.; Wang, J.; Xu, H.; Zhang, Z.; Zhou, M.; Chen, C.; Wang, K. Detection and fitness comparison of target-based highly fludioxonil-resistant isolates of Botrytis cinerea from strawberry and cucumber in China. Pestic. Biochem. Physiol. 2018, 147, 110–118. [Google Scholar] [CrossRef]
- Viaud, M.; Fillinger, S.; Lui, W.; Polepalli, J.S.; Le Pêcheur, P.; Kunduru, A.R.; Leroux, P.; Legendre, L. A class III histidine kinase acts as a novel virulence factor in Botrytis cinerea. Mol. Plant Microbe Interact. 2006, 19, 1042–1050. [Google Scholar] [CrossRef]
- Ma, Z.; Yan, L.; Luo, Y.; Michailides, T.J. Sequence variation in the two-component histidine kinase gene of Botrytis cinerea associated with resistance to dicarboximide fungicides. Pestic. Biochem. Physiol. 2007, 88, 300–306. [Google Scholar] [CrossRef]
- Liu, W.; Leroux, P.; Fillinger, S. The HOG1-like MAP kinase Sak1 of Botrytis cinerea is negatively regulated by the upstream histidine kinase Bos1 and is not involved in dicarboximide- and phenylpyrrole- resistance. Fungal Genet. Biol. 2008, 45, 1062–1074. [Google Scholar] [CrossRef] [PubMed]
- Hu, M.; Cosseboom, S.; Schnabel, G. atrB-Associated fludioxonil resistance in Botrytis fragariae not linked to mutations in transcription factor Mrr1. Phytopathology 2019, 109, 839–846. [Google Scholar] [CrossRef] [PubMed]
- Carugo, O.; Pongor, S. A normalized root-mean-square distance for comparing protein three-dimensional structures. Protein Sci. 2001, 10, 1470–1473. [Google Scholar] [CrossRef]
- Smith, P.C.; Karpowich, N.; Millen, L.; Moody, J.E.; Rosen, J.; Thomas, P.J.; Hunt, J.F. ATP binding to the motor domain from an ABC transporter drives formation of a nucleotide sandwich dimer. Mol. Cell 2002, 10, 139–149. [Google Scholar] [CrossRef] [PubMed]
N° of Isolates | Nomenclature ** | Region | Season | EC50 Fludioxonil (μg/mL) | Sensitivity to Fludioxonil |
---|---|---|---|---|---|
1 * | - | - | - | 0.01 | S |
2 | FBB7 9A3 | Valparaíso | 2017/2018 | 0.011 | S |
3 | FCF6 41B1 | Valparaíso | 2016/2017 | 0.013 | S |
4 | FBF7 10A2 | Valparaíso | 2017/2018 | 0.014 | S |
5 | FBF7 10A3 | Valparaíso | 2017/2018 | 0.016 | S |
6 | FCF7 44D1 | Valparaíso | 2017/2018 | 0.022 | S |
7 | FCF7 44D2 | Valparaíso | 2017/2018 | 0.026 | S |
8 | FCF7 45B1 | De O’Higgins | 2017/2018 | 0.045 | S |
9 | FCF7 45B2 | Valparaíso | 2017/2018 | 0.048 | S |
10 | FCF7 45B3 | Metropolitan | 2017/2018 | 0.055 | S |
11 | FBF6 18B4 | Valparaíso | 2016/2017 | 1.08 | R |
12 | FBF6 11B4 | Valparaíso | 2016/2017 | 1.09 | R |
13 | FBF6 18B3 | Valparaíso | 2016/2017 | 1.10 | R |
14 | FBF7 7B10 | Valparaíso | 2017/2018 | 1.11 | R |
15 | FBF6 12A3 | Valparaíso | 2016/2017 | 1.14 | R |
16 | FBF6 18B1 | De O’Higgins | 2016/2017 | 1.17 | R |
17 | FBF6 12C1 | Valparaíso | 2016/2017 | 1.19 | R |
