Next Article in Journal
Survey of Gastrointestinal Parasites and Lungworms in Cats and Dogs from Terceira and São Miguel Islands, Azores
Previous Article in Journal
Clostridioides difficile and Gut Microbiota: From Colonization to Infection and Treatment
Previous Article in Special Issue
Characterization of CRISPR-Cas Systems in Shewanella algae and Shewanella haliotis: Insights into the Adaptation and Survival of Marine Pathogens
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 13
Issue 8
10.3390/pathogens13080647
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Hypermucoviscous Multidrug-Resistant Klebsiella variicola Strain LL2208 Isolated from Chinese Longsnout Catfish (Leiocassis longirostris): Highly Similar to Human K. variicola Strains

by
Qingyong Li
1,
Xin Yu
1,
Lin Ye
1,
Tongyu Hou
1,
Yi Liu
1,
Guiming Liu
1,
Qing Wang
2,3 and
Defeng Zhang
2,3,*
1
Fisheries Research and Extension Center of Huizhou, Huizhou 516055, China
2
Key Laboratory of Fishery Drug Development, Ministry of Agriculture and Rural Affairs, Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510380, China
3
Guangdong Provincial Key Laboratory of Aquatic Animal Immunology and Sustainable Aquaculture, Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510380, China
*
Author to whom correspondence should be addressed.
Pathogens 2024, 13(8), 647; https://doi.org/10.3390/pathogens13080647
Submission received: 21 June 2024 / Revised: 23 July 2024 / Accepted: 30 July 2024 / Published: 31 July 2024
(This article belongs to the Special Issue Emerging Pathogens in Aquaculture)
Browse Figures
Versions Notes

Abstract

:
Outbreaks of bacterial diseases occur in farmed Chinese longsnout catfish (Leiocassis longirostris). Due to limited information on aquatic Klebsiella variicola-infected animals, this study aimed to identify strain LL2208 isolated from diseased L. longirostris, determine its biological features, and evaluate its risk to public health. Strain LL2208 was tested for molecular identification, challenge, string, biofilm formation, and antimicrobial susceptibility. Furthermore, the whole genome of the strain was sequenced and analyzed. Based on molecular identification, strain LL2208 was identified as K. variicola. Artificial infection showed that this strain was moderately virulent to L. longirostris with an LD50 = 7.92 × 107 CFU/mL. Antibiotic sensitivity tests showed that this strain was resistant to penicillins, macrolides, aminoglycosides, amphenicols, glycopeptides, and lincosamide, indicating multidrug resistance. Strain LL2208 has a genome size of 5,557,050 bp, with a GC content of 57.38%, harboring 30 antimicrobial resistance genes and numerous virulence-related genes. Its molecular type was ST595-KL16-O5. Collinearity analysis showed that strain LL2208 was highly similar to the human-derived K. variicola strain. In conclusion, the multidrug-resistant and virulent K. variicola strain LL2208 was isolated from fish and may have originated from humans. These results provide a foundation for further studies on the transmission of K. variicola between humans and aquatic animals.

1. Introduction

The Klebsiella genus belongs to the Enterobacteriaceae family, and its most common pathogenic member is Klebsiella pneumoniae. K. pneumoniae strains are divided into three phylogenetic groups: KpI (K. pneumoniae), KpII (Klebsiella quasipneumoniae), and KpIII (Klebsiella variicola) [1,2]. K. pneumoniae is the most prevalent cause of respiratory tract infection in humans (21.1%) [3], and the resistance rates to third-generation cephalosporins, such as cefotaxime and ceftriaxone, are 24.4% and 22.7%, respectively. Additionally, K. pneumoniae is a pathogenic bacterium in aquatic animals, for example, large yellow croaker (Larimichthys crocea) [4], Megalobrama amhlycephala [5], largemouth bass (Micropterus salmoides) [6], Procambarus clarkia [7], Anguilla marmorata [8], giant salamander (Andrias davidianus) [9], Nile tilapia (Oreochromis niloticus) [10], and American bullfrog (Rana catesbeiana) [11].
K. variicola is an opportunistic pathogen that can cause severe infections in humans and animals [12]. It is an emerging human pathogen that causes hospital- and community-acquired infections, including respiratory tract, bloodstream, urinary tract, and endodontic infections [13,14,15]. A multidrug-resistant and hypermucoviscous K. variicola (hmvKv) strain was isolated from a pediatric patient [16]. K. variicola has been reported to infect farmed animals, including horses with respiratory diseases [17] and dead chicken embryos [1]. However, limited information is available regarding aquatic animals infected with K. variicola [18].
Antibiotics play an important role in preventing and treating bacterial infections. Recently, the reports on extended-spectrum-β-lactamase- or carbapenemase-producing K. variicola strains have been increasing [19], such as the K. variicola strain 4717 harboring blaOXA-484, which was found in China [20], and K. variicola strain SHET-01 containing the coexisting of blaNDM-1 and blaIMP-4 genes [16], while K. variicola strain 18L carries blaLEN-21 and blaLEN-24 genes in the chromosome [15]. A polymyxin-resistant K. variicola strain, M50, with a non-functional mgrB variant, was isolated from a bird in Brazil [21]. The LEN-17, oqxA, oqxB, fosA, and fosA7 genes have been identified in the genome of K. variicola strain F2R9 (=ATCC BAA-830) isolated from banana root [22]. K. variicola strain KV093 was isolated from a urine sample in India, and the LEN-9 and fosA6 genes were contained in its genome [23]. Plasmids play an important role in the horizontal transfer of antimicrobial-resistant genes in K. variicola strains [12]. Therefore, K. variicola strains containing numerous antimicrobial resistance genes pose a public health challenge. Consequently, it is important to determine the distribution and genetic backgrounds of multidrug-resistant K. variicola strains.
The Chinese longsnout catfish (Leiocassis longirostris) belongs to the Bagridae family and is a commercially important freshwater fish in China distributed in the Yangtze, Minjiang, Pearl, Liaohe, and Huaihe Rivers [24]. Intensive farming of this fish has been widely promoted because of its good taste, lack of intermuscular bone, high market demand, and high price [25]. The annual production of L. longirostris exceeded 20,000 tons in 2020 [26], and the production is continuously increasing. It has a naturally high disease resistance [26]. However, with the increased aquaculture density in ponds and the continuous water quality deterioration, many bacterial diseases frequently occur during farming, including ulcerative syndrome caused by Aeromonas veronii [27] and edwardsiellosis caused by Edwardsiella ictaluri [28] and bacterial gill-rot disease caused by Flavobacterium columnare.
Recently, high-density farmed L. longirostris disease outbreaks were reported in Foshan City, Guangdong province, China. A pathogen named strain LL2208 was isolated from the diseased fish. This study aimed to identify strain LL2208 isolated from diseased L. longirostris and evaluate its risk to public health by analyzing its biological features and genetic characteristics. Strain LL2208 was identified as K. variicola, and it was similar to K. variicola isolated from humans. To the best of our knowledge, this is the first report on multidrug-resistant K. variicola from fish.

