mRNA Profiling and Transcriptomics Analysis of Chickens Received Newcastle Disease Virus Genotype II and Genotype VII Vaccines
Abstract
:1. Introduction
2. Materials and Methods
2.1. Viruses and Vaccines
2.2. Animal Experiments
2.3. RNA Preparation and Sequencing
2.4. Transcriptome and Pathway Analysis of Vaccinated Chickens Differential Expression Genes (DEGs)
2.5. Validation of RNA Sequencing Using Quantitative PCR (qPCR)
3. Results
3.1. RNA-Sequencing Reads
3.2. Gene Expression Induced by GII-Vacc and GVII-Vacc
3.3. Ingenuity Pathway Analysis of Spleen of Chickens Vaccinated with GII-Vacc
3.4. Ingenuity Pathway Analysis of Chickens Vaccinated with GVII-Vacc
3.5. The Results of RNA-Sequencing and Gene Expression Validation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rushton, J.; Gilbert, W. The economics of animal health: Direct and indirect costs of animal disease outbreaks. In Proceedings of the 84th World Assembly of OIE, Paris, France, 22–27 May 2016. [Google Scholar]
- Rima, B.; Balkema-Buschmann, A.; Dundon, W.G.; Duprex, P.; Easton, A.; Fouchier, R.; Kurath, G.; Lamb, R.; Lee, B.; Rota, P.; et al. ICTV Virus Taxonomy Profile: Paramyxoviridae. J. Gen. Virol. 2019, 100, 1593–1594. [Google Scholar] [CrossRef] [PubMed]
- Miller, P.J.; Haddas, R.; Simanov, L.; Lublin, A.; Rehmani, S.F.; Wajid, A.; Bibi, T.; Khan, T.A.; Yaqub, T.; Setiyaningsih, S.; et al. Identification of new sub-genotypes of virulent Newcastle disease virus with potential panzootic features. Infect. Genet. Evol. 2015, 29, 216–229. [Google Scholar] [CrossRef]
- Dimitrov, K.M.; Abolnik, C.; Afonso, C.L.; Albina, E.; Bahl, J.; Berg, M.; Briand, F.-X.; Brown, I.H.; Choi, K.-S.; Chvala, I.; et al. Updated unified phylogenetic classification system and revised nomenclature for Newcastle disease virus. Infect. Genet. Evol. 2019, 74, 103917. [Google Scholar] [CrossRef]
- Dewidar, A.A.A.; Kilany, W.H.; El-Sawah, A.A.; Shany, S.A.S.; Dahshan, A.M.; Hisham, I.; Elkady, M.F.; Ali, A. Genotype VII.1.1-Based Newcastle Disease Virus Vaccines Afford Better Protection against Field Isolates in Commercial Broiler Chickens. Animals 2022, 12, 1696. [Google Scholar] [CrossRef]
- Eid, A.A.M.; Hussein, A.; Hassanin, O.; Elbakrey, R.M.; Daines, R.; Sadeyen, J.R.; Abdien, H.M.F.; Chrzastek, K.; Iqbal, M. Newcastle Disease Genotype VII Prevalence in Poultry and Wild Birds in Egypt. Viruses 2022, 14, 2244. [Google Scholar] [CrossRef]
- Ewies, S.S.; Ali, A.; Tamam, S.M.; Madbouly, H.M. Molecular characterization of Newcastle disease virus (genotype VII) from broiler chickens in Egypt. Beni. Suef Univ. J. Basic Appl. Sci. 2017, 6, 232–237. [Google Scholar] [CrossRef]
- Snoeck, C.J.; Owoade, A.A.; Couacy-Hymann, E.; Alkali, B.R.; Okwen, M.P.; Adeyanju, A.T.; Komoyo, G.F.; Nakouné, E.; Faou, A.L.; Muller, C.P. High Genetic Diversity of Newcastle Disease Virus in Poultry in West and Central Africa: Cocirculation of Genotype XIV and Newly Defined Genotypes XVII and XVIII. J. Clin. Microbiol. 2013, 51, 2250–2260. [Google Scholar] [CrossRef] [PubMed]