18 | FDF6 33 C2 | Valparaíso | 2016/2017 | 1.22 | R |
19 | FBF7 7B6 | Valparaíso | 2017/2018 | 1.24 | R |
20 | FBF7 8D1 | Valparaíso | 2017/2018 | 1.25 | R |
21 | FBF6 14C2 | Valparaíso | 2016/2017 | 1.30 | R |
22 | FBF6 11B3 | Valparaíso | 2016/2017 | 1.37 | R |
23 | FBF7 7B2 | Valparaíso | 2017/2018 | 1.44 | R |
24 | FBF7 8B2 | Valparaíso | 2017/2018 | 1.46 | R |
25 | FBF6 15B3 | Valparaíso | 2016/2017 | 1.47 | R |
26 | FBF6 11C2 | Valparaíso | 2016/2017 | 1.50 | R |
27 | FBF6 15B1 | Valparaíso | 2016/2017 | 1.51 | R |
28 | FBF7 7B1 | Valparaíso | 2017/2018 | 1.68 | R |
29 | FBF7 8B3 | Valparaíso | 2017/2018 | 2.04 | R |
30 | FBF7 6B3 | Valparaíso | 2017/2018 | 2.21 | R |
31 | FBF7 6A1 | Valparaíso | 2017/2018 | 2.22 | R |
32 | FBF7 6C1 | Valparaíso | 2017/2018 | 2.37 | R |
Primer Name | Sequence 5′->3′ | T° Annealing (°C) | Fragment Size (bp) |
---|---|---|---|
BcatrB_qPCR_F | ACGTTTGACAATTGGTGTGG | 55 | 150 |
BcatrB_qPCR_R | GAGTTGAGCGGAAGGTTGAT | 55 | 150 |
Bcact_qPCR_F | CTGGTCGTGATTTGACTGATTA | 55 | 100 |
Bcact_qPCR_R | GATTGACTGGCGGTTTGG | 55 | 100 |
Primer Name | Sequence 5′->3′ | T° Annealing (°C) | Fragment Size (bp) |
---|---|---|---|
BcartB_1F | ATGAGCTACACAGGGATCGAA | 60 | 913 |
BcartB_1R | CGCAGTTTGTCAAAGCCGTC | 60 | 913 |
BcartB_2F | AGTATGGATTCGGGCGAGTG | 56 | 1125 |
BcartB_2R | TGTGGTCGAACAATCGAGGA | 56 | 1125 |
BcartB_3F | CATCAAGGGGTTTCCGGTT | 60 | 978 |
BcartB_3R | GAAACACGCTTACGCTCACC | 60 | 978 |
BcartB_4F | AGCACACCAATACCGAGGAC | 51 | 843 |
BcartB_4R | CGCAAGCTTTGACTTGGGTC | 51 | 843 |
BcartB_5F | CTACCACCGCCATCGCTAAA | 60 | 782 |
BcartB_5R | CACAAGCTTGGAACGCCAAA | 60 | 782 |
BcartB_6F | CTTGCCTATGGCTTTTCGGC | 54 | 779 |
BcartB_6R | GTCGGGGACGGTTCTTGATT | 54 | 779 |
BcartB_7F | AAGCCGGGTATGTTAGGTGC | 61 | 964 |
BcartB_7R | AGACCGCCGACTGAATGTTT | 61 | 964 |
BcartB_8F | CTGGCTCAACTCTCCCGAAT | 53 | 794 |
BcartB_8R | TACTCGCCACAAGTGCCATT | 53 | 794 |
BcartB_9F | CCTCGTCTTCACCAGTTGGG | 63 | 842 |
BcartB_9R | TCTTGGGGATTTGCCGATGT | 63 | 842 |
Bcmrr1_1F | GGATGCGGATGGTTACGGAT | 60 | 1057 |
Bcmrr1_1R | TGATGGCGGATTTGACCGAA | 60 | 1057 |
Bcmrr1_2F | TAATCAGGCATCTGGCACGG | 62 | 921 |
Bcmrr1_2R | CGATCATGAGTGCGCATAGC | 62 | 921 |
Bcmrr1_3F | GTCTCGAGGCTAGCGTGTTT | 63 | 938 |
Bcmrr1_3R | AACCGCAATTACATGCCACG | 63 | 938 |
Bcmrr1_4F | CTCGAGGACAATCCTTGCGT | 62 | 867 |
Bcmrr1_4R | GTGCTTGCTTGAAAGTGCGA | 62 | 867 |
Bcmrr1_5F | AGTTTGTAGCGATGGACCCC | 60 | 1203 |
Bcmrr1_5R | CGTCAGTGTCGCCCAGAATA | 60 | 1203 |
Bcmrr1_6F | ACGGAATCGATGCCTGTGAA | 60 | 959 |
Bcmrr1_6R | ATATCTGCGGCAGCCTTGAG | 60 | 959 |
N° of Isolates | EC50 Fludioxonil (μg/mL) | Sensitivity to Fludioxonil | Nucleotide Changes in the Intergenic Region | Nucleotide Changes in the Coding Region | Amino acid Changes | Genotype |
