Molecular Characterization and Antibacterial Resistance Determination of Escherichia coli Isolated from Fresh Raw Mussels and Ready-to-Eat Stuffed Mussels: A Major Public Health Concern
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Isolation and Enumeration of E. coli
2.3. Identification of E. coli Isolates
2.4. Determination of Phylogenetic Groups of E. coli Isolates
2.5. Antibacterial Resistance Testing of E. coli Isolates
2.6. Phenotypic Test for the Presence of Extended-Spectrum β-Lactamase (ESβL) in E. coli Isolates
2.7. Identification of β-Lactamase and Antibacterial Resistance Genes of E. coli Isolates
2.8. Virulence Factor Genes of E. coli Isolates
3. Results
3.1. Isolation, Enumeration, and Identification
3.2. Determination of Phylogenetic Groups
3.3. Phenotypic and Genotypic Identification of Antibacterial Resistance and ESBL of E. coli Isolates
3.4. Identification of Virulence Factor Genes of E. coli Isolates
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yaghubi, E.; Carboni, S.; Snipe, R.M.J.; Shaw, C.S.; Fyfe, J.J.; Smith, C.M. Farmed mussels: A nutritive protein source, rich in omega-3 fatty acids, with a low environmental footprint. Nutrients 2021, 13, 1124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mititelu, M.; Neacșu, S.M.; Oprea, E.; Dumitrescu, D.-E.; Nedelescu, M.; Drăgănescu, D.; Nicolescu, T.O.; Roșca, A.C.; Ghica, M. Black Sea mussels qualitative and quantitative chemical analysis: Nutritional benefits and possible risks through consumption. Nutrients 2022, 14, 964. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kisla, D.; Uzgun, Y. Microbiological evaluation of stuffed mussels. J. Food Prot. 2008, 7, 616–620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yohans, H.; Mitiku, B.A.; Tassew, H. Levels of Escherichia coli as bio-indicator of contamination of fish food and antibiotic resistance pattern along the value chain in Northwest Ethiopia. Vet. Med. 2022, 13, 299–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ilic, N.; Velebit, B.; Teodorovic, V.; Djordjevic, V.; Karabasil, N.; Vasilev, D.; Djuric, S.; Adzic, B.; Dimitrijevic, M. Influence of environmental conditions on Norovirus presence in mussels harvested in Montenegro. Food Environ. Virol. 2017, 9, 406–414. [Google Scholar] [CrossRef] [Scilit]
- Mannas, H.; Mimouni, R.; Chaouqy, N.; Hamadi, F.; Martinez-Urtaza, J. Occurrence of Vibrio and Salmonella species in mussels (Mytilus galloprovincialis) collected along the Moroccan Atlantic coast. Springerplus 2014, 3, 265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jozić, S.; Vukić, L.D.; Aljinović, A.; Vlakančić, W.; Cenov, A.; Vrdoljak, T.A.; Rakić, A.; Šolić, M. Is TBX agar a suitable medium for monitoring Escherichia coli in bathing water using the membrane filtration method? Environ. Monit. Assess. 2019, 191, 558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kijewska, A.; Koroza, A.; Grudlewska-Buda, K.; Kijewski, T.; Wiktorczyk-Kapischke, N.; Zorena, K.; Skowron, K. Molluscs—A ticking microbial bomb. Front. Microbiol. 2023, 13, 1061223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shuping, L.S.; Human, I.S.; Lues, J.F.R.; Paulse, A.N. The prevalence of viruses related to the production of mussels and oysters in Saldanha Bay: A systematic review. Aquac. J. 2023, 3, 90–106. [Google Scholar] [CrossRef] [Scilit]