2. Materials and Methods

2.1. Bacterial Isolation and Identification

Naturally diseased Chinese longsnout catfish samples (N = 7) were collected from a farm (three ponds) in Foshan City, Guangdong Province, China. The water temperature was 29 to 32 °C, and the cumulative mortality rate was 15–40% within 20 d. The liver, spleen, and kidney tissues were collected and streaked on a Columbia blood agar plate (Guangzhou Detgerm Microbiogical Science Ltd., Guangzhou, China) and then incubated at 29 °C for 48 h. The dominant colonies were purified by streaking and re-streaking on brain heart infusion (BHI; Becton, Dickinson and Company, Sparks, MD, USA) agar plates. One of the representative strains (LL2208) was selected and inoculated on a Columbia blood agar plate at 28 °C for 24 h to observe the colony morphology. An electron microscopy negative-staining sample of strain LL2208 was prepared to observe the bacterial characteristics.
Strain LL2208 was inoculated into a BHI liquid medium for expansion. The bacterial cells were collected, and the genomic DNA was extracted using a bacterial genomic DNA extraction kit (Guangzhou Magen Biotechnology, Co., Ltd., Guangzhou, China). The 16S rRNA gene of strain LL2208 was PCR amplified using the universal primers 27f (5′-AGAGTTTGATCMTGGCTCAG-3′) and 1492r (5′-TACGGYTACCTTGTTACGACT-3′), and the positive PCR product was sequenced. The 16S rRNA gene was analyzed using Blastn. Further, a phylogenetic tree was constructed using MEGA v7.0.20 with Neighbor Joining (Bootstrap 1000 replicates), and species with distant genetic relationships, such as Citrobacter freundii and Plesiomonas shigelloides, were selected as outgroups. The one-step multiplex PCR was performed to determine the taxonomic status [29]. The primers LEN-F and DeoR-R were used, and PCR was performed using the Ex Taq™ Version 2.0 plus dye (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions. The PCR amplification conditions were as follows: pre-denaturation at 95 °C for 4 min, followed by 35 cycles (denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 1 min), and final extension at 72 °C for 10 min. Amplified products were collected and sequenced by Sangon Biotech (Shanghai) Co., Ltd., Shanghai, China.

2.2. String Test

Strain LL2208 was streaked onto a MacConkey agar (Guangdong HuanKai Microbial Sci. & Tech. Co., Ltd., Guangzhou, China) plate and incubated at 30 °C for 18 h. The length of the viscous filament was observed by making contact with the colony surface using the inoculum ring, with a positive strain being ≥10 mm and a negative strain being <10 mm [12]. Strain LL2208 was passed twice, and the string test was repeated. The strain that tested positive on the string test could therefore be classified as hmvKv.

2.3. Biofilm Formation Assay

The biofilm formation ability of strain LL2208 was evaluated as previously described, with slight modifications [30]. The strain was inoculated briefly into Luria–Bertani (LB) medium (Becton, Dickinson and Company, Sparks, MD, USA), cultured until it reached the logarithmic growth phase (OD600 = 0.8), and then the bacterial culture was diluted 1:100 in 5 mL of fresh LB broth. Subsequently, 200 μL of the diluted bacterial cultures and 200 μL of LB broth were added, respectively, to each well of 96-well polystyrene microtiter plates and each well in the control group. The 96-well plates were incubated at 35 °C for 24 h. The supernatant was discarded, the wells were washed thrice with sterile water, and methanol solution (200 μL/well) was added to fix the biofilm for 15 min. The methanol solution was discarded, and the 96-well plates were dried for 15 min. The crystal violet solution was added to each well (200 μL/well) to stain for 10 min at room temperature (25 °C), and the excess stain was removed three times with sterile water. Acetic acid (33%, v/v) was added to each well to re-solubilize the attached stain after drying in a 96-well plate. The OD595 was measured using a microplate reader. The biofilm assay was performed in triplicate.
Biofilm formation was categorized into weak, moderate, or strong according to the absorbance value: weak biofilm producer, OD595c (control group) < OD595 ≤ 2 OD595c; moderate biofilm producer, 2 OD595c < OD595 ≤ 4 OD595c; strong biofilm producer, OD595 ≥ 4 OD595c.

2.4. Challenge Test

Strain LL2208 was inoculated into BHI medium and cultured at 28 °C until the logarithmic growth phase (OD600 = 0.8–1.0). The bacterial cells were collected by centrifugation at 5000 rpm, and the bacterial concentration was adjusted to 5.0 × 108, 5.0 × 107, 5.0 × 106, 5.0 × 105, and 5.0 × 104 CFU/mL using sterile phosphate buffer saline (PBS). Six groups of 20 healthy Chinese longsnout catfish (8.2~13.5 g) each were randomly assigned at a water temperature of 29 ± 1 °C. The challenge test was conducted using a 0.1 mL intraperitoneal injection for each fish. The control group was injected with an equal volume of sterile PBS. After artificial infection, clinical signs and mortality were monitored daily for 14 days, and dead fish were subjected to bacterial isolation and identification. The median lethal dose was calculated using the modified Karber’s method [31,32] as follows:
LD50 = lg−1[Xk − i(∑p − 0.5)]
  • “Xk” is the logarithmic value of the maximum dose;
  • “i” is the logarithmic dose difference between adjacent dose groups;
  • “∑p” is the sum of mortality rates for each dose group.

2.5. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility testing (AST) of strain LL2208 was performed using the Kirby–Bauer disk-diffusion method. Antimicrobial drugs, including penicillin G (10 U), amoxicillin (20 µg), cephalexin (30 µg), ceftriaxone (30 µg), tetracycline (30 µg), doxycycline (30 µg), chloramphenicol (30 µg), florfenicol (30 µg), enrofloxacin (10 µg), ofloxacin (5 µg), norfloxacin (10 µg), gentamicin (10 µg), streptomycin (10 µg), tobramycin (10 µg), roxithromycin (15 µg), erythromycin (15 µg), sulfamethoxazole/trimethoprim (23.75/1.25 µg), sulfamethoxazole (300 µg), lincomycin (2 µg), vancomycin (30 µg), and fosfomycin (30 µg) were obtained from Hangzhou Microbial Reagent Co., Ltd. (Hangzhou, China). Strain LL2208 was inoculated into a Mueller–Hinton agar (MHA) plate and cultured at 28 °C overnight. The bacterial solution was diluted to 0.5 McFarland standard and streaked on MHA plates. The paper disks were placed on MHA plates, which were then incubated at 35 °C for 24 h to measure the diameter of the inhibition zone. The Escherichia coli strain ATCC 25922 was used as a quality control strain. AST was performed in triplicate. The susceptibility results were interpreted based on the Clinical Laboratory Standards Institute (CLSI) guidelines [33] and the manufacturer’s instructions.

2.6. Whole-Genome Sequencing and Bioinformatics Analysis

2.6.1. Sequencing and Functional Genes Prediction

The genomic DNA of strain LL2208 was sequenced using PacBio technology (PacBio Sequel II sequencing platform) and assembled using Canu v1.5 and wtdbg v2.2 software to obtain the complete genome sequence. Prodigal 2.6.2 software (https://github.com/hyattpd/prodigal/wiki (accessed on 9 July 2023)) was used for gene prediction, and tRNAscan-SE and Barnap 0.7 software was used to predict tRNA and rRNA, respectively. IslandViewer 4 (http://www.pathogenomics.sfu.ca/islandviewer/ (accessed on 9 July 2023)) and PhiSpy (https://github.com/linsalrob/PhiSpy (accessed on 9 July 2023)) were used to predict the gene islands and pre-phages, respectively. Multilocus sequence typing (MLST), capsule type, and O antigen type of strain LL2208 were analyzed using the online tool PathogenWatch (https://pathogen.watch (accessed on 22 April 2024)).