- Nooruzzaman, M.; Hossain, I.; Begum, J.A.; Moula, M.; Khaled, S.A.; Parvin, R.; Chowdhury, E.H.; Islam, M.R.; Diel, D.G.; Dimitrov, K.M. The First Report of a Virulent Newcastle Disease Virus of Genotype VII.2 Causing Outbreaks in Chickens in Bangladesh. Viruses 2022, 14, 2627. [Google Scholar] [CrossRef]
- Yang, H.-m.; Zhao, J.; Xue, J.; Yang, Y.-L.; Zhang, G.-Z. Antigenic variation of LaSota and genotype VII Newcastle disease virus (NDV) and their efficacy against challenge with velogenic NDV. Vaccine 2017, 35, 27–32. [Google Scholar] [CrossRef]
- Turan, N.; Ozsemir, C.; Yilmaz, A.; Cizmecigil, U.Y.; Aydin, O.; Bamac, O.E.; Gurel, A.; Kutukcu, A.; Ozsemir, K.; Tali, H.E.; et al. Identification of Newcastle disease virus subgenotype VII.2 in wild birds in Turkey. BMC Vet. Res. 2020, 16, 277. [Google Scholar] [CrossRef] [PubMed]
- Bacigalupo, S.; Freath, L.; Ross, C.; Brown, I.; Perrin, L. Newcastle disease in Europe; Department for Environment, Food and Rural Affairs: London, UK, 2023; p. 5. [Google Scholar]
- Perozo, F.; Marcano, R.; Afonso, C.L. Biological and phylogenetic characterization of a genotype VII Newcastle disease virus from Venezuela: Efficacy of field vaccination. J. Clin. Microbiol. 2012, 50, 1204–1208. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.-H.; Nayak, S.; Paldurai, A.; Nayak, B.; Samuel, A.; Aplogan, G.L.; Awoume, K.A.; Webby, R.J.; Ducatez, M.F.; Collins, P.L.; et al. Complete genome sequence of a novel Newcastle disease virus strain isolated from a chicken in West Africa. Am. Soc. Microbiol. 2012, 86, 11394–11395. [Google Scholar] [CrossRef] [PubMed]
- Pandarangga, P.; Cahyono, M.; McAllister, M.; Peaston, A.; Tearle, R.; Low, W.; Doan, P.; Rabiei, M.; Ignjatovic, J.; Dharmayanti, N.; et al. Full-genome sequences of two Newcastle disease virus strains isolated in West Java, Indonesia. Microbiol. Resour. Announc. 2020, 9, e00221-20. [Google Scholar] [CrossRef]
- Pandarangga, P.; Brown, C.; Miller, P.; Haddas, R.; Rehmani, S.; Afonso, C.; Susta, L. Pathogenesis of new strains of Newcastle disease virus from Israel and Pakistan. Vet. Pathol. 2016, 53, 792–796. [Google Scholar] [CrossRef]
- Lomniczi, B.; Wehmann, E.; Herczeg, J.; Ballagi-Pordány, A.; Kaleta, E.F.; Werner, O.; Meulemans, G.; Jorgensen, P.H.; Manté, A.P.; Gielkens, A.L.; et al. Newcastle disease outbreaks in recent years in western Europe were caused by an old (VI) and a novel genotype (VII). Arch. Virol. 1998, 143, 49–64. [Google Scholar] [CrossRef] [PubMed]
- Dimitrov, K.M.; Afonso, C.L.; Yu, Q.; Miller, P.J. Newcastle disease vaccines-A solved problem or a continuous challenge? Vet. Microbiol. 2017, 206, 126–136. [Google Scholar] [CrossRef] [PubMed]
- Diel, D.G.; da Silva, L.H.; Liu, H.; Wang, Z.; Miller, P.J.; Afonso, C.L. Genetic diversity of avian paramyxovirus type 1: Proposal for a unified nomenclature and classification system of Newcastle disease virus genotypes. Infect. Genet. Evol. 2012, 12, 1770–1779. [Google Scholar] [CrossRef]
- Sultan, H.A.; Elfeil, W.K.; Nour, A.A.; Tantawy, L.; Kamel, E.G.; Eed, E.M.; El Askary, A.; Talaat, S. Efficacy of the Newcastle Disease Virus Genotype VII.1.1-Matched Vaccines in Commercial Broilers. Vaccines 2022, 10, 29. [Google Scholar] [CrossRef]