- Bunduki, G.K.; Heinz, E.; Phiri, V.S.; Noah, P.; Feasey, N.; Musaya, J. Virulence factors and antimicrobial resistance of uropathogenic Escherichia coli (UPEC) isolated from urinary tract infections: A systematic review and meta-analysis. BMC Infect. Dis. 2021, 21, 753. [Google Scholar] [CrossRef] [Scilit]
- de Nies, L.; Lopes, S.; Busi, S.B.; Galata, V.; Heintz-Buschart, A.; Laczny, C.C.; May, P.; Wilmes, P. PathoFact: A pipeline for the prediction of virulence factors and antimicrobial resistance genes in metagenomic data. Microbiome 2021, 9, 49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koga, V.L.; Rodrigues, G.R.; Scandorieiro, S.; Vespero, E.C.; Oba, A.; de Brito, B.G.; de Brito, K.C.; Nakazato, G.; Kobayashi, R.K. Evaluation of the antibiotic resistance and virulence of Escherichia coli strains isolated from chicken carcasses in 2007 and 2013 from Paraná, Brazil. Foodborne Pathog. Dis. 2015, 12, 479–485. [Google Scholar] [CrossRef] [Scilit]
- Ates, M.; Ozkizilcik, A.; Tabakoglu, C. Microbiological analysis of stuffed mussels sold in the streets. Indian J. Med. 2011, 51, 350–354. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karademir, F.; Kahraman, T. Microbiological quality of stuffed mussels consumed in Istanbul. Kocatepe Vet. J. 2021, 14, 436–443. [Google Scholar] [CrossRef] [Scilit]
- Kafa, B.; Kilinc, B. Microbiological quality of frozen black mussels (Mytilus galloprovincialis, Lamarck, 1819) purchased from markets in the Izmir Province of Turkey. EgeJFAS 2021, 38, 167–172. [Google Scholar] [CrossRef] [Scilit]
- Mudadu, A.; Spanu, C.; Pantoja, J.; Dos Santos, M.; De Oliveira, C.; Salza, S.; Piras, G.; Uda, M.T.; Virgilio, S.; Giagnoni, L.; et al. Association between Escherichia coli and Salmonella spp. food safety criteria in live bivalve molluscs from wholesale and retail markets. Food Cont. 2022, 137, 108942. [Google Scholar] [CrossRef] [Scilit]
- Nuñal, S.N.; Jane, M.; Monaya, K.; Rose, T.; Mueda, C.; Mae Santander-De Leon, S. Microbiological quality of oysters and mussels along its market supply chain. J. Food Prot. 2023, 86, 100063. [Google Scholar] [CrossRef] [Scilit]
- Selegean, J.P.; Kusserow, R.; Patel, R.; Heidtke, T.M.; Ram, J.L. Using zebra mussels to monitor Escherichia coli in environmental waters. J. Environ. Qual. 2011, 30, 171–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vásquez-García, A.; Oliveira, A.P.S.C.D.; Mejia-Ballesteros, J.E.; Godoy, S.H.S.D.; Barbieri, E.; Sousa, R.L.M.D.; Fernandes, A.M. Escherichia coli detection and identification in shellfish from southeastern Brazil. Aquaculture 2019, 504, 158–163. [Google Scholar] [CrossRef] [Scilit]
- ISO 16649-2:2001; Microbiology of Food and Animal Feeding Stuffs. Horizontal Method for the Enumeration of Beta-Glucuronidase-Positive Escherichia coli. Part 2: Colony-Count Technique at 44 °C Using 5-bromo-4-chloro-3-indolyl Beta-D-glucuronide. International Organization for Standardization: Geneva, Switzerland, 2001.