2.6.2. ANI and dDDH Analysis

The average nucleotide identity (ANI) is widely used to classify and identify bacteria by calculating the ANI values of prokaryotic genome sequences [34]. ANIu values were calculated between strain LL2208 and related species using the online tool OrthoANIu (https://www.ezbiocloud.net/tools/ani (accessed on 23 April 2024)). Digital DNA-DNA hybridization (dDDH) values between the LL2208 genome and the genomes of related species were analyzed using the Genome-to-Genome Distance Calculator 3.0 (https://ggdc.dsmz.de/ggdc.php (accessed on 24 April 2024)) [35].

2.6.3. Virulence-Related Genes

The virulence-related genes in the genome of strain LL2208 were analyzed using VFanalyzer (http://www.mgc.ac.cn/cgi-bin/VFs/v5/main.cgi (accessed on 8 May 2024)). The virulence genes such as impA, impA2, magA, peg-344, iroB, and iucB were detected using PCR amplification and sequencing. For the PCR amplification, the Ex Taq™ Version 2.0 plus dye was used and the primers were listed in Table 1. The PCR conditions were as follows: pre-denaturation at 95 °C for 4 min, followed by 35 cycles (denaturation at 94 °C for 30 s, annealing at 56–59 °C for 30 s, and extension at 72 °C for 1 min), and final extension at 72 °C for 10 min. Amplified products were collected and sequenced by Sangon Biotech (Shanghai) Co., Ltd., Shanghai, China.

2.6.4. Antimicrobial Resistance Genes

Antimicrobial resistance genes were predicted using the RGI 6.0.3 software (https://card.mcmaster.ca/analyze/rgi (accessed on 22 May 2024)) in the Comprehensive Antibiotic Resistance Database (CARD) with strict hit criteria.

2.6.5. Collinearity Analysis

Collinearity analysis of different strains is important in revealing in-depth genetic variation. BRIG-0.95 software (https://sourceforge.net/projects/brig/ (accessed on 22 May 2024)) was used to obtain the collinearity relationship between strain LL2208 and closely related evolutionary strains [36], including strains WCHKV030666 [37] and 15WZ-82 [38].

3. Results

3.1. Bacterial Isolation and Identification

Clinical signs of the naturally diseased Chinese longsnout catfish (100–600 g) included a swollen abdomen, hemorrhage in the base of the fin, anal dilatation with hyperemia, fluid accumulation in the abdominal cavity, and liver and kidney enlargement (Figure 1). Many bacteria with similar colony morphologies were isolated from the liver, spleen, and kidney tissues of diseased fish (N = 7). The colonies appeared moist and bumped, with regular edges, smooth surfaces, and a grey-white color (Figure 2A). The bacterial morphology of strain LL2208 was observed by transmission electron microscopy, indicating that the strain was thick, short, and rod-shaped, with a large number of extracellular products, filamentous pili, and outer membrane vesicles (Figure 2B).
The 16S rRNA sequence of strain LL2208 was analyzed through Blastn online alignment, and the results showed that the sequence similarities between strain LL2208 and K. pneumoniae or K. variicola strains were ≥99.94%. A phylogenetic tree of the 16S rRNA sequences was constructed, suggesting that strain LL2208 and K. variicola strains were clustered into the same branch (Figure 3). Specific PCR detection showed that strain LL2208 belonged to K. variicola, with the PCR product sequence being 100% similar to that of the K. variicola strain 15WZ-82 (GenBank accession no. CP032354.1, located in 3,232,504 bp~3,232,992 bp), indicating that strain LL2208 could be classified as K. variicola.

3.2. String Test

String tests of strain LL2208 showed that it produced a 2–4 cm viscous string after 18 h of cultivation on MacConkey agar plates (Figure 4). Moreover, strain LL2208 produced a >10 mm viscous string after two passages of cultivation, indicating that it was phenotypically hmvKv.

3.3. Biofilm Formation Ability

The biofilm assay showed that the OD595 of strain LL2208 was 1.41 ± 0.10, while the OD595 of the control group was 0.17 ± 0.01, indicating that strain LL2208 has strong biofilm formation ability (>4 OD595c), and it was an hmvKv strain.

3.4. Pathogenicity

The major clinical signs of fish infected with strain LL2208 were slow swimming, fluid accumulation in the abdominal cavity, and liver and kidney enlargement. A large number of colonies with similar morphologies were isolated from the liver and kidney tissues of the infected fish, and the similarities of the 16S rRNA sequences between the isolated strains and strain LL2208 were 100%, indicating that the death of L. longirostris was caused by artificial infection. The fish in the control group showed no clinical signs or mortality during the observation period. The LD50 of strain LL2208 to L. longirostris was 7.92 × 107 CFU/mL.

3.5. Antimicrobial Susceptibility

AST results showed that strain LL2208 was resistant to penicillins (penicillin, amoxicillin), macrolides (erythromycin and roxithromycin), amphenicols (chloramphenicol and florfenicol), lincosamides (lincomycin), and glycopeptides (vancomycin), while it was sensitive or intermediate to cephalosporins (cephalexin, ceftriaxone), tetracyclines (tetracycline and doxycycline), quinolones (enrofloxacin, norfloxacin, and ofloxacin), sulfonamides (sulfamethoxazole/trimethoprim and sulfamethoxazole), aminoglycosides (tobramycin, gentamicin, and streptomycin), and fosfomycin (Table 2), indicating that strain LL2208 is multidrug-resistant.

3.6. Genomic Sequencing and Bioinformatics Analysis

3.6.1. Genomic Annotation and Features

The genome of strain LL2208 contained a circularized chromosome (5,557,050 bp) with no identifiable plasmids and predicted 5158 CDSs (with protein), 88 tRNAs, and 25 rRNAs (5S, 16S, 23S). The whole-genome sequence was deposited in GenBank under the accession no. CP154255. Six gene islands were identified using IslandViewer 4 (Table S1). However, no prophages were found in the LL2208 genome. According to Pathogenwatch analysis, the MLST, capsule type, and O antigen type were ST595, KL16, and O5, respectively.

3.6.2. ANI and dDDH Analysis

The OrthoANIu values of strain LL2208 against K. variicola strains were 99.10% to 99.98%, with the highest OrthoANIu value (99.98%) compared with the WCHKV030666 strain (Table 3). Generally, an ANI value > 95% indicates the presence of the same species; thus, strain LL2208 belongs to K. variicola. The dDDH values of strain LL2208 compared to K. variicola strains were 92.80% to 100% (Table 3), and the DDH values were >70%, confirming the presence of the same species. Therefore, the LL2208 strain was identified as K. variicola and is highly similar to strain WCHKV030666.

3.6.3. Virulence-Associated Genes

A large number of virulence-related genes were predicted in the LL2208 genome, such as adhesion-related genes mrkABCDFHI and fimABCDEFGHIK, iron absorption-related genes iutA, entABCDEFS, fepABCDG, and iroE/iroN, as well as the T6SS secretion system (Table 4). However, genes rmpA and magA were not predicted in the genome. The rmpA, iroB, and peg-344 were detected using PCR amplification and sequencing, whereas impA2, magA, and iucB genes were not (Figure S1).