- Sultan, H.A.; Talaat, S.; Elfeil, W.K.; Selim, K.; Kutkat, M.A.; Amer, S.A.; Choi, K.-S. Protective efficacy of the Newcastle disease virus genotype VII–matched vaccine in commercial layers. Poult. Sci. 2020, 99, 1275–1286. [Google Scholar] [CrossRef] [PubMed]
- Xiao, S.; Paldurai, A.; Nayak, B.; Samuel, A.; Bharoto, E.E.; Prajitno, T.Y.; Collins, P.L.; Samal, S.K. Complete genome sequences of Newcastle disease virus strains circulating in chicken populations of Indonesia. Am. Soc. Microbiol. 2012, 86, 5969–5970. [Google Scholar]
- Dharmayanti, N.I.; Nurjanah, D.; Nuradji, H.; Suyatno, T.; Indriani, R. Newcastle disease virus: The past and current situation in Indonesia. J. Vet. Sci. 2024, 25, e3. [Google Scholar] [CrossRef]
- Roohani, K.; Tan, S.W.; Yeap, S.K.; Ideris, A.; Bejo, M.H.; Omar, A.R. Characterisation of genotype VII Newcastle disease virus (NDV) isolated from NDV vaccinated chickens, and the efficacy of LaSota and recombinant genotype VII vaccines against challenge with velogenic NDV. J. Vet. Sci. 2015, 16, 447. [Google Scholar] [CrossRef] [PubMed]
- Hu, Z.; Hu, S.; Meng, C.; Wang, X.; Zhu, J.; Liu, X. Generation of a genotype VII Newcastle disease virus vaccine candidate with high yield in embryonated chicken eggs. Avian Dis. 2011, 55, 391–397. [Google Scholar] [CrossRef] [PubMed]
- Pandarangga, P.; McAllister, M.M.; Peaston, A.E.; Ngai, Y.T.; Cahyono, M.I.; Hemmatzadeh, F. Performance comparison of homologous and heterologous Newcastle disease virus in vaccines and antibody tests. Res. Vet. Sci. 2022, 149, 82–89. [Google Scholar] [CrossRef] [PubMed]
- Cornax, I.; Miller, P.J.; Afonso, C.L. Characterization of live LaSota vaccine strain–induced protection in chickens upon early challenge with a virulent Newcastle disease virus of heterologous genotype. Avian Dis. 2012, 56, 464–470. [Google Scholar] [CrossRef] [PubMed]
- Susta, L.; Jones, M.; Cattoli, G.; Cardenas-Garcia, S.; Miller, P.; Brown, C.; Afonso, C. Pathologic characterization of genotypes XIV and XVII Newcastle disease viruses and efficacy of classical vaccination on specific pathogen-free birds. Vet. Pathol. 2015, 52, 120–131. [Google Scholar] [CrossRef] [PubMed]
- Doan, P.T.K. Transcriptome Profiling of Infected Chickens with Newly Emerged Genotype VI I Newcastle Disease Virus Strains. Ph.D. Thesis, University of Adelaide, Adelaide, Australia, 2022. [Google Scholar]
- Rabiei, M.; Low, W.Y.; Ren, Y.; Cahyono, M.I.; Doan, P.T.K.; Dharmayanti, I.; Grande, E.D.; Hemmatzadeh, F. Indicators of the molecular pathogenesis of virulent Newcastle disease virus in chickens revealed by transcriptomic profiling of spleen. Sci. Rep. 2021, 11, 17570. [Google Scholar] [CrossRef]
- Liu, W.; Qiu, X.; Song, C.; Sun, Y.; Meng, C.; Liao, Y.; Tan, L.; Ding, Z.; Liu, X.; Ding, C. Deep sequencing-based transcriptome profiling reveals avian interferon-stimulated genes and provides comprehensive insight into Newcastle disease virus-induced host responses. Viruses 2018, 10, 162. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Shen, X.; Yu, Y.; Li, J.; Fan, J.; Jia, X.; Dai, Y. Effect of Different Levels of Maternally Derived Genotype VII Newcastle Disease Virus-Specific Hemagglutination Inhibition Antibodies on Protection against Virulent Challenge in Chicks. Viruses 2023, 15, 1840. [Google Scholar] [CrossRef] [PubMed]
