PafS Containing GGDEF-Domain Regulates Life Activities of Pseudomonas glycinae MS82

Abstract

Cyclic dimeric guanosine monophosphate (c-di-GMP) is synthesized by diguanylate cyclase (DGC) with the GGDEF domain. As a ubiquitous bacterial second messenger, it regulates diverse life-activity phenotypes in some bacteria. Although 38 genes encoding GGDEF-domain-containing proteins have been identified in the genome of the Pseudomonas glycinae strain MS82, whether c-di-GMP functions as a facilitator or repressor of life-activity phenotypes is poorly understood. In this study, one of the 38 genes containing a GGDEF domain in MS82, PafS was investigated to explore its regulatory function in bacterial life activities. The PafS-deletion mutant ΔPafS and reversion mutant PafS-comp were constructed by the method of biparental conjugation and homologous recombination. The life activities of the mutants, such as antifungal activity, biofilm formation ability, polysaccharide content, and motor behavior, were explored. The results showed that all life-activity phenotypes were significantly reduced after knocking out PafS, whereas all were significantly restored to a similar level to that of MS82 after the complementation of PafS. These results suggested that PafS plays an important role in the regulation of a range of cellular activities by c-di-GMP in P. glycinae MS82.

1. Introduction

In the 1990s, the first diguanylate cyclase (DGC) protein gene was identified in Gluconacetobacter xylinus, which contains a conserved GGDEF domain [1]. The amino acid sequence of this domain was analyzed, but its biochemical characteristics were not described [2]. Subsequently, Pei and Grishin [3] proposed that the GGDEF domain is the core domain of DGCs. The main rationale for this suggestion is that the GGDEF domain-PleD from Caulobacter crescentus and WspR from Pseudomonas aeruginosa can synthesize two molecules of GTP to bis (3′-5′)-cyclic dimeric guanosine monophosphate (c-di-GMP) [4,5]. Subsequently, the GGDEF domain has been a focus of research on the second messenger signaling pathways of bacteria.

As an important domain of DGCs, when it receives different signals from the environment, it can adjust its own concentration or regulate the probability of the binding of the active site containing the GGDEF motif in its domain to the substrate GTP, thus further affecting the synthesis of c-di-GMP [6,7]. In addition, the RXXD motif is located at five amino acid residues upstream of the active center, which is termed the inhibition site (I site). When the synthesized c-di-GMP binds to the I site, the GGDEF domain protein produces non-competitive inhibitor feedback to inhibit the catalytic reaction of DGCs. This feedback regulation can maintain the intracellular c-di-GMP concentration in a dynamic balance [8,9].

The c-di-GMP protein binds to different types of c-di-GMP receptors, and the conjugates participate in and regulate a variety of important bacterial life activities as effector molecules. For example, fluctuation of the c-di-GMP concentration can regulate the initiation of transcription and the post-transcription level of P. aeruginosa [10], Vibrio cholera [11], P. fluorescens [12], Bacillus cereus [13], and other bacteria [14], regulate gene expression to varying degrees, the metabolism and production of cellular substances, the cell cycle, differentiation and variation, the stability of ion concentrations, the formation of biofilm, flagella-mediated movement behavior, extracellular polysaccharides (EPS), and cytotoxicity, for example.

Comprising a wide-ranging and adaptable genus of bacteria, Pseudomonas spp. are not only pathogenic to plants but also have potential biocontrol effects. Ma [15,16] randomly mutated the Pseudomonas glycinae strain MS82 using the EZ-Tn5 transposon system, and obtained a mutant strain MT19 that lost antifungal activity against the mushroom pathogen Mycogone perniciosa and Trichoderma viride, as a result of mutation of the PafR gene containing the GGDEF domain. To explore the signaling mechanism of the genes containing the GGDEF domain in P. glycinae, in this study another gene PafS containing the same GGDEF domain and some other different domains was selected, and the effects of gene PafS on the life activities were investigated through gene knockout and complementation.