- Davidson, P.M.; Roth, L.A.; Gambrel-Lenarz, S.A.; Bruhn, J. Chapter 7, Coliform and other indicator bacteria. In Standard Methods for the Examination of Dairy Products, 17th ed.; Wehr, H.M., Frank, J.F., Eds.; American Public Health Association: Washington, DC, USA, 2004; ISBN 978-0-87553-002-4. [Google Scholar]
- Chen, J.; Griffiths, M.W. PCR Differentiation of Escherichia coli from other gram-negative bacteria using primers derived from the nucleotide sequences flanking the gene encoding the universal stress protein. Lett. Appl. Microbiol. 1998, 27, 369–371. [Google Scholar] [CrossRef] [Scilit]
- Heijnen, L.; Medema, G. Quantitative Detection of E. coli, E. coli O157 and other Shiga toxin producing E. coli in water samples using a culture method combined with real-time PCR. J. Water Health 2006, 4, 487–498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clermont, O.; Bonacorsis, S.; Bingen, E. Rapid and simple determination of Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 2000, 66, 4555–4558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clermont, O.; Christenson, J.K.; Denamur, E.; Gordon, D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-group. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alfinete, N.W.; Bolukaoto, J.Y.; Heine, L.; Potgieter, N.; Barnard, T.G. Virulence and phylogenetic analysis of enteric pathogenic Escherichia coli isolated from children with diarrhoea in South Africa. Int. J. Infect. Dis. 2022, 114, 226–232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 33rd ed.; CLSI supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023. [Google Scholar]
- EUCAST. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 13.1. 2023. Available online: https://acslm.ie/?page_id=13220 (accessed on 4 April 2024).
- Ogutu, J.O.; Zhang, Q.; Huang, Y.; Yan, H.; Su, L.; Gao, B.; Zhang, W.; Zhao, J.; Cai, W.; Li, W.; et al. Development of a multiplex PCR system and its application in detection of blaSHV, blaTEM, blaCTX-M-1, blaCTX-M-9 and blaOXA-1 group genes in clinical Klebsiella pneumoniae and Escherichia coli strains. J. Antibiot. 2015, 68, 725–733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duman, M.; Saticioglu, I.B.; Buyukekiz, A.G.; Balta, F.; Altun, S. Molecular characterization and antimicrobial resistance profile of atypical Citrobacter gillenii and Citrobacter sp. isolated from diseased rainbow trout (Oncorhynchus mykiss). J. Global Antimicrob. Resist. 2017, 10, 136–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saticioglu, I.B.; Duman, M.; Smith, P.; Wiklund, T.; Altun, S. Antimicrobial resistance and resistance genes in Flavobacterium psychrophilum isolates from Turkey. Aquaculture 2019, 512, 734293. [Google Scholar] [CrossRef] [Scilit]
- ISO/TS 13136:2012; Microbiology of Food and Animal Feed. Real-Time Polymerase Chain Reaction (PCR)-Based Method for the Detection of Food-Borne Pathogens. Horizontal Method for the Detection of Shiga Toxin-Producing Escherichia coli (STEC) and the Determination of O157, O111, O26, O103, and O145 Serogroups. International Organization for Standardization: Geneva, Switzerland, 2012.
- Bennani, M.; Badri, S.; Baibai, T.; Oubrim, N.; Hassar, M.; Cohen, N.; Amarouch, H. First detection of Shiga toxin-producing Escherichia coli in shellfish and coastal environments of Morocco. Appl. Biochem. Biotechnol. 2011, 165, 290–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, A.S.; Nayak, B.B.; Kumar, S.H. High Prevalence of multiple antibiotic-resistant, extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli in fresh seafood sold in retail markets of Mumbai, India. Vet. Sci. 2020, 7, 46. [Google Scholar] [CrossRef] [Scilit]