3.6.4. Antimicrobial Resistance Genes

A total of 30 antimicrobial resistance genes (including repeat genes) were predicted in the LL2208 genome based on CARD, including β-lactamase resistance genes, e.g., blaLEN-16, pbp3, ompK37, and mdtQ; glycopeptide resistance gene vanG; and fosfomycin resistance genes fosA6 and uhpT. The LL2208 genome contained four categories of antimicrobial resistance genes according to the mechanism of antibiotic resistance: antibiotic efflux, antibiotic inactivation, changes in antibiotic target sites, and reduced antibiotic permeability (Table 5).

3.6.5. Collinearity Relationship

The results of collinearity analysis showed that strain LL2208 had a highly collinear relationship with strain WCHKV030666, and there was no gene rearrangement or inversion in the genome (Figure 5), indicating a high degree of similarity between these two strains. There was good collinearity between strain LL2208 and strain 15WZ-82; however, there were some gene deletions in the genome of strain 15WZ-82.

4. Discussion

K. variicola is a prevalent opportunistic pathogen that causes infections in humans and animals, including bloodstream infections, and urinary and respiratory-related diseases in humans [23]. It is divided into classical K. variicola, hmvKv, and hypervirulent K. variicola (hvKv). Some of these strains exhibit high infectivity and mortality rates [12]. Unlike K. pneumoniae, K. variicola strains have not been reported as a pathogen in aquatic animals. Moreover, limited information is available regarding the genetic background of K. variicola isolated from humans and fish.
In this study, strain LL2208 was isolated from the kidney of diseased Chinese longsnout catfish and was identified as K. variicola based on 16S rRNA, ANI, and DDH analysis, as well as specific PCR detection. Generally, the common methods for determining hypervirulent K. pneumoniae include the string test, capsular typing, iron uptake detection, and virulence phenotype detection. In this study, the string test showed that strain LL2208 was characterized as an hmvKv strain. The challenge test showed that strain LL2208 has moderate pathogenicity to the Chinese longsnout catfish, similar to that of K. pneumoniae KP0123 from M. salmoides with LD50 = 3.4 × 107 CFU/mL [6]. Additionally, antimicrobial sensitivity tests showed that strain LL2208 is a multidrug-resistant strain resistant to antimicrobial agents, such as penicillins, macrolides, amphenicols, lincomycin, and glycopeptides. The results suggest that antimicrobial sensitivity tests should be performed before using antimicrobial agents to prevent and treat infection with K. variicola in fish to avoid the unreasonable use of antibiotics, leading to increases in drug-resistant strains.
The genome of strain LL2208 contains 30 resistance-related genes, such as the β-lactamase resistance genes, including blaLEN-16, pbp3, ompK37, and mdtQ, and the strain was resistant to penicillin but was sensitive to cephalosporins. It harbored CRP, kpnE, kpnF, kpnG, kpnH, and H-NS, contributing to macrolide resistance. Strain LL2208 harbored resistance gene vanG, which is responsible for vancomycin resistance, and it was resistant to amphenicols, which may be related to its carrying rsmA, marA, and marR. Furthermore, it carried fluoroquinolones/tetracycline resistance-related genes (adeF, oqxA, marA, and marR), disinfectant resistance-related genes (leuO and qacG), and fosfomycin resistance genes (fosA6 and uhpT). However, strain LL2208 was not resistant to fluoroquinolones, tetracycline, and fosfomycin; perhaps these genes in the genome were associated with low-level resistance. Consistent with previous reports, K. variicola strains from humans or animals also carried many antimicrobial resistance genes; for example, K. variicola strain AHKv S01 isolated from dead chicken embryos carried antibiotic resistance genes, including blaLEN-2, ampH, adeF, ompK37, kpnH, kpnG, kpnE, emrR, oqxA, baeR, mdtC, mdtB, marA, acrB, acrR, CRP, fosA2, and uhpT, and this strain was resistant to penicillins, macrolides, and lincosamides [1], indicating that strains AHKv S01 and LL2208 have a similar phenotype and genotype of antimicrobial resistance. K. variicola strain KV093 was resistant to tircarcillin, piperacillin, oxacillin, norfloxacin, methicillin, linezolid, clindamycin, azithromycin, and amikacin, and it harbored blaLEN-9, fosA6, ampH, pbp3, mcr-9.1, mcr-3.5, mdtABC, emrAB, oqxAB, mdtIJ, and qacA [23]. Taken together with the current study results, this suggests that blaLEN, pbp3, oqxA, and fosA genes are common resistance genes of K. variicola.
The typical virulence factors of the Klebsiella genus include capsular polysaccharides, pili/fimbriae, iron-binding siderophores, lipopolysaccharides, outer membrane proteins, and T6SS [39]. Type I fimbriae are encoded by fim gene clusters and can bind to glycoproteins in epithelial cells, contributing to bacterial colonization; type III fimbriae are encoded by mrkABCDF, which is related to biofilm formation and invasion. Strain LL2208 contained type I and III fimbrial gene clusters, including fimABCDEFGHIK and mrkABCDFHI, implying that this strain has strong adhesion ability and biofilm formation ability [40]. Siderophores are closely related to hypervirulent K. pneumoniae, including aerobactin, enterobactin, yersiniabactin, and salmochelin [39]. In K. pneumoniae, enterobactin is the main siderophore for iron uptake, and salmochelin is common in hypervirulent K. pneumoniae (hvKp) strains; more than 90% of these are associated with pyogenic liver abscesses and effective infection in hvKp requires aerobactin [39]. Generally, siderophores are essential for the proliferation and pathogenicity of bacteria and can affect tissue localization and systemic dispersion. Strain LL2208 contained genes associated with the synthesis of salmochelin (iroE and iroN), enterobactin (entABCDEFS and fepABCDG), and aerobactin (iutA), indicating that it could synthesize salmochelin, enterobactin, and aerobactin, which may enhance its pathogenicity.
The virulence genes rmpA, rmpA2, peg344, iroB, and iucA can distinguish between hvKP and classical K. pneumoniae (cKP). Gene rmpA was not identified in the genome of strain LL2208. However, rmpA, peg344, and iroB were detected using PCR amplification and sequencing, suggesting that the hypermucoviscous phenotype of strain LL2208 was related to rmpA. Moreover, strain LL2208 may have low-copy plasmids, and the plasmid sequences were not assembled because the sequencing depth was insufficient. Strain LL2208 contained rmpA, peg344, iroB, and iucA genes (Table 4), suggesting that this strain was an hvKv strain based on the presence of virulence-associated genes.
K. variicoa strains are becoming a threat to public health worldwide. Recently, the number of reports on human hvKv strains has increased. A multidrug-resistant K. variicoa strain (ST17) resulted in a higher mortality rate (54.5%) in newborns [41]. The hvKv strain 21072329 isolated from an elderly patient belonged to the ST11-KL47 type and is resistant to carbapenems and third- and fourth-generation cephalosporins [42]. K. variicola strain wxkv2055, with ST595-KL16-O5 genotype, was isolated from human blood [43], consistent with the report that strain LL2208 also belongs to the same genotype. Furthermore, the genotype of K. variicola strain WCHKV030666 isolated from humans was ST595-O5, and the capsule type was similar to KL16 (wzi251) [37]. Moreover, the strains LL2208 and WCHKV030666 showed a highly collinear relationship, indicating they have a common ancestral lineage. A carbapenem-resistant K. variicola strain 15WZ-82 isolated from human sputum exhibited high-level virulence in mice and showed good collinearity with strain LL2208 [38]. These results indicate that strain LL2208 can potentially become an hvKv. K. variicola, a co-pathogenic bacterium found between humans and aquatic animals, can cause infection in farmed fish if the aquaculture water is contaminated with this strain. Moreover, K. variicola, as a potential foodborne pathogen, poses a risk to human health [44].
In this study, enrofloxacin and sulfonamides are recommended to prevent and control the infection of K. variicola in Chinese longsnout catfish according to the results of the antimicrobial sensitivity test. However, it is necessary to accelerate the research and development of prevention and control products for K. variicola, which belongs to the K. pneumoniae complex, to curb the spread of multidrug-resistant strains. For example, lytic phage was isolated from water as a biocontrol agent against multidrug-resistant K. variicola, inhibiting its growth in vitro and in vivo [45]. Oral treatment with live commensal Bifidobacterium longum 51A prevents detrimental lung inflammation caused by K. pneumoniae strains [46]. A previous report also showed that plant extracts could effectively inhibit the growth of K. pneumoniae, and peppercorn extracts were the most potent growth inhibitors [47]. Vaccines are a promising strategy for preventing infections caused by K. pneumoniae strains and reducing the spread of multidrug-resistant strains [48].