2. Materials and Methods

2.1. Strains, Plasmids, and Culture Conditions

Strains and plasmids used in this study are listed in

Table 1. Bacterial strains and plasmids used in this study.

Strain or Plasmid	Relevant Characteristics	Source
	Pseudomonas glycinae [17]
MS82	Wild-type strain, 28 °C, Apr 1	This study
ΔPafS	MS82 with deletion of PafS, 28 °C, Apr	This study
PafS -comp	MS82 with reverse of PafS, 28 °C, Apr	This study
	Escherichia coli
DH5α	supE44 ΔlacU169 (Φ80 lacZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1, 37 °C	TSINGKE, Beijing, China
S17-1λ	RP4-2(Km::Tn7,Tc::Mu-1), pro-82, LAMpir, recA1, endA1, thiE1, hsdR17, creC510, 37 °C	WEIDI, Shanghai, China
	Trichoderma virens
NJ1	A pathogen isolated from mushroom culture medium	This laboratory
	Plasmids
pEX18GM	Suicide vector, SacB, Gmr 2	FENGHUI, Changsha, China
pEX18-ΔPafS	PEX18 with upstream and downstream fragments of PafS, Gmr	This study
pEX18-PafS-comp	PEX18 with PafS gene containing upstream and downstream fragments, Gmr	This study

¹ Ap^r, ampicillin resistance; ² Gm^r, gentamicin resistance.

. Bacteria were routinely cultured with liquid Lysogenic Broth (LB) medium in a test tube or on LB medium solidified with 1% agar. The concentration of ampicillin (Ap) and gentamicin (Gm) was 50 ng/mL in the different media. The strain MS82 and its mutants were grown in LB medium for determination of biofilm formation and polysaccharide content.

2.2. Deletion and Complementation of PafS

In order to understand whether the presence or absence of gene PafS will affect the life activity of the strain MS82, construction of the deletion mutant and reversion mutant used the same method of homologous recombination and parental combination as described previously [18]. The upstream and downstream fragments of PafS were amplified separately using the primer pairs ΔPafSF1/R1 and ΔPafSF2/R2 (see

Table 2. Primers used in this study.

Primer	Sequence 5′→3′	Enzyme	Annealing Temperature
ΔPafS-F1 ΔPafS-R1	CCAAGCTTGGTAAAGCGTGCGGTGTCCT 1 GGGGTACCCGATCAACCCGGACGAGACT	HindIII KpnI	55 °C
ΔPafS-F2 ΔPafS-R2	GGGGTACCATGCTGCTTCTCTTGTCGGG GCTCTAGAAAGCGTAGAGGGATTTTTTG	KpnI XbaI	55 °C
PafS-compF PafS-compR	ACGGCCAGTGCCAAGCTTGGTAAAGCGTGCGGTGTC GGTACCCGGGGATCCTCTAGACGTTGATGACTACCCTGAAAATCT	HindIII XbaI	65 °C

¹ The underlined sequence is the restriction enzyme site.

). The plasmid pEX18-ΔPafS was generated by inserting both fragments by digestion with the selected restriction enzyme and ligated with the pEX18GM vector by the T₄ DNA ligase. The plasmid was transformed into Escherichia coli strain DH5α and the transformation was confirmed by blue-white spot screening. The plasmid pEX18-ΔPafS was purified from the white clones and transformed into E. coli strain S17-1λ. The blue clones harboring pEX18-ΔPafS were conjugated with P. glycinae MS82, and the conjugation was cultured to a protoplast state for homologous recombination at 28 °C on LB plates without antibiotics for 2 days. Recombination occurred on LB medium containing Ap, Gm, and 12.5 mg/mL sucrose overnight at 28 °C to eliminate E. coli containing the suicide vector. Clones of the stable deletion mutant ΔPafS were able to grow on LB plates containing Ap but not on medium containing Ap and Gm.