- Ni, J.; Deng, J.; Chen, Q.; Liao, T.; Hu, J.; Chen, Y.; Hu, S.; Hu, Z.; Liu, X. Role of Macrophages in the Pathogenesis of Genotype VII Newcastle Disease Virus in Chickens. Animals 2023, 13, 2239. [Google Scholar] [CrossRef] [PubMed]
- Doan, P.T.K.; Cahyono, M.I.; Rabiei, M.; Pandarangga, P.; McAllister, M.M.; Low, W.Y.; Tearle, R.; Dharmayanti, I.; Tarigan, S.; Indriani, R.; et al. Genome Sequences of Newcastle Disease Virus Strains from Two Outbreaks in Indonesia. Microbiol. Resour. Announc. 2020, 9, e00205-20. [Google Scholar] [CrossRef]
- Farhid Hemmatzadeh, M.M.A.; Ebrahimie, E.; Tarigan, S.; Cahyono, M.I. Molecular Characterisation of Newly Emerged Newcastle Disease Viruses in Indonesia; Australian Centre for International Agricultural Research (ACIAR): Canbera, Australia, 2016. [Google Scholar]
- OIE. OIE Terrestrial Manual 2018. In Newcastle Disease (Infection with Newcastle Disease Virus); OIE (World Organisation for Animal Health): Paris, France, 2018; pp. 964–983. [Google Scholar]
- Ramakrishnan, M.A. Determination of 50% endpoint titer using a simple formula. World J. Virol. 2016, 5, 85–86. [Google Scholar] [CrossRef] [PubMed]
- FAO. A Basic Laboratory Manual for the Small-Scale Production and Testing of I-2 Newcastle Disease Vaccine. 2002. Available online: http://www.fao.org/docrep/005/ac802e/ac802e00.htm#Contents (accessed on 11 September 2023).
- Miller, P.J.; Afonso, C.L.; El Attrache, J.; Dorsey, K.M.; Courtney, S.C.; Guo, Z.; Kapczynski, D.R. Effects of Newcastle disease virus vaccine antibodies on the shedding and transmission of challenge viruses. Dev. Comp. Immunol. 2013, 41, 505–513. [Google Scholar] [CrossRef]
- Mahboob, T.; Arshad, M.; Afzal, H.; Siddique, M. Preparation and evaluation of newcastle disease oil emulsion vaccine at hydrophile lipophile balance 7.0 using mukteswar strain. Pak. J. Biol. Sci. 1999, 2, 487–489. [Google Scholar]
- Reddy, G.S.; Srinivasan, S.V. Comparison of two experimental binary ethylenimine (BEI) inactivated Newcastle disease oil-emulsion vaccines. Acta Virol. 1991, 35, 3. [Google Scholar]
- Schubert, M.; Lindgreen, S.; Orlando, L. AdapterRemoval v2: Rapid adapter trimming, identification, and read merging. BMC Res. Notes 2016, 9, 88. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The sequence alignment/map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Holik, A.Z.; Su, S.; Jansz, N.; Chen, K.; Leong, H.S.; Blewitt, M.E.; Asselin-Labat, M.-L.; Smyth, G.K.; Ritchie, M.E. Why weight? Modelling sample and observational level variability improves power in RNA-seq analyses. Nucleic Acids Res. 2015, 43, e97. [Google Scholar] [CrossRef] [PubMed]
- Robinson, M.D.; Oshlack, A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol. 2010, 11, R25. [Google Scholar] [CrossRef] [PubMed]
- Conesa, A.; Madrigal, P.; Tarazona, S.; Gomez-Cabrero, D.; Cervera, A.; McPherson, A.; Szcześniak, M.W.; Gaffney, D.J.; Elo, L.L.; Zhang, X.; et al. A survey of best practices for RNA-seq data analysis. Genome Biol. 2016, 17, 13. [Google Scholar] [CrossRef] [PubMed]