- Bingol, B.E.; Colak, H.; Muratoglu, K.; Hampikyan, H. The microbiological quality of stuffed mussels (Midye Dolma) sold in Istanbul. Brit. Food J. 2008, 110, 1079–1087. [Google Scholar] [CrossRef] [Scilit]
- Hunt, J.M. Shiga Toxin-Producing Escherichia coli (STEC). Clin. Lab. Med. 2010, 30, 21–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pakbin, B.; Allahyari, S.; Amani, Z.; Bruck, W.M.; Mahmoudi, R.; Peymani, A. Prevalence, phylogroups, and antimicrobial susceptibility of Escherichia coli isolates from food products. Antibiotics 2021, 10, 1291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bazzoni, A.M.; Mudadu, A.G.; Esposito, G.; Urru, R.; Ortu, S.; Mara, L.; Uda, M.T.; Arras, I.; Lorenzoni, G.; Sanna, G.; et al. Bacterial and viral investigations combined with determination of phytoplankton and algal biotoxins in mussels and water from a Mediterranean coastal lagoon (Sardinia, Italy). J. Food Prot. 2019, 82, 1501–1511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sferlazzo, G.; Meloni, D.; Lamon, S.; Marceddu, M.; Mureddu, A.; Consolati, S.G.; Pisanu, M.; Virgilio, S. Evaluation of short purification cycles in naturally contaminated Mediterranean mussels (Mytilus galloprovincialis) harvested in Sardinia (Italy). Food Microbiol. 2018, 74, 86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamon, S.; Piras, F.; Meloni, D.; Agus, V.; Porcheddu, G.; Pes, M.; Cambula, M.G.; Esposito, G.; Fois, F.; Consolati, S.G.; et al. Enumeration of Escherichia coli and determination of Salmonella spp. and verotoxigenic Escherichia coli in shellfish (Mytilus galloprovincialis and Ruditapes decussatus) harvested in Sardinia, Italy. Ital. J. Food Saf. 2020, 9, 195–200. [Google Scholar]
- Normanno, G.; Parisi, A.; Addante, N.; Quaglia, N.C.; Dambrosio, A.; Montagna, C.; Chiocco, D. Vibrio parahaemolyticus, Vibrio vulnificus and microorganisms of fecal origin in mussels (Mytilus galloprovincialis) sold in the Puglia region (Italy). Int. J. Food Microbiol. 2006, 106, 219–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katongole, P.; Bulwadda, K.D.; Kyobe, B.H.; Patrick, K.D.; Florence, N.C. Phylogenetic groups and antimicrobial susceptibility patterns of uropathogenic Escherichia coli clinical isolates from patients at Mulago National Referral Hospital, Kampala, Uganda. F1000Research 2019, 8, 1828. [Google Scholar] [CrossRef] [Scilit]
- Redha, M.A.; Al Sweih, N.; Albert, M.J. Virulence and phylogenetic groups of Escherichia coli cultured from raw sewage in Kuwait. Gut Pathog. 2022, 14, 18. [Google Scholar] [CrossRef] [Scilit]
- Beghain, J.; Bridier-Nahmias, A.; Le Nagard, H.; Denamur, E.; Clermont, O. ClermonTyping: An easy-to-use and accurate in silico method for Escherichia genus strain phylotyping. Microb. Genom. 2018, 4, e000192. [Google Scholar] [CrossRef] [Scilit]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit]
- Rashid, M.; Kotwal, S.K.; Malik, M.; Singh, M. Prevalence, genetic profile of virulence determinants and multidrug resistance of Escherichia coli isolates from foods of animal origin. Vet. World 2013, 6, 139–142. [Google Scholar] [CrossRef] [Scilit]