For construction of the reversion mutant, several steps differed from those for construction of the deletion mutant as described below. The PafS gene containing upstream and downstream fragments was amplified using the primer pair pafS-compF/R (see Table 2). The plasmid pEX18-PafS-comp was generated by ligation of the PafS gene fragment and pEX18GM vector. The blue E. coli S17-1λ clones harboring pEX18-pafS-comp were conjugated with ΔPafS, and the stable reversion mutant PafS-comp clones were obtained.

2.3. Antifungal Activity Bioassay

The antifungal activities of MS82, ΔPafS, and PafS-comp were analyzed using the antifungal zone method [19]. Ten microliters of the prepared bacterial solution (approximately 2 × 10⁸ CFU/mL) was spotted in the center of LB solid medium. After the bacterial solution had dried, an appropriate volume of NJ1 spore suspension diluted with sterile water was sprayed with a small watering can (spore concentration is 2 × 10⁸/mL). The inverted plates were incubated in the dark at 28 °C for 2 days, then the diameter of the inhibition zone of each strain was measured. Three replicates of the plate bioassays were performed independently.

2.4. Biofilm Formation Assay

The time course of biofilm formation was determined by measuring the ability of cells to grow adherent to the wells of sterile polystyrene microtiter plates (96 flat-bottom wells) as previously described [20]. After the bacterial community is adsorbed and colonizes the surface of the object, the c-di-GMP signaling system mediates the movement of type IV flagella, producing an outermost protective biofilm to resist environmental stimuli. The absorbance of P. glycinae is strongest at a wavelength of 590 nm. Therefore, after staining the bacterial liquid with crystal violet, the OD₅₉₀ value was measured with an ultraviolet spectrophotometer to indicate the biofilm formation ability. Plates were incubated under static conditions at 28 °C for up to 48 h. To measure the degree of attachment, cultures were removed from selected wells at 12 h intervals, rinsed with distilled water, stained with 1% crystal violet, and quantified by measuring the OD₅₉₀ of the resulting solution. The experiment was performed four times with three replicates each.

2.5. Extracellular Polysaccharides (EPS) Synthesis Assay

Using a modification of a previously described method [21], the strains were incubated in LB liquid medium for 48 h, three volumes of ethanol were added, and the resulting solution was left to stand overnight at 4 °C. The precipitated EPS was collected by centrifugation, dried at 55 °C, and the dry weight was recorded as an estimate of EPS yield. The experiment was repeated three times independently.

2.6. Motility Assay

Swimming, swarming, and twitching motility assays were performed as described previously [22]. Semi-solid LB medium was adjusted to contain 0.3% (w/v) agar for the swimming medium, 0.7% (w/v) agar for the swarming medium, and 1% (w/v) agar for the twitching motility medium. Ten microliters of liquid germ of MS82, ΔPafS, and PafS-comp were inoculated in the center of swimming medium and swarming medium, then incubated at 28 °C for 12 h. Clones were seeded on the bottom of the twitching medium and incubated at 28 °C for 72 h. After incubation, the agar was removed and the bottom of the plate was stained with 0.01% crystal violet for 30 min. The final diffusion diameter was measured for each motility assay, and three replicates were performed.

3. Results

3.1. Deletion and Complementation of PafS

In the genome of the P. glycinae strain MS82 (GenBank accession no. CP028826.1), PafS was one of 38 genes that contained the GGDEF domain, and was predicted to be a putative DGC responsible for c-di-GMP synthesis. The PafS gene comprised 2124 bp and contained one each of the RESPONSE_R^~, PAS, GGDEF, and EAL domains.