- Etriwati; Ratih, D.; Handharyani, E.; Setiyaningsih, S. Pathology and immunohistochemistry study of Newcastle disease field case in chicken in Indonesia. Vet. World 2017, 10, 1066–1071. [Google Scholar]
- Hori, T.; Katafuchi, T.; Take, S.; Shimizu, N.; Niijima, A. The autonomic nervous system as a communication channel between the brain and the immune system. Neuroimmunomodulation 1995, 2, 203–215. [Google Scholar] [CrossRef] [PubMed]
- Motobu, M.; El-Abasy, M.; Na, K.J.; Vainio, O.; Toivanen, P.; Hirota, Y. Effects of 6-hydroxydopamine on the development of the immune system in chickens. J. Vet. Med. Sci. 2003, 65, 35–42. [Google Scholar] [CrossRef] [PubMed]
- Shih, R.H.; Wang, C.Y.; Yang, C.M. NF-kappaB Signaling Pathways in Neurological Inflammation: A Mini Review. Front. Mol. Neurosci. 2015, 8, 77. [Google Scholar] [CrossRef] [PubMed]
- Munir, M.; Shabbir, M.Z.; Yaqub, T.; Shabbir, M.A.; Mukhtar, N.; Khan, M.R.; Berg, M. Complete genome sequence of a velogenic neurotropic avian paramyxovirus 1 isolated from peacocks (Pavo cristatus) in a wildlife park in Pakistan. J. Virol. 2012, 86, 13113–13114. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Lei, B.; Yuan, Y.; Zhang, L.; Hu, L.; Jin, S.; Kang, B.; Liao, X.; Sun, W.; Xu, F.; et al. Brain control of humoral immune responses amenable to behavioural modulation. Nature 2020, 581, 204–208. [Google Scholar] [CrossRef] [PubMed]
- Qu, Y.; Zhan, Y.; Yang, S.; Ren, S.; Qiu, X.; Rehamn, Z.U.; Tan, L.; Sun, Y.; Meng, C.; Song, C.; et al. Newcastle disease virus infection triggers HMGB1 release to promote the inflammatory response. Virology 2018, 525, 19–31. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Xie, P.; Sun, M.; Xiang, B.; Kang, Y.; Gao, P.; Zhu, W.; Ning, Z.; Ren, T. S1PR1 expression correlates with inflammatory responses to Newcastle disease virus infection. Infect. Genet. Evol. 2016, 37, 37–42. [Google Scholar] [CrossRef] [PubMed]
- Strle, K.; Zhou, J.-H.; Shen, W.; Broussard, S.; Johnson, R.; Freund, G.; Dantzer, R.; Kelley, K. Interleukin-10 in the brain. Crit. Rev. Immunol. 2001, 21, 427–449. [Google Scholar] [CrossRef] [PubMed]
- Rothwell, N.J.; Luheshi, G.N. Interleukin 1 in the brain: Biology, pathology and therapeutic target. Trends Neurosci. 2000, 23, 618–625. [Google Scholar] [CrossRef] [PubMed]
- Brambilla, R.; Dvoriantchikova, G.; Barakat, D.; Ivanov, D.; Bethea, J.R.; Shestopalov, V.I. Transgenic inhibition of astroglial NF-κB protects from optic nerve damage and retinal ganglion cell loss in experimental optic neuritis. J. Neuroinflammation 2012, 9, 213. [Google Scholar] [CrossRef]
- Brambilla, R.; Persaud, T.; Hu, X.; Karmally, S.; Shestopalov, V.I.; Dvoriantchikova, G.; Ivanov, D.; Nathanson, L.; Barnum, S.R.; Bethea, J.R. Transgenic inhibition of astroglial NF-κB improves functional outcome in experimental autoimmune encephalomyelitis by suppressing chronic central nervous system inflammation. J. Immunol. 2009, 182, 2628–2640. [Google Scholar] [CrossRef]
- Liot, G.; Gabriel, C.; Cacquevel, M.; Ali, C.; MacKenzie, E.T.; Buisson, A.; Vivien, D. Neurotrophin-3-induced PI-3 kinase/Akt signaling rescues cortical neurons from apoptosis. Exp. Neurol. 2004, 187, 38–46. [Google Scholar] [CrossRef] [PubMed]