- Gow, N.A.R.; Johnson, C.; Berman, J.; Coste, A.T.; Cuomo, C.A.; Perlin, D.S.; Bicanic, T.; Harrison, T.S.; Wiederhold, N.; Bromley, M.; et al. The importance of antimicrobial resistance in medical mycology. Nat. Commun. 2022, 13, 5352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, S.; Liao, C.; Peng, J.; Tao, S.; Zhang, T.; Dai, Y.; Ding, Y.; Ma, Y. Resistance and virulence gene analysis and molecular typing of Escherichia coli from duck farms in Zhanjiang, China. Front. Cell. Infect. Microbiol. 2023, 13, 1202013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mwakyoma, A.A.; Kidenya, B.R.; Minja, C.A.; Mushi, M.F.; Sandeman, A.; Sabiti, W.; Holden, M.T.G.; Mshana, S.E. Comparison of horizontal blaCTX-M gene transfer via conjugation among extended spectrum β-lactamases producing Escherichia coli isolates from patients with urinary tract infection, their animals, and environment. Arch. Mol. Biol. Genet. 2023, 2, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Shin, S.W.; Shin, M.K.; Jung, M.; Belaynehe, K.M.; Yoo, H.S. Prevalence of antimicrobial resistance and transfer of tetracycline resistance genes in Escherichia coli isolates from beef cattle. Appl. Environ. Microbiol. 2015, 81, 5560–5566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al Qabili, D.M.A.; Aboueisha, A.M.; Ibrahim, G.A.; Youssef, A.I.; El-Mahallawy, H.S. Virulence and antimicrobial-resistance of shiga toxin-producing E. coli (STEC) isolated from edible shellfish and its public health significance. Arch. Microbiol. 2022, 204, 510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baliere, C.; Rince, A.; Blanco, J.; Dahbi, G.; Harel, J.; Vogeleer, P.; Giard, J.C.; Mariani-Kurkdjian, P.; Gourmelon, M. Prevalence and characterization of shiga toxin-producing and enteropathogenic Escherichia coli in shellfish-harvesting areas and their watersheds. Front. Microbiol. 2015, 6, 1356. [Google Scholar] [CrossRef] [Scilit]
- Martin, C.C.; Svanevik, C.S.; Lunestad, B.T.; Sekse, C.; Johannessen, G.S. Isolation and characterisation of Shiga toxin-producing Escherichia coli from Norwegian bivalves. Food Microbiol. 2019, 84, 103268. [Google Scholar] [CrossRef] [Scilit]

| Primer ID | Target | Primer Sequence (5′-3′) | PCR Size (bp) |
|---|---|---|---|
| uidA.f | uidA | ATGGAATTTCGCCGATTTTGC | 166 |
| uidA.r | ATTGTTTGCCTCCCTGCTGC | ||
| uspA.f | uspA | CCGATACGCTGCCAATCAGT | 884 |
| uspA.r | ACGCAGACCGTAGGCCAGAT | ||
| chuA.1b | chuA | ATGGTACCGGACGAACCAAC | 288 |
| chuA.2 | TGCCGCCAGTACCAAAGACA | ||
| yjaA.1b | yjaA | CAAACGTGAAGTGTCAGGAG | 211 |
| yjaA.2b | AATGCGTTCCTCAACCTGTG | ||
| TspE4C2.1b | TspE4C2 | CACTATTCGTAAGGTCATCC | 152 |
| TspE4C2.2b | AGTTTATCGCTGCGGGTCGC | ||
| AceK.f | arpA | AACGCTATTCGCCAGCTTGC | 400 |
| ArpA1.r | TCTCCCCATACCGTACGCTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yibar, A.; Saticioglu, I.B.; Ajmi, N.; Duman, M. Molecular Characterization and Antibacterial Resistance Determination of Escherichia coli Isolated from Fresh Raw Mussels and Ready-to-Eat Stuffed Mussels: A Major Public Health Concern. Pathogens 2024, 13, 532. https://doi.org/10.3390/pathogens13070532
Yibar A, Saticioglu IB, Ajmi N, Duman M. Molecular Characterization and Antibacterial Resistance Determination of Escherichia coli Isolated from Fresh Raw Mussels and Ready-to-Eat Stuffed Mussels: A Major Public Health Concern. Pathogens. 2024; 13(7):532. https://doi.org/10.3390/pathogens13070532
Chicago/Turabian StyleYibar, Artun, Izzet B. Saticioglu, Nihed Ajmi, and Muhammed Duman. 2024. "Molecular Characterization and Antibacterial Resistance Determination of Escherichia coli Isolated from Fresh Raw Mussels and Ready-to-Eat Stuffed Mussels: A Major Public Health Concern" Pathogens 13, no. 7: 532. https://doi.org/10.3390/pathogens13070532
APA StyleYibar, A., Saticioglu, I. B., Ajmi, N., & Duman, M. (2024). Molecular Characterization and Antibacterial Resistance Determination of Escherichia coli Isolated from Fresh Raw Mussels and Ready-to-Eat Stuffed Mussels: A Major Public Health Concern. Pathogens, 13(7), 532. https://doi.org/10.3390/pathogens13070532