To explore the potential biological functions of PafS, PafS-deletion and reversion mutants were constructed in strain MS82. The length of the upstream and downstream fragments of PafS were 353 bp and 276 bp, respectively, and a 629 bp fragment was amplified from the PafS-deletion mutant ΔPafS (Figure 1). However, because some fragments in the designed primer sequence overlapped with the target gene, the amplified band length of MS82 and PafS-comp was expected to be 2365 bp (Figure 1). The constructed mutants were verified by PCR and double-enzyme digestion, and the sequences were used as the query for a BLAST search of the NCBI databases. After multiple generations of culture, the mutant strains were genetically stable.

3.2. Antifungal Activity Bioassay

The antifungal activity of strain MS82 and its mutants against the pathogen T. virens showed variation (Figure 2). The knockout of PafS distinctly decreased the antifungal activity of ΔPafS (23.50 ± 0.87 mm). In contrast, the antifungal activity of PafS-comp did not differ significantly from that of MS82. The deletion and reversion of gene PafS resulted in the decrease and increase in the antifungal activity, indicating that PafS had a positive regulatory effect on the synthesis of antifungal substances.

3.3. Biofilm Formation Assay

The deletion of PafS severely affected biofilm formation (Figure 3). After incubation for more than 12 h, the biofilm formation ability of ΔPafS was significantly reduced compared with that of MS82 and PafS-comp. In contrast, MS82 and PafS-comp maintained similar biofilm formation abilities. The results of the biofilm formation assay showed that the gene PafS had a positive regulation effect, and the regulation effect increased with the increase in time.

3.4. Extracellular Polysaccharides Synthesis Assay

With prolonged incubation, the EPS content of the strains MS82, ΔPafS, and PafS-comp increased gradually (Figure 4). For each incubation period, the EPS content of ΔPafS was significantly lower than that of MS82 and PafS-comp. With the knockout and restoration of PafS, the EPS content changed from low (0.24 ± 0.01 g, 48 h) to high (0.39 ± 0.01 g, 48 h). Although a slight difference in EPS content was observed between MS82 and PafS-comp at each time period, the difference was not significant. Deletion of the gene PafS reduced EPS production, suggesting that PafS promotes the EPS synthesis of strain MS82.

3.5. Motility Assay

The results of the motility assay were consistent with those for antifungal activity, biofilm formation, and EPS content (Figure 5). The swimming, swarming, and twitching movement abilities of ΔPafS differed significantly from those of the wild-type MS82 and the PafS-comp mutant. Complementation of PafS in the reversion mutant PafS-comp restored all three motor performance abilities. Notably, the degree of recovery of the swarming movement was greater than that of the swimming and twitching movements, and the diffusion diameter of PafS-comp was slightly larger than that of the wild-type MS82 strain, but the differences were not significant. The regulation of gene PafS can significantly promote three kinds of motility.

4. Discussion

In a previous study, we used site-directed mutagenesis and random mutagenesis to generate mutations of PafR, which showed similar experimental results as observed in the present study [15]. We applied the method of biparental conjugation and homologous recombination to successfully knockout and complement the gene PafS, which contains the GGDEF domain, in P. glycinae strain MS82. This procedure resulted in the corresponding deletion mutant ΔPafS and reversion mutant PafS-comp, which showed significant phenotypic differences. Thus, a novel procedure for gene mutation in P. glycinae is described here.

The PafR gene, which also contains the GGDEF domain, is closely associated with the antifungal activity of P. glycinae MS82 [15]. In the present study, the antifungal activity bioassay showed that the antifungal-activity phenotype differed significantly before and after the deletion of the PafS gene containing the GGDEF domain, and that the wild-type phenotype was restored after complementation of the gene. We speculate that the deletion of PafS affects the expression of certain metabolic genes in the MS82 strain, which blocks the recognition of specific promoters by the DGC core enzymes, thereby inhibiting the secretion of antibiotic metabolites inhibitory to pathogenic fungi. These substances mainly include the antibiotics pyoverdine (Pvd), 2,4-diacetylphloroxylic (DAPG), phenazine-1-carboxylic acid (PCA), pyolueorin (PLT), and pyrrolnitrin (PRN) [23,24]. Both mutants of gene PafR and PafS showed significantly decreased antifungal activities, suggesting that their deletion would reduce the synthesis of one or more antifungal substances in P. glycinae MS82. These antifungal substances may combine their specificity. For example, the rhizosphere bacterium P. fluorescens promotes the growth and improves the autoimmunity of the host plant towards the green mold disease of citrus, and thus acts as a biocontrol agent to effectively inhibit the incidence of plant diseases.