---|---|---|---|---|---|---|
2 | 0.011 | sensitive | T-490C; A-858G; C-1259T; T-1614C; A-1748G; T-1757C | C3591T | N.D. | 1 |
4 | 0.014 | sensitive | ||||
5 | 0.016 | sensitive | ||||
8 | 0.045 | sensitive | ||||
9 | 0.048 | sensitive | ||||
12 | 1.09 | resistant | ||||
16 | 1.17 | resistant | ||||
17 | 1.19 | resistant | ||||
19 | 1.24 | resistant | ||||
26 | 1.50 | resistant | ||||
28 | 1.68 | resistant | ||||
29 | 2.04 | resistant | ||||
3 | 0.013 | sensitive | C-67T; G-68T; G-413A; T-490C; G-710A; A-858G; C-1259T; T-1694G; A-1748G; C-1756T; T-1757C; C-1779T | A369G; A1200G; T3675C | N.D. | 2 |
6 | 0.022 | sensitive | ||||
7 | 0.026 | sensitive | ||||
10 | 0.055 | sensitive | ||||
11 | 1.08 | resistant | ||||
18 | 1.22 | resistant | ||||
13 | 1.10 | resistant | N.D | T1149C; A1200G; A1645G; A2143C; C2169T; T2209C; G2287T; T2323G; C2325T; C2379T; A2390G; C2457T; G2479A; T3675C | N715H; Y737H; A763S; S775A; E797G | 3 |
14 | 1.11 | resistant | ||||
15 | 1.14 | resistant | ||||
20 | 1.25 | resistant | ||||
21 | 1.30 | resistant | ||||
22 | 1.37 | resistant | ||||
23 | 1.44 | resistant | ||||
24 | 1.46 | resistant | ||||
25 | 1.47 | resistant | ||||
27 | 1.51 | resistant | A-54G; T-187G; T-252C; C-256T; G-631T; A-858G; A-1172T; C-1259T; A-1313G; C-1378T; A-1410C; A-1413G; G-1419T; A-1603T; A-1748G; T-1757C; T-1769C; G-1782C | A684T; A921C; T1149C; A1200G; T2316C; C2325T; T3675C; C3768T; A3915G | N.D. | 4 |
30 | 2.21 | resistant | ||||
31 | 2.22 | resistant | ||||
32 | 2.37 | resistant |
Efficiency Parameters (Kcal/mol) | ||||||
---|---|---|---|---|---|---|
Binding Energy | Ligand Efficiency | Intermolar Energy | Electrostatic Energy | Torsional Energy | Free Energy | |
WTP-ATP | 0.97 | 0.03 | 3.5 | 1.97 | 4.47 | 7.13 |
MP-ATP | 0.97 | 0.03 | 3.5 | 1.97 | 4.47 | 7.13 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Copier, C.; Osorio-Navarro, C.; Maldonado, J.E.; Auger, J.; Silva, H.; Esterio, M. A Conservative Mutant Version of the Mrr1 Transcription Factor Correlates with Reduced Sensitivity to Fludioxonil in Botrytis cinerea. Pathogens 2024, 13, 374. https://doi.org/10.3390/pathogens13050374
Copier C, Osorio-Navarro C, Maldonado JE, Auger J, Silva H, Esterio M. A Conservative Mutant Version of the Mrr1 Transcription Factor Correlates with Reduced Sensitivity to Fludioxonil in Botrytis cinerea. Pathogens. 2024; 13(5):374. https://doi.org/10.3390/pathogens13050374
Chicago/Turabian StyleCopier, Charleen, Claudio Osorio-Navarro, Jonathan E. Maldonado, Jaime Auger, Herman Silva, and Marcela Esterio. 2024. "A Conservative Mutant Version of the Mrr1 Transcription Factor Correlates with Reduced Sensitivity to Fludioxonil in Botrytis cinerea" Pathogens 13, no. 5: 374. https://doi.org/10.3390/pathogens13050374