Persistence of Salmonella and Campylobacter on Whole Chicken Carcasses under the Different Chlorine Concentrations Used in the Chill Tank of Processing Plants in Sri Lanka
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Enumeration of Salmonella and Campylobacter
2.3. Molecular Identification of Campylobacter and Serotyping of Non-Typhoidal Salmonella
2.4. Minimum Inhibitory Concentration (MIC) for Campylobacter and Salmonella
2.5. Statistical Analysis
3. Results
3.1. Enumeration of Campylobacter and Salmonella
3.2. Minimum Inhibitory Concentration (MIC) for Campylobacter and Salmonella
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. The Global View of Campylobacteriosis: Report of an Expert Consultation; WHO: Utrecht, The Netherlands, 2012; pp. 9–11.
- WHO. WHO Estimates of the Global Burden of Foodborne Diseases: Foodborne Disease Burden Epidemiology Reference Group 2007–2015; World Health Organization: Geneva, Switzerland, 2015.
- Heredia, N.; García, S. Animals as sources of foodborne pathogens: A review. Anim. Nutr. 2018, 4, 250–255. [Google Scholar] [CrossRef] [PubMed]
- FoodNet. Foodborne Diseases Active Surveillance Network. FoodNet Annual Surveillance Report. 2014. Available online: https://www.cdc.gov/foodnet/pdfs/2014-foodnet-surveillance-report.pdf (accessed on 29 April 2016).
- Akil, L.; Ahmad, H.A. Quantitative risk assessment model of human salmonellosis resulting from consumption of broiler chicken. Diseases 2019, 7, 19. [Google Scholar] [CrossRef] [PubMed]
- Dogan, O.B.; Clarke, J.; Mattos, F.; Wang, B. A quantitative microbial risk assessment model of Campylobacter in broiler chickens: Evaluating processing interventions. Food Control 2019, 100, 97–110. [Google Scholar] [CrossRef]
- USDA-FSIS; The U.S. Department of Agriculture’s (USDA) Food Safety and Inspection Service (FSIS). USDA Finalizes New Food Safety Measures Reduce Salmonella and Campylobacter in Poultry, Washington. 4 February 2016. Available online: https://www.usda.gov/media/press-releases/2016/02/04/usda-finalizes-new-food-safety-measures-reduce-salmonella-and (accessed on 4 February 2016).
- Ricke, S.C.; Kundinger, M.M.; Miller, D.R.; Keeton, J.T. Alternatives to antibiotics: Chemical and physical antimicrobial interventions and foodborne pathogen response. Poult. Sci. 2005, 84, 667–675. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, H.; Yamamoto, S. Campylobacter contamination in retail poultry meats and by-products in the world: A literature survey. J. Vet. Med. Sci. 2009, 71, 255–261. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Ge, B.; De Villena, J.; Sudler, R.; Yeh, E.; Zhao, S.; White, D.G.; Wagner, D.; Meng, J. Prevalence of Campylobacter spp., Escherichia coli, and Salmonella Serovars in Retail Chicken, Turkey, Pork, and Beef from the Greater Washington, D.C., Area. Appl. Environ. Microbiol. 2001, 67, 5431–5436. [Google Scholar] [CrossRef] [PubMed]
- Ta, Y.T.; Nguyen, T.T.; To, P.B.; Pham, D.X.; Le, H.T.H.; Thi, G.N.; Alali, W.Q.; Walls, I.; Doyle, M.P. Quantification, serovars, and antibiotic resistance of Salmonella isolated from retail raw in Vietnam. J. Food Prot. 2014, 77, 57–66. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Khoo, W.J.; Zheng, Q.; Chung, H.-J.; Yuk, H.-G. Counts, serotypes, and antimicrobial resistance of Salmonella isolates on retail raw poultry in the People’s Republic of China. J. Food Prot. 2014, 77, 894–902. [Google Scholar] [CrossRef]
- DAPH. Annual Report of the Department of Animal Production and Health; DAPH: Peradeniya, Sri Lanka, 2015. [Google Scholar]
- DAPH. Annual Report of the Department of Animal Production and Health; DAPH: Peradeniya, Sri Lanka, 2021. [Google Scholar]