During biofilm formation, EPS synthesis and the movement behavior of bacteria are closely associated. Motility is determined by external structures, such as flagella and pili, on the bacterium surface. Polysaccharides form the “skeleton” of the biofilm and the composition varies with the formation of the biofilm. The first adhesion stage of bacterial biofilm formation begins with the swimming movement mediated by type IV flagella [25]. Through the secretion of various glycoproteins, mucopolysaccharides, metal ions, and other components, the bacteria adhere to the surface of an object within a short period to form a multicellular aggregation embedded within a self-produced matrix, which continues to play an important role in the selective transportation of nutrients and in the catalysis of metabolic processes. At its maturity, the biofilm is regulated by the synthesis and polymerization of extracellular polysaccharide synthesis receptor proteins. For example, in P. aeruginosa PAO1, the FleQ gene affects the adhesion of the bacteria by inhibiting flagella synthesis [26]. The FleQ protein binds to the promoter regions of the Pel operon and Psl operon to transcriptionally regulate the biosynthesis of the Pel and Psl polysaccharides. In addition, FleQ regulates the synthesis of bacterial extracellular polysaccharides by affecting the activity of the corresponding glycosyltransferase [27]. These regulatory mechanisms occur in the second signaling system pathway of c-di-GMP. Therefore, as the core site of c-di-GMP synthase DGCs, the GGDEF domain directly affects bacterial adhesion [3], EPS synthesis, and type IV flagella-mediated motility. In the present study, the phenotypes of biofilm formation, EPS synthesis, and motility were reduced after the deletion of PafS, whereas the corresponding life activities were restored after complementation with PafS. These results are consistent with the above findings, which confirm that GGDEF domain-containing genes influence the function of c-di-GMP synthase DGCs, and further affect the c-di-GMP signaling pathway to regulate biofilm formation, EPS content, and motility.

Although we confirmed that the function of the GGDEF-domain-containing gene PafS in P. glycinae MS82 is consistent with previous findings, owing to the diversity of the c-di-GMP signaling pathway and the corresponding receptor proteins between and within populations, the GGDEF domain of different genomes distributed in different populations will differ in the degree and direction of regulation [28]. For example, in Pseudomonas spp., the GGDEF-domain-containing WspR gene in P. fluorescens Pf0-1 has been mutated to produce a weak positive increase in biofilm formation without affecting the corresponding swimming motion [18,29]. The same mutation in P. fluorescens F113 exhibits enhanced swimming motility [30]. In P. aeruginosa PAO1, the mutation of wspR inhibits bacterial motility [31]. The comparison of the present results for biofilm formation, EPS content, and motility with the above-mentioned findings indicates that the genes containing the GGDEF domain in Pseudomonas spp. strains perform a similar regulatory function. However, the regulatory functions of genes containing the GGDEF domain at different positions in the genome in different strains also differ. With regard to motility, the present results differed from those for P. fluorescens F113 [32], but were consistent with the experimental results reported for P. aeruginosa PAO1 [33].

The present study represents the first phase in exploring the c-di-GMP signaling mechanism in P. glycinae MS82. However, further research on the signaling pathway is required to assess the roles of the remaining GGDEF domains in MS82 to determine whether their influence on bacterial life activities is consistent, to identify homologous genes in other genomes, to detect commonalities of c-di-GMP in MS82 and other Pseudomonas strains, and to elucidate the complete c-di-GMP signaling pathway.