5. Conclusions

A multidrug-resistant hmvKv strain LL2208 with strong biofilm formation ability was isolated from diseased fish. Genome analysis revealed that the strain harbored antimicrobial resistance genes, including blaLEN-16, ompK37, pbp3, and vanG, and it contained numerous virulence-associated genes, including type I and III fimbrial gene clusters, siderophores, and T6SS. The genotype was ST595-KL16-O5. Comparative genomics analysis revealed strain LL2208 is highly similar to human-derived K. variicola strains, suggesting that the spread of K. variicola strains in diseased fish poses a potential risk to public health. Monitoring the epidemiology, pathogenicity, and antimicrobial resistance of K. variicola as an emerging pathogen in fish is crucial for disease prevention and safeguarding public health.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pathogens13080647/s1, Figure S1: Virulence-associated genes detected by PCR; Table S1: Gene islands in the genome of strain LL2208 predicted by IslandViewer 4.

Author Contributions

Conceptualization, D.Z. and Q.L.; methodology, D.Z. and Q.L.; software, L.Y. and X.Y.; validation, T.H. and L.Y.; formal analysis, T.H. and Y.L.; investigation, D.Z. and Q.L.; resources, Q.L. and Q.W.; data curation, D.Z.; writing—original draft preparation, D.Z.; writing—review and editing, Q.W. and Q.L.; visualization, X.Y. and T.H.; supervision, Q.L. and G.L.; project administration, Q.L. and Q.W.; funding acquisition, Q.W. and Q.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the China Agriculture Research System, grant number CARS-46; the Central Public-interest Scientific Institution Basal Research Fund, CAFS, grant number 2023TD49; and the Guangdong Provincial Special Fund for Modern Agriculture Industry Technology Innovation Teams, grant number 2024KJ150.

Institutional Review Board Statement

This study was conducted in accordance with the internal ethics committee of the Fisheries Research and Extension Center of Huizhou (FR&E-HZ/2022/1), approved on 22 October 2022.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data are included in the article/referenced in the article.