- DAPH. Annual Report of the Department of Animal Production and Health; DAPH: Peradeniya, Sri Lanka, 2022. [Google Scholar]
- Kottawatta, K.S.A.; Van Bergen, M.A.P.; Abeynayake, P.; Wagenaar, J.A.; Veldman, K.T.; Kalupahana, R.S. Campylobacter in broiler chicken and broiler meat in Sri Lanka: Influence of semi-automated vs. wet market processing on Campylobacter contamination of broiler neck skin samples. Foods 2017, 6, 105. [Google Scholar] [CrossRef]
- Keener, K.; Bashor, M.; Curtis, P.; Sheldon, B.; Kathariou, S. Comprehensive review of Campylobacter and poultry processing. Compr. Rev. Food Sci. Food Saf. 2004, 3, 105–116. [Google Scholar] [CrossRef]
- Kulasooriya, G.; Amarasiri, M.; Abeykoon, A.; Kalupahana, R. Salmonella, Campylobacter and Escherichia coli in raw chicken meat, chicken products and cooked chicken in retail markets in Kandy, Sri Lanka. Sri Lanka Vet. J. 2019, 66, 19–26. [Google Scholar] [CrossRef]
- Paravisi, M.; Laviniki, V.; Bassani, J.; Kunert Filho, H.C.; Carvalho, D.; Wilsmann, D.E.; Borges, K.A.; Furian, T.Q.; Salle, C.T.P.; Moraes, H.L.d.S. Antimicrobial resistance in Campylobacter jejuni isolated from Brazilian poultry slaughterhouses. Braz. J. Poult. Sci. 2020, 22, eRBCA-2020-1262. [Google Scholar] [CrossRef]
- McDermott, P.F.; Bodeis-Jones, S.M.; Fritsche, T.R.; Jones, R.N.; Walker, R.D. Broth Microdilution Susceptibility Testing of Campylobacter jejuni and the Determination of Quality Control Ranges for Fourteen Antimicrobial Agents. J. Clin. Microbiol. 2006, 44, 6136–6138. [Google Scholar] [CrossRef]
- CDC, Centers for Disease Control and Prevention. Foodborne Burden. 2011. Available online: https://www.cdc.gov/foodborneburden/2011-foodborne-estimates.html (accessed on 5 November 2018).
- Engberg, J.; Aarestrup, F.M.; Taylor, D.E.; Gerner-Smidt, P.; Nachamkin, I. Quinolone and macrolide resistance in Campylobacter jejuni and C. coli: Resistance mechanisms and trends in human isolates. Emerg. Infect. Dis. 2001, 7, 24. [Google Scholar] [CrossRef] [PubMed]
- Szczepanska, B.; Andrzejewska, M.; Spica, D.; Klawe, J.J. Prevalence and antimicrobial resistance of Campylobacter jejuni and Campylobacter coli isolated from children and environmental sources in urban and suburban areas. BMC Microbiol. 2017, 17, 80. [Google Scholar] [CrossRef] [PubMed]
- Du, Y.; Wang, C.; Ye, Y.; Liu, Y.; Wang, A.; Li, Y.; Zhou, X.; Pan, H.; Zhang, J.; Xu, X. Molecular identification of multidrug-resistant Campylobacter species from diarrheal patients and poultry meat in Shanghai, China. Front. Microbiol. 2018, 9, 1642. [Google Scholar] [CrossRef] [PubMed]
- Montgomery, M.P. Multidrug-resistant Campylobacter jejuni outbreak linked to puppy exposure—United States, 2016–2018. MMWR Morb. Mortal. Wkly. Rep. 2018, 67, 1032–1035. [Google Scholar] [CrossRef] [PubMed]
- Jayaweera, T.S.P.; Ruwandeepika, H.A.D.; Deekshit, V.K.; Vidanarachchi, J.K.; Kodithuwakku, S.P.; Karunasagar, I.; Cyril, H.W. Isolation and Identification of Salmonella spp. from Broiler Chicken Meat in Sri Lanka and their Antibiotic Resistance. J. Agric. Sci. 2020, 15, 395–410. [Google Scholar] [CrossRef]
- Chousalkar, K.; Sims, S.; McWhorter, A.; Khan, S.; Sexton, M. The effect of sanitizers on microbial levels of collected from commercial processing plants. Int. J. Environ. Res. 2019, 16, 4807. [Google Scholar] [CrossRef]
- ISO 6579-1:2017; Microbiology of the Food Chain—Horizontal Method for the Detection, Enumeration and Serotyping of Salmonella—Part 1: Detection of Salmonella spp. ISO: Geneva, Switzerland, 2017; pp. 1–50. Available online: https://www.iso.org/obp/ui/en/#iso:std:iso:6579:-1:ed-1:v1:en (accessed on 1 June 2024).
