Using Genomics to Design a Pathovar-Specific Loop-Mediated Isothermal Amplification (LAMP) Assay, for the Improved Detection of Xanthomonas citri pv. citri
Abstract
:1. Introduction
2. Materials and Methods
2.1. Identifying Pathovar Specific Regions for X. citri pv. citri
2.2. LAMP Reaction
2.3. DNA Extraction
2.4. PCR Detection Methods
3. Results
3.1. Limit of Detection
3.2. Genomic Region
3.3. Incursion Response
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Schubert, T.S.; Rizvi, S.A.; Sun, X.; Gottwald, T.R.; Graham, J.H.; Dixon, W.N. Meeting the challenge of eradicating citrus canker in Florida—Again. Plant Dis. 2021, 85, 340–356. [Google Scholar] [CrossRef] [Green Version]
- Graham, J.H.; Gottwald, T.R.; Cubero, J.; Achor, D.S. Xanthomonas axonopodis pv. citri: Factors affecting successful eradication of citrus canker. Mol. Plant Pathol. 2004, 5, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Canteros, B.I.; Gochez, A.M.; Moschini, R.C. Management of citrus canker in Argentina, a success story. Plant Pathol. J. 2017, 33, 441. [Google Scholar] [CrossRef] [Green Version]
- Graham, J.H.; Myers, M.E.; Gottwald, T.R.; Bock, C.H. Effect of windbreaks on wind speed and canker incidence on grapefruit. Citrus Res. Technol. 2017, 37, 173–181. [Google Scholar] [CrossRef]
- IPPC. Xanthomonas citri subsp citri (Citrus canker) in Northern Territory. 2018. Available online: https://www.ippc.int/ (accessed on 24 July 2020).
- Department of Primary Industries and Regional Development. Citrus Canker. 2019. Available online: https://www.agric.wa.gov.au/citruscanker/citrus-canker (accessed on 15 December 2020).
- Gambley, C.; Miles, A.; Ramsden, M.; Doogan, V.; Thomas, J.; Parmenter, K.; Whittle, P. The distribution and spread of citrus canker in Emerald, Australia. Australas. Plant Pathol. 2009, 38, 547–557. [Google Scholar] [CrossRef]
- Northern Territory Government, Department of Industry, Tourism and Trade. Citrus Canker Has Been Eradicated from the NT. 2021. Available online: https://industry.nt.gov.au/news/2021/april/citrus-canker-has-been-eradicated-from-the-nt (accessed on 20 March 2022).
- Rigano, L.A.; Marano, M.R.; Castagnaro, A.P.; Do Amaral, A.M.; Vojnov, A.A. Rapid and sensitive detection of Citrus Bacterial Canker by loop-mediated isothermal amplification combined with simple visual evaluation methods. BMC Microbiol. 2010, 10, 176. [Google Scholar] [CrossRef] [Green Version]
- Cubero, J.; Graham, J.; Gottwald, T. Quantitative PCR method for diagnosis of citrus bacterial canker. Appl. Environ. Microbiol. 2001, 67, 2849–2852. [Google Scholar] [CrossRef] [Green Version]
- Mavrodieva, V.; Levy, L.; Gabriel, D.W. Improved sampling methods for real-time polymerase chain reaction diagnosis of citrus canker from field samples. Phytopathology 2004, 94, 61–68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rigano, L.A.; Malamud, F.; Orce, I.G.; Filippone, M.P.; Marano, M.R.; Do Amaral, A.M.; Castagnaro, A.P.; Vojnov, A.A. Rapid and sensitive detection of Candidatus Liberibacter asiaticus by loop mediated isothermal amplification combined with a lateral flow dipstick. BMC Microbiol. 2014, 14, 86. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hartung, J.; Daniel, J.-F.; Pruvost, O. Detection of Xanthomonas campestris pv. citri by the polymerase chain reaction method. Appl. Environ. Microbiol. 1993, 59, 1143–1148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cubero, J.; Graham, J. Genetic relationship among worldwide strains of Xanthomonas causing canker in citrus species and design of new primers for their identification by PCR. Appl. Environ. Microbiol. 2002, 68, 1257–1264. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Delcourt, S.; Vernière, C.; Boyer, C.; Pruvost, O.; Hostachy, B.; Robène-Soustrade, I. Revisiting the specificity of PCR primers for diagnostics of Xanthomonas citri pv. citri by experimental and in silico analyses. Plant Dis. 2013, 97, 373–378. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghosal, D.; Jeong, K.C.; Chang, Y.-W.; Gyore, J.; Teng, L.; Gardner, A.; Vogel, J.P.; Jensen, G.J. Molecular architecture, polar targeting and biogenesis of the Legionella Dot/Icm T4SS. Nat. Microbiol. 2019, 4, 1173–1182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jalali, A.; Alavi, S.M.; Sangtarash, M.H. Comparative genomic analysis of wide and narrow host range strains of Xanthomonas citri subsp. citri, showing differences in the genetic content of their pathogenicity and virulence factors. Australas. Plant Pathol. 2017, 46, 49–61. [Google Scholar] [CrossRef]