Acknowledgments

We thank the farmers for their collaboration, and thank Ouqin Chang for providing the morphological picture of strain LL2208.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Yin, L.; Shen, X.H.; Ma, H.T.; Pan, X.C.; Zhang, D.J.; Zhao, R.H.; Dai, Y.; Hou, H.Y.; Hu, X.M. Comprehensive genomic analysis and characterization of a new ST 174 type Klebsiella variicola strain isolated from chicken embryos. Infect. Genet. Evol. 2021, 90, 104768. [Google Scholar]
  2. Guo, Y.T.; Zhai, Y.; Zhang, Z.; Li, D.X.; Wang, Z.W.; Li, J.Q.; He, Z.L.; Hu, S.N.; Kang, Y.; Gao, Z.C. Complete genomic analysis of a kingdom-crossing Klebsiella variicola isolate. Front. Microbiol. 2018, 9, 2428. [Google Scholar] [CrossRef] [PubMed]
  3. China Antimicrobial Resistance Surveillance System. Antimicrobial resistance surveillance reports from respiratory medicine departments from China Antimicrobial Resistance Surveillance System in 2021. China J. Nosocomiol. 2023, 33, 3380–3386. (In Chinese) [Google Scholar]
  4. Pan, Y.X.; Wang, W.J.; Chen, Q.D.; Hu, G.W. Isolation, identification, and pathogenic analysis of Klebsiella pneumoniae from large yellow croaker Larimichthys crocea. Fish. Sci. 2023, 42, 268–278. (In Chinese) [Google Scholar]
  5. Teng, T.; Liang, L.G.; Xie, J.; Xu, P. Isolation and identification of pathogenic Klebsiella pneumoniae from Megalobrama amhlycephala. J. Hydroecol. 2016, 37, 95–100. (In Chinese) [Google Scholar]
  6. Cao, X.Y.; Huang, J.Y.; Du, S.Y.; Hou, T.M.; Xiang, W.; Gao, W.H.; Zhang, F.X. Isolation and characterization of Klebsiella pneumoniae type ST 873 from Micropterus salmoides. Oceanol. Limnol. Sin. 2023, 54, 836–847. (In Chinese) [Google Scholar]
  7. Dong, J.; Zhang, L.S.; Liu, S.C.; Zhang, G.D.; Zhou, S.; Yang, Q.H.; Ai, X.H. Isolation, identification and susceptibility analysis of pathogenic Klebsiella pneumonia from diseased Procambarus clarkii. J. Huazhong Agric. Univ. 2021, 40, 93–98. (In Chinese) [Google Scholar]
  8. Tan, A.P.; Deng, Y.T.; Jiang, L.; Wu, Y.L.; Xue, H.J.; Wang, W.L.; Luo, L.; Zhao, F. Isolation and identification of a multiple-drugresistant Klebsiella pneumoniae from Anguilla marmorata. Acta Hydrobiol. Sin. 2013, 37, 744–750. (In Chinese) [Google Scholar]
  9. Li, X.Y.; Zhou, W.P.; Fan, W.J. The partial biological characteristics and pathogenic analysis of Klebsiella pneumoniae from Chinese Giant salamander. Chin. J. Prev. Vet. Med. 2017, 39, 628–632. (In Chinese) [Google Scholar]
  10. Vaneci-Silva, D.; Assane, I.M.; de Oliveira Alves, L.; Gomes, F.C.; Moro, E.B.; Kotzent, S.; Pitondo-Silva, A.; Pilarski, F. Klebsiella pneumoniae causing mass mortality in juvenile Nile tilapia in Brazil: Isolation, characterization, pathogenicity and phylogenetic relationship with other environmental and pathogenic strains from livestock and human sources. Aquaculture 2022, 546, 737376. [Google Scholar] [CrossRef]
  11. Lin, H.; Ma, J.; Sun, J.Y.; Qin, Z.D.; Jiang, B.; Li, W.; Wang, Q.; Su, Y.L.; Lin, L.; Liu, C. Identification and characterization of Klebsiella pneumoniae from farmed American bullfrogs (Rana catesbeiana). Microbiol. Spectr. 2023, 11, e3522–e3579. [Google Scholar] [CrossRef] [PubMed]
  12. Rodríguez-Medina, N.; Barrios-Camacho, H.; Duran-Bedolla, J.; Garza-Ramos, U. Klebsiella variicola: An emerging pathogen in humans. Emerg. Microbes Infect 2019, 8, 973–988. [Google Scholar] [CrossRef] [PubMed]
  13. Maatallah, M.; Vading, M.; Kabir, M.H.; Bakhrouf, A.; Kalin, M.; Nauclér, P.; Brisse, S.; Giske, C.G. Klebsiella variicola is a frequent cause of bloodstream infection in the stockholm area, and associated with higher mortality compared to K. pneumoniae. PLoS ONE 2014, 9, e113539. [Google Scholar] [CrossRef]
  14. Long, D.L.; Wang, Y.H.; Wang, J.L.; Mu, S.J.; Chen, L.; Shi, X.Q.; Li, J.Q. Fatal community-acquired bloodstream infection caused by Klebsiella variicola: A case report. World J. Clin. Cases 2022, 10, 2474–2483. [Google Scholar] [CrossRef]
  15. Nakamura-Silva, R.; Macedo, L.M.D.; Cerdeira, L.; Oliveira-Silva, M.; Silva-Sousa, Y.T.C.; Pitondo-Silva, A. First report of hypermucoviscous Klebsiella variicola subsp. variicola causing primary endodontic infection. Clin. Microbiol. Infect. 2021, 27, 303–304. [Google Scholar] [CrossRef]
  16. Wang, B.; Pan, F.; Han, D.; Zhao, W.; Shi, Y.; Sun, Y.; Wang, C.; Zhang, T.; Zhang, H. Genetic characteristics and microbiological profile of hypermucoviscous multidrug-resistant Klebsiella variicola coproducing IMP-4 and NDM-1 carbapenemases. Microbiol. Spectr. 2022, 10, e01581-21. [Google Scholar] [CrossRef]
  17. Mondo, E.; Rinnovati, R.; Spadari, A.; Giacometti, F.; Serraino, A.; Savini, F.; Piva, S. First isolation of Klebsiella variicola from a horse pleural effusion. BMC Vet. Res. 2021, 17, 75. [Google Scholar] [CrossRef] [PubMed]
  18. Narendrakumar, L.; Sudhagar, A.; Preena, P.G.; Nithianantham, S.R.; Mohandas, S.P.; Swaminathan, T.R. Detection of Mycobacterium marinum and multidrug-resistant bacteria in a chronic progressive disease outbreak among Siamese fighting fish (Betta splendens) in India. Biologia 2022, 77, 2725–2733. [Google Scholar] [CrossRef]
  19. Dong, N.; Yang, X.; Chan, E.W.-C.; Zhang, R.; Chen, S. Klebsiella species: Taxonomy, hypervirulence and multidrug resistance. eBioMedicine 2022, 79, 103998. [Google Scholar] [CrossRef]
  20. Ge, H.; Qiao, J.; Xu, H.; Liu, R.; Zhao, J.; Chen, R.; Li, C.; Chen, M.; Guo, X. Emergence of OXA-484-producing Klebsiella variicola in China. Infect. Drug Resist. 2023, 16, 1767–1775. [Google Scholar] [CrossRef]
  21. Lenzi, M.H.; Martins, W.M.B.S.; Roch, M.; Ramos, P.L.; Sands, K.; Cayô, R.; Walsh, T.R.; Andrey, D.O.; Gales, A.C. A new mutation in mgrb mediating polymyxin resistance in Klebsiella variicola. Int. J. Antimicrob. Agents 2021, 58, 106424. [Google Scholar] [CrossRef] [PubMed]
  22. Garza-Ramos, U.; Rodriguez-Medina, N.; Lozano-Aguirre, L.; Silva-Sanchez, J.; Sanchez-Arias, M.; Rodriguez-Olguin, J.; Martínez-Romero, E. Klebsiella variicola reference strain F2R9 (ATCC BAA-830) genome sequence. Microbiol. Resour. Ann. 2021, 10, e00329-21. [Google Scholar] [CrossRef] [PubMed]
  23. Srinivasan, V.B.; Rajamohan, G. Comparative genome analysis and characterization of a MDR Klebsiella variicola. Genomics 2020, 5, 3179–3190. [Google Scholar] [CrossRef] [PubMed]
  24. Zhao, W.; Zhou, J.; Li, Z.; Jing, T.; Zhao, L.; Ye, H. Characterization of 55 SNP markers in Chinese longsnout catfish Leriocassis Longirostris. Conserv. Genet. Resour. 2020, 12, 427–432. [Google Scholar] [CrossRef]