- Nisticò, R.; Salter, E.; Nicolas, C.; Feligioni, M.; Mango, D.; Bortolotto, Z.A.; Gressens, P.; Collingridge, G.L.; Peineau, S. Synaptoimmunology-roles in health and disease. Mol. Brain 2017, 10, 26. [Google Scholar] [CrossRef] [PubMed]
- Marin, I.; Kipnis, J. Learning and memory… and the immune system. Learn. Mem. 2013, 20, 601–606. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [PubMed]
- Moura, V.M.; Susta, L.; Cardenas-Garcia, S.; Stanton, J.B.; Miller, P.J.; Afonso, C.L.; Brown, C.C. Neuropathogenic Capacity of Lentogenic, Mesogenic, and Velogenic Newcastle Disease Virus Strains in Day-Old Chickens. Vet. Pathol. 2016, 53, 53–64. [Google Scholar] [CrossRef] [PubMed]
- Clark, W.M.; Rinker, L.G.; Lessov, N.S.; Hazel, K.; Eckenstein, F. Time course of IL-6 expression in experimental CNS ischemia. Neurol. Res. 1999, 21, 287–292. [Google Scholar] [CrossRef]
- Liu, T.; Clark, R.; McDonnell, P.; Young, P.; White, R.; Barone, F.; Feuerstein, G. Tumor necrosis factor-alpha expression in ischemic neurons. Stroke 1994, 25, 1481–1488. [Google Scholar] [CrossRef]
- Yamasaki, Y.; Matsuura, N.; Shozuhara, H.; Onodera, H.; Itoyama, Y.; Kogure, K. Interleukin-1 as a pathogenetic mediator of ischemic brain damage in rats. Stroke 1995, 26, 676–681. [Google Scholar] [CrossRef]
- Susta, L.; Cornax, I.; Diel, D.G.; Garcia, S.C.; Miller, P.J.; Liu, X.; Hu, S.; Brown, C.C.; Afonso, C.L. Expression of interferon gamma by a highly virulent strain of Newcastle disease virus decreases its pathogenicity in chickens. Microb. Pathog. 2013, 61–62, 73–83. [Google Scholar] [CrossRef]
- Singleton, E.V.; David, S.C.; Davies, J.B.; Hirst, T.R.; Paton, J.C.; Beard, M.R.; Hemmatzadeh, F.; Alsharifi, M. Sterility of gamma-irradiated pathogens: A new mathematical formula to calculate sterilizing doses. J. Radiat. Res. 2020, 61, 886–894. [Google Scholar] [CrossRef]
- Zhou, Y.; Danbolt, N.C. Glutamate as a neurotransmitter in the healthy brain. J. Neural Transm. 2014, 121, 799–817. [Google Scholar] [CrossRef]
- Traynelis, S.F.; Wollmuth, L.P.; McBain, C.J.; Menniti, F.S.; Vance, K.M.; Ogden, K.K.; Hansen, K.B.; Yuan, H.; Myers, S.J.; Dingledine, R. Glutamate receptor ion channels: Structure, regulation, and function. Pharmacol. Rev. 2010, 62, 405–496. [Google Scholar] [CrossRef]
- Zhang, T.Y.; Cai, M.T.; Zheng, Y.; Lai, Q.L.; Shen, C.H.; Qiao, S.; Zhang, Y.X. Anti-Alpha-Amino-3-Hydroxy-5-Methyl-4-Isoxazolepropionic Acid Receptor Encephalitis: A Review. Front. Immunol. 2021, 12, 652820. [Google Scholar] [CrossRef] [PubMed]
- Ebrahimie, E.; Nurollah, Z.; Ebrahimi, M.; Hemmatzadeh, F.; Ignjatovic, J. Unique ability of pandemic influenza to downregulate the genes involved in neuronal disorders. Mol. Biol. Rep. 2015, 42, 1377–1390. [Google Scholar] [CrossRef]
- Choi, D.W. Glutamate neurotoxicity and diseases of the nervous system. Neuron 1988, 1, 623–634. [Google Scholar] [CrossRef]
- Choi, D.W. Glutamate receptors and the induction of excitotoxic neuronal death. Prog. Brain Res. 1994, 100, 47–51. [Google Scholar]
- Colonna, M.; Butovsky, O. Microglia function in the central nervous system during health and neurodegeneration. Annu. Rev. Immunol. 2017, 35, 441–468. [Google Scholar] [CrossRef]