- Singh, N.K.; Upadhyay, A.K.; Kamboj, A.; Shukla, M.; Ambwani, T.K.; Kumar, R.; Sharma, H.; Shukla, N. Evaluation of Various Methods for Genomic DNA Extraction from Pure Cultures of Lysis Resistant Campylobacters Isolated from Wild Animals. J. Anim. Res. 2022, 12, 775–781. [Google Scholar] [CrossRef]
- Syarifah, I.K.; Latif, H.; Basri, C.; Rahayu, P. Identification and differentiation of Campylobacter isolated from chicken meat using real-time polymerase chain reaction and high resolution melting analysis of hipO and glyA genes. Vet. World 2020, 13, 1875. [Google Scholar] [CrossRef]
- De Boer, P.; Rahaoui, H.; Leer, R.; Montijn, R.; Van der Vossen, J. Real-time PCR detection of Campylobacter spp.: A comparison to classic culturing and enrichment. Food Microbiol. 2015, 51, 96–100. [Google Scholar] [CrossRef]
- Kauffmann, V.; Edwards, P.R. A revised, simplified Kauffmann-White schema. Acta Pathol. Microbiol. Scand. 1957, 41, 242–246. [Google Scholar] [CrossRef]
- CLSI M100; Performance Standards for Antimicrobial Susceptibility Testing, 34th Edition. CLSI: Berwyn, PA, USA. Available online: https://clsi.org/standards/products/microbiology/documents/m100/ (accessed on 1 June 2024).
- EUCAST. Antimicrobial Susceptibility Testing. Available online: https://www.eucast.org/ast_of_bacteria (accessed on 1 January 2024).
- EUCAST. Clinical Breakpoints—Breakpoints and Guidance. Available online: https://www.eucast.org/clinical_breakpoints (accessed on 1 January 2024).
- Johnson, R. US-EU Poultry Dispute on the Use of Pathogen Reduction Treatments (PRTs); Congressional Research Service: Washington, DC, USA, 2015.
- Food Standards Australia New Zealand. Scientific Assessment of the Public Health and Safety of Poultry Meat in Australia; Food Standards Australia New Zealand: Kingston, Australia, 2005.
- EPA. Wastewater Technology Fact Sheet—Dechlorination; United States Environmental Protection Agency, Office of Water: Washington, DC, USA, 2000.
- Jalil, M.A.; Islam, M.T. Serological survey of Salmonella infection in non-vaccinated commercial layer birds in Khulna district of Bangladesh. Bangl. J. Vet. Med. 2011, 9, 27–31. [Google Scholar] [CrossRef]
- Kalupahana, R.; Kottawatta, K.; Kanankege, K.; Van Bergen, M.; Abeynayake, P.; Wagenaar, J. Colonization of Campylobacter spp. in broiler chickens and laying hens reared in tropical climates with low-biosecurity housing. Appl. Environ. Microbiol. 2013, 79, 393–395. [Google Scholar] [CrossRef]
- Guillén, S.; Nadal, L.; Álvarez, I.; Mañas, P.; Cebrián, G. Impact of the resistance responses to stress conditions encountered in food and food processing environments on the virulence and growth fitness of non-typhoidal Salmonellae. Foods 2021, 10, 617. [Google Scholar] [CrossRef]
- Gottardi, D.; Bukvicki, D.; Prasad, S.; Tyagi, A.K. Beneficial effects of spices in food preservation and safety. Front. Microbiol. 2016, 7, 186557. [Google Scholar] [CrossRef]
- Weerasooriya, G.; Khan, S.; Chousalkar, K.K.; McWhorter, A.R. Invasive potential of sub-lethally injured Campylobacter jejuni and Salmonella Typhimurium during storage in juice. Food Control 2022, 135, 108823. [Google Scholar] [CrossRef]
- Park, S.; Harrison, M.A.; Berrang, M.E. Post chill antimicrobial treatments to control Salmonella, Listeria, and Campylobacter contamination on chicken skin used in ground chicken. J. Food Prot. 2017, 80, 857–862. [Google Scholar] [CrossRef]
- Schlisselberg, D.B.; Kler, E.; Kisluk, G.; Shachar, D.; Yaron, S. Biofilm formation ability of Salmonella enterica serovar Typhimurium acrAB mutants. Int. J. Antimicrob. Agents 2015, 46, 456–459. [Google Scholar] [CrossRef]
- Nidaullah, H.; Abirami, N.; Shamila-Syuhada, A.K.; Chuah, L.-O.; Nurul, H.; Tan, T.P.; Abidin, F.W.Z.; Rusul, G. Prevalence of Salmonella in poultry processing environments in wet markets in Penang and Perlis, Malaysia. Vet. World 2017, 10, 286. [Google Scholar] [CrossRef]
- Ramya, P.; Madhavarao, T.; Rao, L.V. Study on the incidence of Salmonella enteritidis in poultry and meat samples by cultural and PCR methods. Vet. World 2012, 5, 541–545. [Google Scholar] [CrossRef]
- Wu, D.; Alali, W.; Harrison, M.A.; Hofacre, C.L. Prevalence of Salmonella in neck skin and bone of chickens. J. Food Prot. 2014, 77, 1193–1197. [Google Scholar] [CrossRef]
- Jacobs-Reitsma, W. Campylobacter in the food supply. In Campylobacter, 2nd ed.; Nachamkin, I., Blaser, M., Eds.; ASM Press: Washington, DC, USA, 2000. [Google Scholar]
- Pavic, A.; Cox, J.M.; Chenu, J.W. Effect of extending processing plant operating time on the microbiological quality and safety of broiler carcasses. Food Control 2015, 56, 103–109. [Google Scholar] [CrossRef]
- Bashor, M.P.; Curtis, P.A.; Keener, K.M.; Sheldon, B.W.; Kathariou, S.; Osborne, J.A. Effects of carcass washers on Campylobacter contamination in large broiler processing plants. Poult. Sci. 2004, 83, 1232–1239. [Google Scholar] [CrossRef]
- Arsenault, J.; Letellier, A.; Quessy, S.; Boulianne, M. Prevalence and risk factors for Salmonella and Campylobacter spp. carcass contamination in broiler chickens slaughtered in Quebec, Canada. J. Food Prot. 2007, 70, 1820–1828. [Google Scholar] [CrossRef]
- Hermans, D.; Van Deun, K.; Messens, W.; Martel, A.; Van Immerseel, F.; Haesebrouck, F.; Rasschaert, G.; Heyndrickx, M.; Pasmans, F. Campylobacter control in poultry by current intervention measures ineffective: Urgent need for intensified fundamental research. Vet. Microbiol. 2011, 152, 219–228. [Google Scholar] [CrossRef]
- Newell, D.G.; Fearnley, C. Sources of Campylobacter Colonization in Broiler Chickens. Appl. Environ. Microbiol. 2003, 69, 4343–4351. [Google Scholar] [CrossRef]
- Lillard, H. Factors affecting the persistence of Salmonella during the processing of poultry. J. Food Prot. 1989, 52, 829–832. [Google Scholar] [CrossRef]
- Fuzihara, T.O.; Fernandes, S.A.; Franco, B.D. Prevalence and dissemination of Salmonella serotypes along the slaughtering process in Brazilian small poultry slaughterhouses. J. Food Prot. 2000, 63, 1749–1753. [Google Scholar] [CrossRef]
- Muhandiramlage, G.K.; McWhorter, A.R.; Chousalkar, K.K. Chlorine induces physiological and morphological changes on Campylobacter isolates. Front. Microbiol. 2020, 11, 503. [Google Scholar] [CrossRef]
- Ma, L.; Wang, Y.; Shen, J.; Zhang, Q.; Wu, C. Tracking Campylobacter contamination along a broiler chicken production chain from the farm level to retail in China. Int. J. Food Microbiol. 2014, 181, 77–84. [Google Scholar] [CrossRef]
- CDC, Centers for Disease Control and Prevention. National Enteric Disease Surveillance: Salmonella Annual Report. 2016. Available online: https://www.cdc.gov/nationalsurveillance/pdfs/2016-Salmonella-report-508.pdf (accessed on 4 August 2021).
- EFSA, European Food Safety Authority; European Centre for Disease Prevention and Control. The European Union One Health 2019 Zoonoses Report. EFSA J. 2021, 19, e06406. [Google Scholar]
- Shah, D.H.; Paul, N.C.; Sischo, W.C.; Crespo, R.; Guard, J. Population dynamics and antimicrobial resistance of the most prevalent poultry-associated Salmonella serotypes. Poult. Sci. 2017, 96, 687–702. [Google Scholar] [CrossRef]
- Rosenquist, H.; Nielsen, N.L.; Sommer, H.M.; Nørrung, B.; Christensen, B.B. Quantitative risk assessment of human campylobacteriosis associated with thermophilic Campylobacter species in chickens. Int. J. Food Microbiol. 2003, 83, 87–103. [Google Scholar] [CrossRef]
- Virto, R.; Manas, P.; Alvarez, I.; Condon, S.; Raso, J. Membrane damage and microbial inactivation by chlorine in the absence and presence of a chlorine-demanding substrate. Appl. Environ. Microbiol. 2005, 71, 5022–5028. [Google Scholar] [CrossRef]
- Nagel, G.M.; Bauermeister, L.; Bratcher, C.; Singh, M.; McKee, S. Salmonella and Campylobacter reduction and quality characteristics of poultry carcasses treated with various antimicrobials in a post-chill immersion tank. Int. J. Food Microbiol. 2013, 165, 281–286. [Google Scholar] [CrossRef]
- Gnanadhas, D.P.; Marathe, S.A.; Chakravortty, D. Biocides—Resistance, cross-resistance mechanisms and assessment. Expert Opin. Investig. Drugs 2013, 22, 191–206. [Google Scholar] [CrossRef]
- Havelaar, A.H.; Mangen, M.J.J.; De Koeijer, A.A.; Bogaardt, M.J.; Evers, E.G.; Jacobs-Reitsma, W.F.; Van Pelt, W.; Wagenaar, J.A.; De Wit, G.A.; Van Der Zee, H. Effectiveness and efficiency of controlling Campylobacter on broiler chicken meat. Risk Anal. Int. J. 2007, 27, 831–844. [Google Scholar] [CrossRef]
- Weerasooriya, G.; Khan, S.; Chousalkar, K.K.; McWhorter, A.R. Transcriptomic response of Campylobacter jejuni following exposure to acidified sodium chlorite. npj Sci. Food 2021, 5, 23. [Google Scholar] [CrossRef] [PubMed]
- Frasao, B.d.S.; Medeiros, V.; Barbosa, A.V.; de Aguiar, W.S.; dos Santos, F.F.; Abreu, D.L.d.C.; Clementino, M.M.; de Aquino, M.H.C. Detection of fluoroquinolone resistance by mutation in gyrA gene of Campylobacter spp. isolates from broiler and laying (Gallus gallus domesticus) hens, from Rio de Janeiro State, Brazil. Ciência Rural 2015, 45, 2013–2018. [Google Scholar] [CrossRef]
- Post, A.; Martiny, D.; van Waterschoot, N.; Hallin, M.; Maniewski, U.; Bottieau, E.; Van Esbroeck, M.; Vlieghe, E.; Ombelet, S.; Vandenberg, O. Antibiotic susceptibility profiles among Campylobacter isolates obtained from international travellers between 2007 and 2014. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 2101–2107. [Google Scholar] [CrossRef]
- Forgaciu, A.; Tabaran, A.; Colobatiu, L.; Mihaiu, R.; Dan, S.D.; Mihaiu, M. Concerning Increase in Antimicrobial Resistance Patterns of Pathogenic Strains of Salmonella Isolated in Poultry Meat Products. Antibiotics 2022, 11, 1469. [Google Scholar] [CrossRef]
- Bahramianfard, H.; Derakhshandeh, A.; Naziri, Z.; Khaltabadi Farahani, R. Prevalence, virulence factor and antimicrobial resistance analysis of Salmonella Enteritidis from poultry and egg samples in Iran. BMC Vet. Res. 2021, 17, 196. [Google Scholar] [CrossRef]
- Tay, M.Y.; Pathirage, S.; Chandrasekaran, L.; Wickramasuriya, U.; Sadeepanie, N.; Waidyarathna, K.D.; Liyanage, L.D.C.; Seow, K.L.; Hendriksen, R.S.; Takeuchi, M.T. Whole-genome sequencing analysis of nontyphoidal Salmonella enterica of chicken meat and human origin under surveillance in Sri Lanka. Foodborne Pathog. Dis. 2019, 16, 531–537. [Google Scholar] [CrossRef] [PubMed]
- Patra, S.D.; Mohakud, N.K.; Panda, R.K.; Sahu, B.R.; Suar, M. Prevalence and multidrug resistance in Salmonella enterica Typhimurium: An overview in South East Asia. World J. Microbiol. Biotechnol. 2021, 37, 185. [Google Scholar] [CrossRef]
- Mattock, J.; Chattaway, M.A.; Hartman, H.; Dallman, T.J.; Smith, A.M.; Keddy, K.; Langridge, G.C. A One Health Perspective on Salmonella enterica Serovar Infantis, an Emerging Human Multidrug-Resistant Pathogen. Emerg. Infect. Dis. 2024, 30, 701. [Google Scholar] [CrossRef]
- Mavri, A.; Možina, S.S. Development of antimicrobial resistance in Campylobacter jejuni and Campylobacter coli adapted to biocides. Int. J. Food Microbiol. 2013, 160, 304–312. [Google Scholar] [CrossRef]
- Thames, H.T.; Theradiyil Sukumaran, A. A review of Salmonella and Campylobacter in broiler meat: Emerging challenges and food safety measures. Foods 2020, 9, 776. [Google Scholar] [CrossRef]
- Obe, T.; Boltz, T.; Kogut, M.; Ricke, S.C.; Brooks, L.A.; Macklin, K.; Peterson, A. Controlling Salmonella: Strategies for feed, the farm, and the processing plant. Poult. Sci. 2023, 102, 103086. [Google Scholar] [CrossRef]
Primer Name | Sequences (5′–3′) | Target Gene |
---|---|---|
C.jejuni-F | ATGAAGCTGTGGATTTTGCTAGTG | hipO |
C.jejuni-R | AAATCCAAAATCCTCACTTGCCA | hipO |
C.coli-F | CATATTGTAAAACCAAAGCTTATC | glyA |
C.coli-R | AGTCCAGCAATGTGTGCAATG | glyA |
Group | Serova | Somatic (O) Antigen | Flagella (H) Antigen |
---|---|---|---|
O: B | Salmonella enterica subspecies enterica serovar Typhimurium | 1,4,5,12 | i (phase 1) |
O: C1 | Salmonella enterica subspecies enterica serovar Infantis | 6,7,14 | r (phase 1) |
O: D | S. enterica subspecies enterica serovar Enteritidis | 1,9,12 | g,m (phase 1) |
Sample Type | Sample Number | Salmonella Positive Percentage (%) | Campylobacter Positive Percentage (%) |
---|---|---|---|
Carcass wash | 150 | 80.66 (121/150) | 68.66 (103/150) |
Neck skin | 100 | 73 (73/100) | 57 (57/100) |
Ceca | 100 | 79 (79/100) | 63 (63/100) |
Total | 350 | 78.25 (273/350) | 63.7 (223/350) |
Antimicrobial Agent | Minimum Inhibitory Concentration (MIC) n (%) | Resistant % | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
0.076 | 0.0312 | 0.063 | 0.125 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | 32 | 64 | 124 | 256 | ||
GEN * | 0 | 0 | 0 | 0 | 1 | 3 | 1 | 1 | 1 | 4 | 30 | |||||
(2.4) | (7.3) | (2.4) | (2.4) | (2.4) | (9.8) | (73.2) | 87.8 | |||||||||
CIP | 2 | 1 | 1 | 1 | 1 | 3 | 1 | 3 | 6 | 8 | 14 | |||||
(4.9) | (2.4) | (2.40 | (2.4) | (2.4) | (7.3) | (2.4) | (7.3) | (14.6) | (19.5) | (34.1) | 68.3 | |||||
NAL | 0 | 0 | 0 | 1 | 1 | 2 | 3 | 4 | 27 | 2 | 1 | 0 | ||||
(2.4) | (2.4) | (2.4) | (4.9) | (7.3) | (9.8) | (65.9) | (4.9) | (2.4) | 7.31 | |||||||
TET | 0 | 0 | 0 | 0 | 3 | 1 | 0 | 2 | 4 | 15 | 16 | |||||
(7.3) | (2.4) | 0 | (4.9) | (9.8) | (36.6) | (39) | 39 |
Antimicrobial Agent | Minimum Inhibitory Concentration (MIC) n (%) | Resistant % | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
0.063 | 0.125 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | 32 | 64 | 128 | 256 | 512 | 1028 | ||
GEN * | 0 | 4 | 7 | 14 | 6 | 9 | 3 | 3 | 2 | |||||||
(8.5) | (14.8) | (29.7) | (12.7) | (19.1) | (2.4) | (6.3) | (4.2) | 8.5 | ||||||||
CIP | 27 | 6 | 7 | 2 | 3 | 0 | 0 | 0 | 2 | 0 | ||||||
(57.4) | (12.7 | (14.8) | (4.2) | (2.4) | (4.2) | 14.9 | ||||||||||
NAL | 0 | 0 | 0 | 0 | 6 | 4 | 14 | 6 | 7 | 7 | 3 | |||||
(12.7) | (8.5) | (29.7) | (12.7) | (14.8) | (14.8) | (6.3) | 36.2 | |||||||||
TET | 0 | 2 | 2 | 1 | 6 | 6 | 16 | 13 | 0 | 0 | 1 | |||||
(4.2) | (2.1) | (12.7) | (12.7) | (34) | (27.6) | (2.1) | 63.8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Weerasooriya, G.; Dulakshi, H.M.T.; de Alwis, P.S.; Bandara, S.; Premarathne, K.R.P.S.; Dissanayake, N.; Liyanagunawardena, N.; Wijemuni, M.I.; Priyantha, M.A.R. Persistence of Salmonella and Campylobacter on Whole Chicken Carcasses under the Different Chlorine Concentrations Used in the Chill Tank of Processing Plants in Sri Lanka. Pathogens 2024, 13, 664. https://doi.org/10.3390/pathogens13080664
Weerasooriya G, Dulakshi HMT, de Alwis PS, Bandara S, Premarathne KRPS, Dissanayake N, Liyanagunawardena N, Wijemuni MI, Priyantha MAR. Persistence of Salmonella and Campylobacter on Whole Chicken Carcasses under the Different Chlorine Concentrations Used in the Chill Tank of Processing Plants in Sri Lanka. Pathogens. 2024; 13(8):664. https://doi.org/10.3390/pathogens13080664
Chicago/Turabian StyleWeerasooriya, Gayani, H. M. T. Dulakshi, P. S. de Alwis, Sandun Bandara, K. R. P. S. Premarathne, Nayanajith Dissanayake, N. Liyanagunawardena, M. I. Wijemuni, and M. A. R. Priyantha. 2024. "Persistence of Salmonella and Campylobacter on Whole Chicken Carcasses under the Different Chlorine Concentrations Used in the Chill Tank of Processing Plants in Sri Lanka" Pathogens 13, no. 8: 664. https://doi.org/10.3390/pathogens13080664
APA StyleWeerasooriya, G., Dulakshi, H. M. T., de Alwis, P. S., Bandara, S., Premarathne, K. R. P. S., Dissanayake, N., Liyanagunawardena, N., Wijemuni, M. I., & Priyantha, M. A. R. (2024). Persistence of Salmonella and Campylobacter on Whole Chicken Carcasses under the Different Chlorine Concentrations Used in the Chill Tank of Processing Plants in Sri Lanka. Pathogens, 13(8), 664. https://doi.org/10.3390/pathogens13080664