  25. Wang, F.; Ma, X.; Wang, W.; Liu, J. Comparison of proximate composition, amino acid and fatty acid profiles in wild, pond- and cage-cultured longsnout catfish (Leiocassis longirostris). Int. J. Food Sci. Technol. 2012, 47, 1772–1776. [Google Scholar] [CrossRef]
  26. Mou, C.Y.; Li, Y.; Zhou, J.; Li, Q.; Zhou, B.; Wei, Z.; Luo, H.; Ke, H.Y.; Duan, Y.L.; Zhai, W.T. Genome-wide association study reveals growth-related markers and candidate genes for selection in Chinese longsnout catfish (Leiocassis longirostris). Aquaculture 2022, 560, 738513. [Google Scholar] [CrossRef]
  27. Cai, S.; Wu, Z.; Jian, J.; Lu, Y.; Tang, J. Characterization of pathogenic Aeromonas veronii bv. veronii associated with ulcerative syndrome from Chinese longsnout catfish (Leiocassis longirostris Günther). Braz. J. Microbiol. 2012, 1, 382–388. [Google Scholar]
  28. Xiao, Y.; Lei, Y.; Tang, S.L.; Zhang, H.J.; Wang, X.; Wang, X.P. Identification and antibiotic sensitivity of Edwardsiella ictaluri isolated from cultured Leiocassis longirostris. Chin. J. Fish. 2015, 28, 39–44. (In Chinese) [Google Scholar]
  29. Fonseca, E.L.; Ramos, N.d.V.; Andrade, B.G.N.; Morais, L.L.C.S.; Marin, M.F.A.; Vicente, A.C.P. A one-step multiplex PCR to identify Klebsiella pneumoniae, Klebsiella variicola, and Klebsiella quasipneumoniae in the clinical routine. Diagn. Microbiol. Infect. Dis. 2017, 4, 315–317. [Google Scholar] [CrossRef]
  30. Desai, S.; Sanghrajka, K.; Gajjar, D. High adhesion and increased cell death contribute to strong biofilm formation in Klebsiella pneumoniae. Pathogens 2019, 8, 277. [Google Scholar] [CrossRef]
  31. Laboratory Medicine Brach of Chinese Geriatrics Society; Shanghai Society of Laboratory Medicine; Clinical Microbiology Division of Shanghai Society of Microbiology. Expert consensus on laboratory testing for hypervirulent Klebsiella pneumoniae. Chin. J. Lab. Med. 2023, 46, 1164–1172. [Google Scholar]
  32. Zhang, T.; Yang, H.; Kang, L.; Gao, S.; Xin, W.; Yao, W.; Zhuang, X.; Ji, B.; Wang, J. Strong protection against ricin challenge induced by a novel modified ricin A-chain protein in mouse model. Hum. Vaccines Immunother. 2015, 11, 1779–1787. [Google Scholar] [CrossRef] [PubMed]
  33. Clinical and Laboratory Standards Institute (CLSI). CLSI M100TM Performance Standards for Antimicrobial Susceptibility Testing, 34th ed.; Clinical and Laboratory Standards Institute: Malvern, PA, USA, 2024. [Google Scholar]
  34. Yoon, S.H.; Ha, S.M.; Lim, J.; Kwon, S.; Chun, J. A large-scale evaluation of algorithms to calculate average nucleotide identity. Antonie Leeuwenhoek 2017, 110, 1281–1286. [Google Scholar] [CrossRef] [PubMed]
  35. Meier-Kolthoff, J.P.; Carbasse, J.S.; Peinado-Olarte, R.L.; Göker, M. TYGS and LPSN: A database tandem for fast and reliable genome-based classification and nomenclature of prokaryotes. Nucleic Acids Res. 2021, 50, D801–D807. [Google Scholar] [CrossRef] [PubMed]
  36. Alikhan, N.F.; Petty, N.K.; Ben Zakour, N.L.; Beatson, S.A. BLAST Ring Image Generator (BRIG): Simple prokaryote genome comparisons. BMC Genom. 2011, 12, 402. [Google Scholar] [CrossRef] [PubMed]
  37. Lu, Y.; Feng, Y.; McNally, A.; Zong, Z. Occurrence of colistin-resistant hypervirulent Klebsiella variicola. J. Antimicrob. Chemother. 2018, 73, 3001–3004. [Google Scholar] [CrossRef]
  38. Yang, X.; Chan, E.W.-C.; Zhang, R.; Chen, S. A conjugative plasmid that augments virulence in Klebsiella pneumoniae. Nat. Microbiol. 2019, 4, 2039–2043. [Google Scholar] [CrossRef] [PubMed]
  39. Abbas, R.; Chakkour, M.; Zein, H.; Obaseki, E.F.; Obeid, S.T.; Jezzini, A.; Ghssein, G.; Ezzeddine, Z. General overview of Klebsiella pneumonia: Epidemiology and the role of siderophores in its pathogenicity. Biology 2024, 13, 78. [Google Scholar] [CrossRef] [PubMed]
  40. Guerra, M.E.S.; Destro, G.; Vieira, B.; Lima, A.S.; Ferraz, L.F.C.; Hakansson, A.P.; Darrieux, M.; Converso, T.R. Klebsiella pneumoniae biofilms and their role in disease pathogenesis. Front. Cell. Infect. Microbiol. 2022, 12, 877995. [Google Scholar] [CrossRef]
  41. Farzana, R.; Jones, L.S.; Rahman, A.; Andrey, D.O.; Sands, K.; Portal, E.; Watkins, W.J.; Pervin, M.; Banerjee, M.; Walsh, T.R. Outbreak of hypervirulent multidrug-resistant Klebsiella variicola causing high mortality in neonates in Bangladesh. Clin. Infect. Dis. 2019, 7, 1225–1227. [Google Scholar] [CrossRef]
  42. He, Z.E.; Cao, L.W.; Dai, Y.Y.; Lu, H.W.; Sun, B.L.; Li, Y.J. An abnormal multidrug-resistant and hypervirulent Klebsiella pneumoniae clinical isolate without rmpA or rmpA2. J. Univ. Sci. Technol. China 2023, 53, 54–59+70. (In Chinese) [Google Scholar] [CrossRef]
  43. Shen, L.F.; Hu, R.J.; Wan, L.; Huang, J. Whole-genome sequencing and virulence characteristics of Klebsiella variicola. Occup. Health 2024, 40, 732–738. (In Chinese) [Google Scholar]
  44. Crippa, C.; Pasquali, F.; Rodrigues, C.; De Cesare, A.; Lucchi, A.; Gambi, L.; Manfreda, G.; Brisse, S.; Palma, F. Genomic features of Klebsiella isolates from artisanal ready-to-eat food production facilities. Sci. Rep. 2023, 13, 10957. [Google Scholar] [CrossRef] [PubMed]
  45. Nikapitiya, C.; Chandrarathna, H.P.S.U.; Dias, M.K.H.M.; Lee, J.M.; Zoysa, D. Characterization and biocontrol efficacy of lytic phage (KPP-1) that infects multidrug resistant Klebsiella variicola. Braz. J. Microbiol. 2023, 54, 2509–2520. [Google Scholar] [CrossRef]
  46. Vieira, A.T.; Rocha, V.M.; Tavares, L.; Garcia, C.C.; Teixeira, M.M.; Oliveira, S.C.; Cassali, G.D.; Gamba, C.; Martins, F.S.; Nicoli, J.R. Control of Klebsiella pneumoniae pulmonary infection and immunomodulation by oral treatment with the commensal probiotic Bifidobacterium longum 51A. Microbes Infect. 2016, 18, 180–189. [Google Scholar] [CrossRef] [PubMed]
  47. Winnett, V.; Sirdaarta, J.; White, A.; Clarke, F.M.; Cock, I.E. Inhibition of Klebsiella pneumoniae growth by selected Australian plants: Natural approaches for the prevention and management of ankylosing spondylitis. Inflammopharmacology 2017, 25, 223–235. [Google Scholar] [CrossRef] [PubMed]
  48. Assoni, L.; Girardello, R.; Converso, T.R.; Darrieux, M. Current stage in the development of Klebsiella pneumoniae vaccines. Infect. Dis. Ther. 2021, 10, 2157–2175. [Google Scholar] [CrossRef]
Pathogens 13 00647 g001
Figure 1. Clinical signs of naturally occurring disease in Chinese longsnout catfish. (A) Swollen abdomen, hemorrhage in the base of the fin, anal dilatation with hyperemia; (B) fluid accumulation in the abdominal cavity, and liver and kidney enlargement.