- Poncer, J.C.; Esteban, J.A.; Malinow, R. Multiple mechanisms for the potentiation of AMPA receptor-mediated transmission by α-Ca2+/calmodulin-dependent protein kinase II. J. Neurosci. 2002, 22, 4406–4411. [Google Scholar] [CrossRef]
- Park, M. AMPA receptor trafficking for postsynaptic potentiation. Front. Cell. Neurosci. 2018, 12, 361. [Google Scholar] [CrossRef]
- Soderling, T.R.; Derkach, V.A. Postsynaptic protein phosphorylation and LTP. Trends Neurosci. 2000, 23, 75–80. [Google Scholar] [CrossRef]
- Lee, H.-K. Synaptic plasticity and phosphorylation. Pharmacol. Ther. 2006, 112, 810–832. [Google Scholar] [CrossRef]
- Silva, A.J.; Kogan, J.H.; Frankland, P.W.; Kida, S. CREB and memory. Annu. Rev. Neurosci. 1998, 21, 127–148. [Google Scholar] [CrossRef]
- Deisseroth, K.; Bito, H.; Tsien, R.W. Signaling from synapse to nucleus: Postsynaptic CREB phosphorylation during multiple forms of hippocampal synaptic plasticity. Neuron 1996, 16, 89–101. [Google Scholar] [CrossRef]
- Walton, M.R.; Dragunow, M. Is CREB a key to neuronal survival? Trends Neurosci. 2000, 23, 48–53. [Google Scholar] [CrossRef]
- Bliss, T.V.; Cooke, S.F. Long-term potentiation and long-term depression: A clinical perspective. Clinics 2011, 66, 3–17. [Google Scholar] [CrossRef]
- Brini, M.; Calì, T.; Ottolini, D.; Carafoli, E. Neuronal calcium signaling: Function and dysfunction. Cell. Mol. Life Sci. 2014, 71, 2787–2814. [Google Scholar] [CrossRef]
- Miller, P.J.; King, D.J.; Afonso, C.L.; Suarez, D.L. Antigenic differences among Newcastle disease virus strains of different genotypes used in vaccine formulation affect viral shedding after a virulent challenge. Vaccine 2007, 25, 7238–7246. [Google Scholar] [CrossRef]
- Liu, Z.; Lv, Y.; Zhao, N.; Guan, G.; Wang, J. Protein kinase R-like ER kinase and its role in endoplasmic reticulum stress-decided cell fate. Cell Death Dis. 2015, 6, e1822. [Google Scholar] [CrossRef] [PubMed]
- Janssens, S.; Pulendran, B.; Lambrecht, B.N. Emerging functions of the unfolded protein response in immunity. Nat. Immunol. 2014, 15, 910. [Google Scholar] [CrossRef] [PubMed]
- Iwakoshi, N.N.; Lee, A.-H.; Vallabhajosyula, P.; Otipoby, K.L.; Rajewsky, K.; Glimcher, L.H. Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-1. Nat. Immunol. 2003, 4, 321–329. [Google Scholar] [CrossRef] [PubMed]
- Etienne-Manneville, S.; Hall, A. Rho GTPases in cell biology. Nature 2002, 420, 629–635. [Google Scholar] [CrossRef]
- Bokoch, G.M. Regulation of innate immunity by Rho GTPases. Trends Cell Biol. 2005, 15, 163–171. [Google Scholar] [CrossRef]
- Burbage, M.; Keppler, S.J.; Gasparrini, F.; Martínez-Martín, N.; Gaya, M.; Feest, C.; Domart, M.-C.; Brakebusch, C.; Collinson, L.; Bruckbauer, A.; et al. Cdc42 is a key regulator of B cell differentiation and is required for antiviral humoral immunity. J. Exp. Med. 2015, 212, 53–72. [Google Scholar] [CrossRef] [PubMed]
- Kapczynski, D.R.; Afonso, C.L.; Miller, P.J. Immune responses of poultry to Newcastle disease virus. Dev. Comp. Immunol. 2013, 41, 447–453. [Google Scholar] [CrossRef] [PubMed]