- Sgro, G.G.; Oka, G.U.; Souza, D.P.; Cenens, W.; Bayer-Santos, E.; Matsuyama, B.Y.; Bueno, N.F.; Dos Santos, T.R.; Alvarez-Martinez, C.E.; Salinas, R.K. Bacteria-killing type IV secretion systems. Front. Microbiol. 2019, 10, 1078. [Google Scholar] [CrossRef] [PubMed]
- Alegria, M.C.; Souza, D.P.; Andrade, M.O.; Docena, C.; Khater, L.; Ramos, C.H.; Da Silva, A.C.; Farah, C.S. Identification of new protein-protein interactions involving the products of the chromosome-and plasmid-encoded type IV secretion loci of the phytopathogen Xanthomonas axonopodis pv. citri. J. Bacteriol. 2005, 187, 2315–2325. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Malamud, F.; Homem, R.A.; Conforte, V.P.; Yaryura, P.M.; Castagnaro, A.P.; Marano, M.R.; Do Amaral, A.M.; Vojnov, A.A. Identification and characterization of biofilm formation-defective mutants of Xanthomonas citri subsp. citri. Microbiology 2013, 159, 1911–1919. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ko, K.S.; Hong, S.K.; Lee, H.K.; Park, M.-Y.; Kook, Y.-H. Molecular evolution of the dotA gene in Legionella pneumophila. J. Bacteriol. 2003, 185, 6269–6277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaur, A.; Bansal, K.; Kumar, S.; Sonti, R.V.; Patil, P.B. Complete genome dynamics of a dominant-lineage strain of Xanthomonas oryzae pv. oryzae harbouring a novel plasmid encoding a type IV secretion system. Access Microbiol. 2019, 1, e000063. [Google Scholar] [CrossRef] [PubMed]
- Robène, I.; Maillot-Lebon, V.; Chabirand, A.; Moreau, A.; Becker, N.; Moumène, A.; Rieux, A.; Campos, P.; Gagnevin, L.; Gaudeul, M. Development and comparative validation of genomic-driven PCR-based assays to detect Xanthomonas citri pv. citri in citrus plants. BMC Microbiol. 2020, 20, 296. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Type | Sequence (5′–3′) | Length |
---|---|---|---|
XccLAMP219-F3 | F3 | CCCACGGCTACATCTTCCT | 19 mer |
XccLAMP219-B3 | B3 | TGCACAAGGTTGAGACACAT | 20 mer |
XccLAMP219-FIP | FIP (F1c + F2) | GTTCCGCCTGCGATGACTCC-CTTGGAGATGATGGTGCGT | 39 mer |
XccLAMP219-BIP | BIP (B1c + B2) | GTTGCTGAACGAGGGGTTCGA-AGGCCAGAATCGAACCGAT | 40 mer |
XccLAMP219-LF | LF | CGAGCACCATGAGCACAGG | 19 mer |
XccLAMP219-LB | LB | CATTGCCCTTGCAAACGCT | 19 mer |
Sample Type | Number of Jpth Positives ^ | Number of Multiplex Positives | Number of LAMP Positives (This Study) |
---|---|---|---|
X. citri pv. citri | 19/19 | 21/21 | 21/21 |
X. citri pv. malvacearum | 20/20 | 0/20 | 0/20 |
X. citri pv. mangiferaeindicae | 5/5 | 0/5 | 0/5 |
Other Endemic Xanthomonads | 18/21 | 0/88 | 0/88 |
Citrus leaves (non-CBC) | 0/20 | 0/36 | 0/10 |
Cotton Leaves (uninfected) | 10/10 | 0/10 | 0/10 |
Mango Leaves (uninfected) | ND | 0/10 | 0/10 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Webster, J.; Kehoe, M.A.; Nogarotto, E.; Falconer, L.; Donovan, N.J.; Chapman, T.A. Using Genomics to Design a Pathovar-Specific Loop-Mediated Isothermal Amplification (LAMP) Assay, for the Improved Detection of Xanthomonas citri pv. citri. Microorganisms 2022, 10, 1153. https://doi.org/10.3390/microorganisms10061153
Webster J, Kehoe MA, Nogarotto E, Falconer L, Donovan NJ, Chapman TA. Using Genomics to Design a Pathovar-Specific Loop-Mediated Isothermal Amplification (LAMP) Assay, for the Improved Detection of Xanthomonas citri pv. citri. Microorganisms. 2022; 10(6):1153. https://doi.org/10.3390/microorganisms10061153
Chicago/Turabian StyleWebster, John, Monica A. Kehoe, Elisse Nogarotto, Linda Falconer, Nerida Jane Donovan, and Toni A. Chapman. 2022. "Using Genomics to Design a Pathovar-Specific Loop-Mediated Isothermal Amplification (LAMP) Assay, for the Improved Detection of Xanthomonas citri pv. citri" Microorganisms 10, no. 6: 1153. https://doi.org/10.3390/microorganisms10061153