Figure 1. Clinical signs of naturally occurring disease in Chinese longsnout catfish. (A) Swollen abdomen, hemorrhage in the base of the fin, anal dilatation with hyperemia; (B) fluid accumulation in the abdominal cavity, and liver and kidney enlargement.
Pathogens 13 00647 g001
Pathogens 13 00647 g002
Figure 2. Morphological characteristics of the colony (A) and bacterium (B) of strain LL2208. Strain LL2208 was streaked on Columbia blood agar plate and incubated at 29 °C for 48 h. The bacterial morphology of strain LL2208 was observed using transmission electron microscopy (HT7800; Hitachi, Tokyo, Japan) with 6000× magnification.
Figure 2. Morphological characteristics of the colony (A) and bacterium (B) of strain LL2208. Strain LL2208 was streaked on Columbia blood agar plate and incubated at 29 °C for 48 h. The bacterial morphology of strain LL2208 was observed using transmission electron microscopy (HT7800; Hitachi, Tokyo, Japan) with 6000× magnification.
Pathogens 13 00647 g002
Pathogens 13 00647 g003
Figure 3. The phylogenetic tree constructed based on 16S rRNA gene sequences.
Figure 3. The phylogenetic tree constructed based on 16S rRNA gene sequences.
Pathogens 13 00647 g003
Pathogens 13 00647 g004
Figure 4. String test of strain LL2208 with initial strain (A) and two passages (B).
Figure 4. String test of strain LL2208 with initial strain (A) and two passages (B).
Pathogens 13 00647 g004
Pathogens 13 00647 g005
Figure 5. The relationship of genomic collinearity.
Figure 5. The relationship of genomic collinearity.
Pathogens 13 00647 g005
Table 1. Primer sequences of virulence-associated genes.
Table 1. Primer sequences of virulence-associated genes.
GenePrimerSequence (5′-3′)Length (bp)
rmpAKvrmpA-FAACTGGACTACCTCTGTTTC537
KvrmpA-RCTTGGCATGAGCCATCTTTCA
rmpA2rmpA2-FCTTTATGTGCAATAAGGATGTT447
rmpA2-RCCTCCTGGAGAGTAAGCATT
magAmagA-FTTAATGTCTTAGGGCCTTTGC720
magA-RATTGACCATATTGCTCCGTTG
peg-344peg344-FGCTCTTGAAACTATCCCTCCA388
peg344-RGGGCAATAACTCCCGTCCACT
iroBiroB-FCCCGATCTCATCATCTACCCTCC752
iroB-RGCCATTTCCGCCGCTACCTCT
iucBiucB-FACTTTCAGCGGTGGTTCTCCC509
iucB-RGGTCAAAGGGTTGCCATGAATAG
Table 2. Results of drug sensitivity tests of strain LL2208.
Table 2. Results of drug sensitivity tests of strain LL2208.
ClassAntimicrobial AgentsBreakpoints (mm) *Zone Diameter
(mm)		Sensitivity
RIS
PenicillinsPenicillin≤1314~16≥176.0R
Amoxicillin≤1314~17≥186.0R
CephalosporinsCephalexin≤1415~17≥1822.5S
Ceftriaxone≤1920~22≥2335.5S
TetracyclinesTetracycline≤1112~14≥1517.5S
Doxycycline≤1011~13≥1415.0S
AmphenicolsChloramphenicol≤1213~17≥186.0R
Florfenicol≤1213~17≥1810.2R
QuinolonesEnrofloxacin≤1516~20≥2119.0I
Ofloxacin≤1213~15≥1618.3S
Norfloxacin≤1213~16≥1715.6I
AminoglycosidesGentamicin≤1415~17≥1818.2S
Streptomycin≤1112~14≥1515.3S
Tobramycin≤1213~14≥1519.1S
MacrolidesRoxithromycin≤1314~22≥236.0R
Erythromycin≤1314~22≥236.0R
SulfonamidesSulfamethoxazole/Trimethoprim≤1011~15≥1623.3S
Sulfamethoxazole≤1213~16≥1717.4S
LincosamidesLincomycin≤910~15≥166.0R
GlycopeptidesVancomycin≤910~15≥166.0R
OthersFosfomycin≤1213~15≥1619.7S
Notes: R, resistant; I, intermediate; S, susceptible. * The breakpoints were determined according to the Performance Standards for Antimicrobial Susceptibility Testing [33].
Table 3. OrthoANIu and dDDH analysis between LL2208 and reference Klebsiella strains.
Table 3. OrthoANIu and dDDH analysis between LL2208 and reference Klebsiella strains.
Klebsiella StrainsGenBank Accession No.OrthoANIu Value (%)dDDH (%)
K. variicola WCHKV030666CP02706499.98100
K. variicola 15WZ-82CP03235499.7498.70
K. variicola 13450CP03017399.1092.80
K. pneumoniae str.Kp52.145FO83490694.5558.60
K. pneumoniae BJCFK909CP03412394.5558.30
K. quasipneumoniae A708CP02636893.3452.50
Table 4. Virulence-associated genes in the genome of strain LL2208 were predicted by VFanalyzer.
Table 4. Virulence-associated genes in the genome of strain LL2208 were predicted by VFanalyzer.
ClassVirulence FactorsGenes
AdherenceType III fimbriaemrkA, mrkB, mrkC, mrkD, mrkF, mrkH, mrkI
Type I fimbriaefimA, fimB, fimC, fimD, fimE, fimF, fimG, fimH, fimI, fimK
Efflux pumpAcrABacrA, acrB
Iron uptakeAerobactiniutA
Ent siderophoreentA, entB, entC, entD, entE, entF, entS, fepA, fepB, fepC, fepD, fepG, fes
SalmocheliniroE, iroN
RegulationRcsABrcsA, rcsB
Secretion systemT6SS-IclpV/tssH, dotU/tssL, hcp/tssD, icmF/tssM, impA/tssA, ompA, sciN/tssJ, tssF, tssG, vasE/tssK, vgrG/tssI, vipA/tssB, vipB/tssC
T6SS-IIclpV
T6SS-IIIimpF
AutotransporterContact-dependent inhibition CDI systemcdiA
Fimbrial adherence determinantsStcstcB, stcC
StistiB
Magnesium uptakeMg2+ transportmgtB
Table 5. Genes associated with the antibiotic resistance of strain LL2208.
Table 5. Genes associated with the antibiotic resistance of strain LL2208.
Resistance MechanismAntimicrobial Resistance Gene FamilyGenes
Antibiotic effluxMFS antibiotic efflux pumpkpnG, kpnH, emrR, H-NS, leuO
RND antibiotic efflux pumpCRP, rsmA, adeF, oqxA, baeR, marR, marA
SMR antibiotic efflux pumpkpnE, kpnF, qacG
ABC antibiotic efflux pumplptD, msbA
Antibiotic inactivationBeta-lactamaseLEN-16
Fosfomycin thiol transferasefosA6
Antibiotic target alterationphosphoethanolamine transferaseeptB, arnT
glycopeptide resistance genevanG
Elfamycin-resistantEF-Tu
Fosfomycin-resistantuhpT
Penicillin-binding protein mutationspbp3
Reduced permeability to antibioticOuter Membrane PorinmdtQ
Reduced permeability to beta-lactamsompK37
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, Q.; Yu, X.; Ye, L.; Hou, T.; Liu, Y.; Liu, G.; Wang, Q.; Zhang, D. Hypermucoviscous Multidrug-Resistant Klebsiella variicola Strain LL2208 Isolated from Chinese Longsnout Catfish (Leiocassis longirostris): Highly Similar to Human K. variicola Strains. Pathogens 2024, 13, 647. https://doi.org/10.3390/pathogens13080647

AMA Style

Li Q, Yu X, Ye L, Hou T, Liu Y, Liu G, Wang Q, Zhang D. Hypermucoviscous Multidrug-Resistant Klebsiella variicola Strain LL2208 Isolated from Chinese Longsnout Catfish (Leiocassis longirostris): Highly Similar to Human K. variicola Strains. Pathogens. 2024; 13(8):647. https://doi.org/10.3390/pathogens13080647

Chicago/Turabian Style

Li, Qingyong, Xin Yu, Lin Ye, Tongyu Hou, Yi Liu, Guiming Liu, Qing Wang, and Defeng Zhang. 2024. "Hypermucoviscous Multidrug-Resistant Klebsiella variicola Strain LL2208 Isolated from Chinese Longsnout Catfish (Leiocassis longirostris): Highly Similar to Human K. variicola Strains" Pathogens 13, no. 8: 647. https://doi.org/10.3390/pathogens13080647

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop