Modelling the Potential Risk of Infection Associated with Listeria monocytogenes in Irrigation Water and Agricultural Soil in Two District Municipalities in South Africa
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Microbiological Analysis
2.3. Microbial Risk Modelling
2.3.1. Hazard Identification
2.3.2. Hazard Characterization
2.3.3. Exposure Assessment
2.3.4. Risk Characterization
3. Results and Discussion
3.1. Hazard Identification and Concentration of L. monocytogenes in the Samples
3.2. Dose Modelling and Hazard Characterization
3.3. Exposure Assessment
3.4. Risk Characterization
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Linke, K.; Rückerl, I.; Brugger, K.; Karpiskova, R.; Walland, J.; Muri-Klinger, S.; Tichy, A.; Wagner, M.; Stessl, B. Reservoirs of Listeria Species in Three Environmental Ecosystems. Appl. Environ. Microbiol. 2014, 80, 5583–5592. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barba, F.J.; Koubaa, M.; do Prado-Silva, L.; Orlien, V.; Sant’Ana, A.D.S. Mild processing applied to the inactivation of the main foodborne bacterial pathogens: A review. Trends Food Sci. Technol. 2017, 66, 20–35. [Google Scholar] [CrossRef]
- Bae, D.; Mezal, E.H.; Smiley, R.D.; Cheng, C.-M.; Khan, A.A. The sub-species characterization and antimicrobial resistance of Listeria monocytogenes isolated from domestic and imported food products from 2004 to 2011. Food Res. Int. J. 2014, 64, 656–663. [Google Scholar] [CrossRef] [PubMed]
- Reda, W.W.; Abdel-Moein, K.; Hegazi, A.; Mohamed, Y.; El-Razik, K.A. Listeria monocytogenes: An emerging food-borne pathogen and its public health implications. J. Infect. Dev. Ctries. 2016, 10, 149–154. [Google Scholar] [CrossRef] [PubMed]
- Matereke, L.T.; Okoh, A.I. Listeria monocytogenes Virulence, Antimicrobial Resistance and Environmental Persistence: A Review. Pathogens 2020, 9, 528. [Google Scholar] [CrossRef] [PubMed]
- Kathariou, S. Listeria monocytogenes Virulence and Pathogenicity, a Food Safety Perspective. J. Food Prot. 2002, 65, 1811–1829. [Google Scholar] [CrossRef] [PubMed]
- Vivant, A.-L.; Garmyn, D.; Piveteau, P. Listeria monocytogenes, a down-to-earth pathogen. Front. Cell. Infect. Microbiol. 2013, 3, 87. [Google Scholar] [CrossRef] [Green Version]
- Buchanan, R.L.; Gorris, L.; Hayman, M.M.; Jackson, T.C.; Whiting, R.C. A review of Listeria monocytogenes: An update on outbreaks, virulence, dose-response, ecology, and risk assessments. Food Control 2017, 75, 1–13. [Google Scholar] [CrossRef]
- Kayode, A.J.; Igbinosa, E.O.; Okoh, A. Overview of listeriosis in the Southern African Hemisphere—Review. J. Food Saf. 2019, 40, e12732. [Google Scholar] [CrossRef] [Green Version]
- Gohar, S.; Abbas, G.; Sajid, S.; Sarfraz, M.; Ali, S.; Ashraf, M.; Aslam, R.; Yaseen, K. Prevalence and antimicrobial resistance of Listeria monocytogenes isolated from raw milk and dairy products. Matrix Sci. Medica 2017, 1, 10–14. [Google Scholar] [CrossRef]
- WHO World Health Organization. Listeriosis–South Africa. Available online: https://www.who.int/csr/don/02-may-2018-listeriosis-south-africa/en/ (accessed on 23 December 2020).
- Li, Z.; Pérez-Osorio, A.; Wang, Y.; Eckmann, K.; Glover, W.A.; Allard, M.W.; Brown, E.W.; Chen, Y. Whole genome sequencing analyses of Listeria monocytogenes that persisted in a milkshake machine for a year and caused illnesses in Washington State. BMC Microbiol. 2017, 17, 134. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Luo, Y.; Carleton, H.; Timme, R.; Melka, D.; Muruvanda, T.; Wang, C.; Kastanis, G.; Katz, L.S.; Turner, L.; et al. Whole Genome and Core Genome Multilocus Sequence Typing and Single Nucleotide Polymorphism Analyses of Listeria monocytogenes Isolates Associated with an Outbreak Linked to Cheese, United States, 2013. Appl. Environ. Microbiol. 2017, 83, e00633-17. [Google Scholar] [CrossRef] [Green Version]
- Schjørring, S.; Lassen, S.G.; Jensen, T.; Moura, A.; Kjeldgaard, J.S.; Müller, L.; Thielke, S.; Leclercq, A.; Maury, M.M.; Tourdjman, M.; et al. Cross-border outbreak of listeriosis caused by cold-smoked salmon, revealed by integrated surveillance and whole genome sequencing (WGS), Denmark and France, 2015 to 2017. Eurosurveillance 2017, 22, 17–00762. [Google Scholar] [CrossRef] [PubMed]
- Gelbíčová, T.; Zobaníková, M.; Tomáštíková, Z.; Van Walle, I.; Ruppitsch, W.; Karpíšková, R. An outbreak of listeriosis linked to turkey meat products in the Czech Republic, 2012–2016. Epidemiol. Infect. 2018, 146, 1407–1412. [Google Scholar] [CrossRef] [Green Version]
- Angelo, K.M.; Conrad, A.R.; Saupe, A.; Dragoo, H.; West, N.; Sorenson, A.; Barnes, A.; Doyle, M.; Beal, J.; Jackson, K.A.; et al. Multistate outbreak of Listeria monocytogenes infections linked to whole apples used in commercially produced, prepackaged caramel apples: United States, 2014–2015. Epidemiol. Infect. 2017, 145, 848–856. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- CDC Centers for Disease Control and Prevention. List of Selected Multistate Foodborne Outbreak Investigations. Available online: https://www.cdc.gov/foodsafety/outbreaks/multistate-outbreaks/outbreaks-list.html (accessed on 25 March 2019).
- CDC Centers for Disease Control and Prevention. Multistate Outbreak of Listeriosis Linked to Frozen Vegetables (Final Update). Available online: https://www.cdc.gov/listeria/outbreaks/frozen-vegetables-05-16/index.html (accessed on 25 March 2019).
- CDC Centers for Disease Control and Prevention. Multistate Outbreak of Listeriosis Linked to Packaged Salads Produced at Springfield, Ohio Dole Processing Facility (Final Update). Available online: https://www.cdc.gov/listeria/outbreaks/bagged-salads-01-16/index.html (accessed on 25 March 2019).
- Iwu, C.D.; Okoh, A.I. Preharvest Transmission Routes of Fresh Produce Associated Bacterial Pathogens with Outbreak Potentials: A Review. Int. J. Environ. Res. Public Health 2019, 16, 4407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Komora, N.; Bruschi, C.; Magalhães, R.; Ferreira, V.B.; Teixeira, P. Survival of Listeria monocytogenes with different antibiotic resistance patterns to food-associated stresses. Int. J. Food Microbiol. 2017, 245, 79–87. [Google Scholar] [CrossRef]
- Allen, K.J.; Wałecka-Zacharska, E.; Chen, J.C.; Katarzyna, K.-P.; Devlieghere, F.; Van Meervenne, E.; Osek, J.; Wieczorek, K.; Bania, J. Listeria monocytogenes–An examination of food chain factors potentially contributing to antimicrobial resistance. Food Microbiol. J. 2016, 54, 178–189. [Google Scholar] [CrossRef]
- Wang, X.-M.; Lü, X.-F.; Yin, L.; Liu, H.-F.; Zhang, W.-J.; Si, W.; Yu, S.-Y.; Shao, M.-L.; Liu, S.-G. Occurrence and antimicrobial susceptibility of Listeria monocytogenes isolates from retail raw foods. Food Control 2013, 32, 153–158. [Google Scholar] [CrossRef]
- Rajwar, A.; Srivastava, P.; Sahgal, M. Microbiology of Fresh Produce: Route of Contamination, Detection Methods, and Remedy. Crit. Rev. Food Sci. Nutr. 2016, 56, 2383–2390. [Google Scholar] [CrossRef]
- Zhu, Q.; Gooneratne, S.R.; Hussain, M.A. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels. Foods 2017, 6, 21. [Google Scholar] [CrossRef] [Green Version]
- WHO World Health Organization. Quantitative Microbial Risk Assessment: Application for Water Safety Management. Available online: http://www.who.int/water_sanitation_health/publications/qmra/en/ (accessed on 25 April 2018).
- ECSECC Eastern Cape Socio Economic Consultative Council. Amathole District Municipality Socio Economic Review and Outlook, 2017; ECSECC Eastern Cape Socio Economic Consultative Council: East London, South Africa, 2017. [Google Scholar]
- CHDM about Us–Chris Hani District Municipality. Available online: https://www.chrishanidm.gov.za/municipality/about-us/ (accessed on 30 January 2021).
- Iwu, C.D.; Okoh, A.I. Characterization of antibiogram fingerprints in Listeria monocytogenes recovered from irrigation water and agricultural soil samples. PLoS ONE 2020, 15, e0228956. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jami, S.; Jamshidi, A.; Khanzadi, S. The presence of Listeria monocytogenes in raw milk samples in Mashhad, Iran. Iran. J. Vet. Res. 2010, 11, 363–367. [Google Scholar]
- Du, X.-J.; Zhang, X.; Wang, X.-Y.; Su, Y.; Li, P.; Wang, S. Isolation and characterization of Listeria monocytogenes in Chinese food obtained from the central area of China. Food Control 2016, 74, 9–16. [Google Scholar] [CrossRef]
- Coroneo, V.; Carraro, V.; Aissani, N.; Sanna, A.; Ruggeri, A.; Succa, S.; Meloni, B.; Pinna, A.; Sanna, C. Detection of Virulence Genes and Growth Potential in Listeria monocytogenes Strains Isolated from Ricotta Salata Cheese. J. Food Sci. 2015, 81, M114–M120. [Google Scholar] [CrossRef]
- Liu, D.; Lawrence, M.L.; Austin, F.W.; Ainsworth, A.J. A multiplex PCR for species- and virulence-specific determination of Listeria monocytogenes. J. Microbiol. Methods 2007, 71, 133–140. [Google Scholar] [CrossRef]
- Lomonaco, S.; Patti, R.; Knabel, S.J.; Civera, T. Detection of virulence-associated genes and epidemic clone markers in Listeria monocytogenes isolates from PDO Gorgonzola cheese. Int. J. Food Microbiol. 2012, 160, 76–79. [Google Scholar] [CrossRef] [PubMed]
- Kaur, S.; Malik, S.V.S.; Vaidya, V.M.; Barbuddhe, S.B. Listeria monocytogenes in spontaneous abortions in humans and its detection by multiplex PCR. J. Appl. Microbiol. 2007, 103, 1889–1896. [Google Scholar] [CrossRef] [PubMed]
- CAC Codex Alimentarius Commission. Principles and Guidelines for the Conduct of Microbiological Risk Management (MRM). Available online: http://www.fao.org/docrep/004/y1579e/y1579e05.htm (accessed on 26 April 2018).
- Smith, A.M.; Tau, N.P.; Smouse, S.L.; Allam, M.; Ismail, A.; Ramalwa, N.R.; Disenyeng, B.; Ngomane, M.; Thomas, J. Outbreak of Listeria monocytogenes in South Africa, 2017–2018: Laboratory Activities and Experiences Associated with Whole-Genome Sequencing Analysis of Isolates. Foodborne Pathog. Dis. 2019, 16, 524–530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haas, C.N.; Rose, J.B.; Gerba, C.P. Quantitative Microbial Risk Assessment; John Wiley & Sons, Inc.: New York, NY, USA, 1999; ISBN 9780471183976. [Google Scholar]
- Kouamé, P.K.; Nguyen-Viet, H.; Dongo, K.; Zurbrügg, C.; Biémi, J.; Bonfoh, B. Microbiological risk infection assessment using QMRA in agriculture systems in Côte d’Ivoire, West Africa. Environ. Monit. Assess. 2017, 189, 587. [Google Scholar] [CrossRef] [Green Version]
- Ding, T.; Iwahori, J.; Kasuga, F.; Wang, J.; Forghani, F.; Park, M.-S.; Oh, D.-H. Risk assessment for Listeria monocytogenes on lettuce from farm to table in Korea. Food Control 2012, 30, 190–199. [Google Scholar] [CrossRef]
- Franz, E.; Tromp, S.O.; Rijgersberg, H.; Van Der Fels-Klerx, H.J. Quantitative Microbial Risk Assessment for Escherichia coli O157:H7, Salmonella, and Listeria monocytogenes in Leafy Green Vegetables Consumed at Salad Bars. J. Food Prot. 2010, 73, 274–285. [Google Scholar] [CrossRef] [PubMed]
- Balderrama-Carmona, A.P.; Gortáres-Moroyoqui, P.; Álvarez-Valencia, L.H.; Castro-Espinoza, L.; Mondaca-Fernández, I.; Balderas-Cortés, J.D.J.; Chaidez-Quiroz, C.; Meza-Montenegro, M.M. Occurrence and quantitative microbial risk assessment of Cryptosporidium and Giardia in soil and air samples. Int. J. Infect. Dis. 2014, 26, 123–127. [Google Scholar] [CrossRef] [Green Version]
- Shuval, H.; Lampert, Y.; Fattal, B. Development of a risk assessment approach for evaluating wastewater reuse standards for agriculture. Water Sci. Technol. 1997, 35, 15–20. [Google Scholar] [CrossRef]
- U.S. EPA. Exposure Factors Handbook (1997, Final Report); U.S. Environmental Protection Agency: Washington, DC, USA, 1997.
- DWAF Department of Water Affairs and Forestry. South African Water Quality Guidelines. Domest. Water Use 2012, 1, 1–197. [Google Scholar]
- WHO World Health Organization. Health Guidelines for the Use of Wastewater in Agriculture and Aquaculture. Available online: https://apps.who.int/iris/bitstream/handle/10665/39401/WHO_TRS_778.pdf?sequence=1&isAllowed=y (accessed on 3 June 2020).
- Mpondo, L.; Ebomah, K.E.; Okoh, A.I. Multidrug-Resistant Listeria Species Shows Abundance in Environmental Waters of a Key District Municipality in South Africa. Int. J. Environ. Res. Public Health 2021, 18, 481. [Google Scholar] [CrossRef] [PubMed]
- Falardeau, J.; Johnson, R.P.; Pagotto, F.; Wang, S. Occurrence, characterization, and potential predictors of verotoxigenic Escherichia coli, Listeria monocytogenes, and Salmonella in surface water used for produce irrigation in the Lower Mainland of British Columbia, Canada. PLoS ONE 2017, 12, e0185437. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weller, D.; Wiedmann, M.; Strawn, L.K. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State. Appl. Environ. Microbiol. 2015, 81, 6059–6069. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jamali, H.; Radmehr, B.; Thong, K.L. Prevalence, characterisation, and antimicrobial resistance of Listeria species and Listeria monocytogenes isolates from raw milk in farm bulk tanks. Food Control 2013, 34, 121–125. [Google Scholar] [CrossRef]
- Wang, G.; Qian, W.; Zhang, X.; Wang, H.; Ye, K.; Bai, Y.; Zhou, G. Prevalence, genetic diversity and antimicrobial resistance of Listeria monocytogenes isolated from ready-to-eat meat products in Nanjing, China. Food Control 2015, 50, 202–208. [Google Scholar] [CrossRef]
- Shi, W.; Qingping, W.; Jumei, Z.; Moutong, C.; Weipeng, G. Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food. Front. Microbiol. 2016, 7, 168. [Google Scholar] [CrossRef] [Green Version]
- Olaniran, A.O.; Nzimande, S.B.T.; Mkize, N.G. Antimicrobial resistance and virulence signatures of Listeria and Aeromonas species recovered from treated wastewater effluent and receiving surface water in Durban, South Africa. BMC Microbiol. 2015, 15, 234. [Google Scholar] [CrossRef] [PubMed]
- Poimenidou, S.V.; Dalmasso, M.; Papadimitriou, K.; Fox, E.; Skandamis, P.N.; Jordan, K. Virulence Gene Sequencing Highlights Similarities and Differences in Sequences in Listeria monocytogenes Serotype 1/2a and 4b Strains of Clinical and Food Origin from 3 Different Geographic Locations. Front. Microbiol. 2018, 9, 1103. [Google Scholar] [CrossRef] [PubMed]
- Katukiza, A.Y.; Ronteltap, M.; van der Steen, P.; Foppen, J.W.; Lens, P.N.L. Quantification of microbial risks to human health caused by waterborne viruses and bacteria in an urban slum. J. Appl. Microbiol. 2013, 116, 447–463. [Google Scholar] [CrossRef] [PubMed]
- Steele, M.; Odumeru, J. Irrigation Water as Source of Foodborne Pathogens on Fruit and Vegetables. J. Food Prot. 2004, 67, 2839–2849. [Google Scholar] [CrossRef]
- Smith, A.; Moorhouse, E.; Monaghan, J.; Taylor, C.; Singleton, I. Sources and survival of Listeria monocytogenes on fresh, leafy produce. J. Appl. Microbiol. 2018, 125, 930–942. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fewtrell, L.; Bartram, J. Water quality: Guidelines, standards and health. In Assessment of Risk and Risk Management for Water-Related Infectious Diseases; Fewtrell, L., Bartram, J., Eds.; IWA Publishing: London, UK, 2001; Volume 6, pp. 1–124. [Google Scholar]
- WHO World Health Organization. Guidelines for the Safe use of Wastewater, Excreta and Greywater-Volume 4. Available online: http://www.who.int/water_sanitation_health/publications/gsuweg4/en/ (accessed on 18 January 2021).
- Forslund, A.; Ensink, J.H.J.; Markussen, B.; Battilani, A.; Psarras, G.; Gola, S.; Sandei, L.; Fletcher, T.; Dalsgaard, A. Escherichia coli contamination and health aspects of soil and tomatoes (Solanum lycopersicum L.) subsurface drip irrigated with on-site treated domestic wastewater. Water Res. 2012, 46, 5917–5934. [Google Scholar] [CrossRef] [PubMed]
- Sant’Ana, A.S.; Franco, B.D.G.M.; Schaffner, D.W. Risk of infection with Salmonella and Listeria monocytogenes due to consumption of ready-to-eat leafy vegetables in Brazil. Food Control 2014, 42, 1–8. [Google Scholar] [CrossRef] [Green Version]
- CDC Centers for Disease Control and Prevention. People at Risk. Available online: https://www.cdc.gov/listeria/risk.html (accessed on 29 January 2021).
- NDA National Development Agency. State of Poverty and Its Manifestation in the Nine Provinces of South Africa; HSRC: Pretoria, South Africa, 2014. [Google Scholar]
- Obaromi, D.; Ndege, J.; Yongsong, Q. Disease mapping of tuberculosis prevalence in Eastern Cape Province, South Africa. J. Public Health 2019, 27, 241–248. [Google Scholar] [CrossRef] [Green Version]
Primer Sequence (5′-3′) | Target Genes | Cycling Conditions | Amplicon Size (bp) | References |
---|---|---|---|---|
F: GCTGAAGAGATTGCGAAAGAAG R: CAAAGAAACCTTGGATTTGCGG | prs | 5 min 95 °C 35 [30 s 94 °C, 90 s 60 °C, 90 s 72 °C] 5 min 2 °C | 370 | [30] |
F: GATACAGAAACATCGGTTGGC R: GTGTAATCTTGATGCCATCAG | prfA | 5 min 95 °C 35 [30 s 94 °C, 90 s 60 °C, 90 s 72 °C] 5 min 2 °C | 274 | [30] |
inlAF: CCTAGCAGGTCTAACCGCAC inlAR: TCGCTAATTTGGTTATGCCC | inlA | 5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C | 256 | [32] |
inlBF: TGATGTTGATGGAACGGTAAT inlBR: CTCGTGGAAGTTTGTAGATGC | inlB | 5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C | 272 | [31] |
inlCF: AATTCCCACAGGACACAACC inlCR: CGGGAATGCAATTTTTCACTA | inlC | 5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C | 517 | [33] |
inlJF: TGTAACCCCGCTTACACAGTT inlJR: AGCGGCTTGGCAGTCTAATA | inlJ | 5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C | 238 | [33] |
actAF: CCAAGCGAGGTAAATACGGGA actAR: GTCCGAAGCATTTACCTCTTC | actA | 5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C | 650 | [34] |
hlyF: ATCATCGACGGCAACCTCGGAGAC hlyR: CACCATTCCCAAGCTAAACCAGTGC | hlyA | 5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C | 404 | [31] |
plcAF: CTCGGACCATTGTAGTCATCTT plcAR: CACTTTCAGGCGTATTAGAAACGA | plcA | 5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C | 326 | [34] |
plcBF: AATATTTCAATCAATCGGTGGCTGA plcBR: GGGTAGTCCGCTTTCGCTCTT | plcB | 5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C | 289 | [31] |
iapF: ACAAGCTGCACCTGTTGCAG iapR: TGACAGCGTGTGTAGTAGCA | iap | 5 min 94 °C 35 [35 s, 94 °C; 30 s, 52 °C; 1 min, 72 °C] 10 min 72 °C | 131 | [35] |
Irrigation Water | Agricultural Soil | ||||
---|---|---|---|---|---|
Parameter | Data | Source | Parameter | Data | Source |
Concentration (C) of L. monocytogenes (CFU/100 mL) | Min: 0.00 Mean: 11.96 × 102 Max: 56.67 × 102 | This study | Concentration (C) of L. monocytogenes (CFU/g) | Min: 1.33 × 102 Mean: 19.64 × 102 Max: 62.33 × 102 | This study |
Recovery efficiency (R) (%) | 93 | This study | Recovery efficiency (R) (%) | 93 | This study |
Proportion (I) of L. monocytogenes capable of causing severe infection (%) | 100 | This study | Proportion (I) of L. monocytogenes capable of causing severe infection (%) | 100 | This study |
Amount (M) of water ingested during farming (mL/day) | 10 | [43] | Amount (M) of soil and dust ingested by adults (mg/day) | 50 | [44] |
Amount (M) of water ingested by children during farming | Not given | Amount (M) of soil and dust ingested by children (mg/day) | 100 | [44] |
Parameter | Irrigation Water | Agricultural Soil | ||||
---|---|---|---|---|---|---|
Min | Mean | Max | Min | Mean | Max | |
Ingestion dose (D) in adults | 0.00 | 11.97 × 103 | 56.67 × 103 | 6.67 × 103 | 98.21 × 103 | 311.67 × 103 |
Ingestion dose (D) in children | - | - | - | 13.33 × 103 | 196.41 × 103 | 623.33 × 103 |
Probability of infection (Pinf) in adults (daily risk) | 0.00 | 2.30 × 10−6 | 1.10 × 10−5 | 1.30 × 10−6 | 1.90 × 10−5 | 6.00 × 10−5 |
Probability of infection (Pinf) in children (daily risk) | - | - | - | 2.50 × 10−6 | 3.80 × 10−5 | 1.20 × 10−4 |
Irrigation Water | Agricultural Soil | |
---|---|---|
Parameter | Data | Data |
Exposure (E) in adults | Min: 0.00 Mean: 12.87 × 103 Max: 60.93 × 103 | Min: 7.17 × 103 Mean: 105.60 × 103 Max: 335.125 × 103 |
Exposure (E) in children | Not determined | Min: 14.34 × 103 Mean: 211.19 × 103 Max: 670.25 × 103 |
Parameter | Irrigation Water | Agricultural Soil | ||||
---|---|---|---|---|---|---|
Min | Mean | Max | Min | Mean | Max | |
Annual risk (Pinf/y) in adults | 0.00 | 5.50 × 10−2 | 48.30 × 10−2 | 9.10 × 10−3 | 54.50 × 10−2 | 1 |
Annual risk (Pinf/y) in children | - | - | - | 3.60 × 10−2 | 70.50 × 10−2 | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Iwu, C.D.; Iwu-Jaja, C.J.; Elhadi, R.; Semerjian, L.; Okoh, A.I. Modelling the Potential Risk of Infection Associated with Listeria monocytogenes in Irrigation Water and Agricultural Soil in Two District Municipalities in South Africa. Microorganisms 2022, 10, 181. https://doi.org/10.3390/microorganisms10010181
Iwu CD, Iwu-Jaja CJ, Elhadi R, Semerjian L, Okoh AI. Modelling the Potential Risk of Infection Associated with Listeria monocytogenes in Irrigation Water and Agricultural Soil in Two District Municipalities in South Africa. Microorganisms. 2022; 10(1):181. https://doi.org/10.3390/microorganisms10010181
Chicago/Turabian StyleIwu, Chidozie Declan, Chinwe Juliana Iwu-Jaja, Rami Elhadi, Lucy Semerjian, and Anthony Ifeanyin Okoh. 2022. "Modelling the Potential Risk of Infection Associated with Listeria monocytogenes in Irrigation Water and Agricultural Soil in Two District Municipalities in South Africa" Microorganisms 10, no. 1: 181. https://doi.org/10.3390/microorganisms10010181