- EL-Morshidy, Y.; Abdo, W.; Elmahallawy, E.K.; Abd EL-Dayem, G.A.; El-Sawak, A.; El-Habashi, N.; Mosad, S.M.; Lokman, M.S.; Albrakati, A.; Abou Asa, S. Pathogenesis of Velogenic Genotype VII.1.1 Newcastle Disease Virus Isolated from Chicken in Egypt via Different Inoculation Routes: Molecular, Histopathological, and Immunohistochemical Study. Animals 2021, 11, 3567. [Google Scholar] [CrossRef] [PubMed]
- Xiang, B.; Chen, L.; Cai, J.; Liang, J.; Lin, Q.; Xu, C.; Ding, C.; Liao, M.; Ren, T. Insights into Genomic Epidemiology, Evolution, and Transmission Dynamics of Genotype VII of Class II Newcastle Disease Virus in China. Pathogens 2020, 9, 837. [Google Scholar] [CrossRef] [PubMed]
Sample | Raw Reads | Cleaned Reads | Mapping (%) |
---|---|---|---|
Control 1 | 29,105,264 | 26,879,254 | 88.34 |
Control 2 | 113,657,819 | 102,102,063 | 87.89 |
Control 3 | 41,358,926 | 38,723,858 | 88.54 |
GII-Vacc 1 | 114,175,518 | 106,868,298 | 88.4 |
GII-Vacc 2 | 50,698,778 | 47,722,191 | 89.19 |
GII-Vacc 3 | 92,323,607 | 86,455,927 | 87.95 |
GVII-Vacc 1 | 158,700,330 | 150,616,087 | 89.4 |
GVII-Vacc 2 | 135,532,995 | 113,542,784 | 89.59 |
GVII-Vacc 3 | 171,523,812 | 157,323,249 | 88.76 |
NCBI Accession Number | Gene Name | Primer | Ta (°C) | AE (%) | Size (bp) | Ref. | |
---|---|---|---|---|---|---|---|
Forward | Reverse | ||||||
NM_205424.1 | ANOS1 | CCAAAGCTTCTGTGAGCCTCT | TGGGAACTTGGCATGTGTGA | 60 | 98.5 | 224 | This study |
NM 001198752.1 | CCR7 | GACCATGGACGGCGGTAAAC | CGGTGACGTTGTTCCCAGCA | 60 | 107.17 | 89 | This study |
NM_001277996.1 | IL16 | GCTTCAGTCTGGAAGGTGG | TGTTCCAACGAGGTCCCTTT | 58 | 97 | 88 | |
XM_416914.6 | IL1R2 | AGGATGCAGAACCACAGATTTCA | CAGGTTCTCCGTGCAGTTCA | 60 | 108.7 | 205 | This study |
XM_015293006.2 | OASL | GGAGTCAGCATCACCAGTCC | CTGAATCACCTGCCCCAGTG | 64 | 109 | 144 | |
NM_001039097.1 | SLCO1C1 | CCAGTGCACTCAGATACGTG | CCGAAGAACCCACAGGACAG | 60 | 99.8 | 92 | This study |
NC_006088.5 | RAC2 | AGGATTACGACAGGCTGAGGC | GATGCTGGGCTGACAAGGGA | 61 | 110 | 82 | |
AB495656.1 | ACTB | CCAGACATCAGGGTGTGATGG | CTCCATATCATCCCAGTTGGTGA | 60 | 95 | 137 | |
NC_006088.5 | GAPDH | GAAGGCTGGGGCTCATCTG | CAGTTGGTGGTGCACGATG | 60 | 104.93 | 150 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pandarangga, P.; Doan, P.T.K.; Tearle, R.; Low, W.Y.; Ren, K.; Nguyen, H.T.H.; Dharmayanti, N.I.; Hemmatzadeh, F. mRNA Profiling and Transcriptomics Analysis of Chickens Received Newcastle Disease Virus Genotype II and Genotype VII Vaccines. Pathogens 2024, 13, 638. https://doi.org/10.3390/pathogens13080638
Pandarangga P, Doan PTK, Tearle R, Low WY, Ren K, Nguyen HTH, Dharmayanti NI, Hemmatzadeh F. mRNA Profiling and Transcriptomics Analysis of Chickens Received Newcastle Disease Virus Genotype II and Genotype VII Vaccines. Pathogens. 2024; 13(8):638. https://doi.org/10.3390/pathogens13080638
Chicago/Turabian StylePandarangga, Putri, Phuong Thi Kim Doan, Rick Tearle, Wai Yee Low, Kelly Ren, Hanh Thi Hong Nguyen, Niluh Indi Dharmayanti, and Farhid Hemmatzadeh. 2024. "mRNA Profiling and Transcriptomics Analysis of Chickens Received Newcastle Disease Virus Genotype II and Genotype VII Vaccines" Pathogens 13, no. 8: 638. https://doi.org/10.3390/pathogens13080638