Paraprobiotics and Postbiotics of Lactobacillus delbrueckii CIDCA 133 Mitigate 5-FU-Induced Intestinal Inflammation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Culture Conditions
2.2. Lactobacillus delbrueckii CIDCA 133 Preparation (Viable, Heat-Inactivated, and Cell-Free Supernatant)
2.3. Animals
2.4. Experimental Design
2.5. Inflammatory Cell Infiltration
2.6. Gene Expression of Cytokines and Epithelial Barrier Markers
2.6.1. Total RNA Isolation
2.6.2. Quantitative PCR (qPCR)
2.7. Histological and Morphometric Analysis
2.8. Statistical Analysis
3. Results
3.1. Heat-Killed Lactobacillus delbrueckii CIDCA 133 Improved Weight Loss in Chemotherapy-Inflamed Mice
3.2. Heat-Killed and Cell-Free Supernatant of Lactobacillus delbrueckii CIDCA 133 Reduced Levels of Myeloperoxidase Activity
3.3. Heat-Killed and Cell-Free Supernatant of Lactobacillus delbrueckii CIDCA 133 Modulated the Gene Expression of Inflammatory Cytokines
3.4. Heat-Killed and Cell-Free Supernatant of Lactobacillus delbrueckii CIDCA 133 Regulated Genes Related to Intestinal Epithelial Barrier
3.5. Heat-Killed and Cell-Free Supernatant of Lactobacillus delbrueckii CIDCA 133 Improved Epithelium Intestinal Architecture
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Maria, O.M.; Eliopoulos, N.; Muanza, T. Radiation-Induced Oral Mucositis. Front. Oncol. 2017, 7, 89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, L.; Li, W.; Chen, L.; Su, Q.; Wang, Y.; Guo, Z.; Lu, Y.; Liu, B.; Qin, S. Radiation-Induced Intestinal Damage: Latest Molecular and Clinical Developments. Futur. Oncol. 2019, 15, 4105–4118. [Google Scholar] [CrossRef] [PubMed]
- Sonis, S.T. The Pathobiology of Mucositis. Nat. Rev. Cancer 2004, 4, 277–284. [Google Scholar] [CrossRef]
- Bowen, J.; Al-Dasooqi, N.; Bossi, P.; Wardill, H.; Van Sebille, Y.; Al-Azri, A.; Bateman, E.; Correa, M.E.; Raber-Durlacher, J.; Kandwal, A.; et al. The Pathogenesis of Mucositis: Updated Perspectives and Emerging Targets. Support. Care Cancer 2019, 27, 4023–4033. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peterson, D.E.; Jones, J.B.; Petit, R.G. Randomized, Placebo-Controlled Trial of Saforis for Prevention and Treatment of Oral Mucositis in Breast Cancer Patients Receiving Anthracycline-Based Chemotherapy. Cancer 2007, 109, 322–331. [Google Scholar] [CrossRef]
- Elad, S.; Cheng, K.K.F.; Lalla, R.V.; Yarom, N.; Hong, C.; Logan, R.M.; Bowen, J.; Gibson, R.; Saunders, D.P.; Zadik, Y.; et al. MASCC/ISOO Clinical Practice Guidelines for the Management of Mucositis Secondary to Cancer Therapy. Cancer 2020, 126, 4423–4431. [Google Scholar] [CrossRef]
- Rosenthal, D.I. Consequences of Mucositis-Induced Treatment Breaks and Dose Reductions on Head and Neck Cancer Treatment Outcomes. J. Support. Oncol. 2007, 5, 23–31. [Google Scholar]
- Dahlgren, D.; Sjöblom, M.; Hellström, P.M.; Lennernäs, H. Chemotherapeutics-Induced Intestinal Mucositis: Pathophysiology and Potential Treatment Strategies. Front. Pharmacol. 2021, 12, 681417. [Google Scholar] [CrossRef]
- Van Vliet, M.J.; Harmsen, H.J.M.; de Bont, E.S.J.M.; Tissing, W.J.E. The Role of Intestinal Microbiota in the Development and Severity of Chemotherapy-Induced Mucositis. PLoS Pathog. 2010, 6, e1000879. [Google Scholar] [CrossRef] [Green Version]
- Ashaolu, T.J.; Fernández-Tomé, S. Gut Mucosal and Adipose Tissues as Health Targets of the Immunomodulatory Mechanisms of Probiotics. Trends Food Sci. Technol. 2021, 112, 764–779. [Google Scholar] [CrossRef]
- Santos Rocha, C.; Lakhdari, O.; Blottière, H.M.; Blugeon, S.; Sokol, H.; Bermu’dez-Humara’n, L.G.; Azevedo, V.; Miyoshi, A.; Doré, J.; Langella, P.; et al. Anti-Inflammatory Properties of Dairy Lactobacilli. Inflamm. Bowel Dis. 2012, 18, 657–666. [Google Scholar] [CrossRef] [PubMed]
- Petrof, E.O.; Kojima, K.; Ropeleski, M.J.; Musch, M.W.; Tao, Y.; De Simone, C.; Chang, E.B. Probiotics Inhibit Nuclear Factor-ΚB and Induce Heat Shock Proteins in Colonic Epithelial Cells through Proteasome Inhibition. Gastroenterology 2004, 127, 1474–1487. [Google Scholar] [CrossRef] [PubMed]
- Justino, P.F.C.; Franco, A.X.; Pontier-Bres, R.; Monteiro, C.E.S.; Barbosa, A.L.R.; Souza, M.H.L.P.; Czerucka, D.; Soares, P.M.G. Modulation of 5-Fluorouracil Activation of Toll-like/MyD88/NF-ΚB/MAPK Pathway by Saccharomyces boulardii CNCM I-745 Probiotic. Cytokine 2020, 125, 154791. [Google Scholar] [CrossRef] [PubMed]
- Plaza-Diaz, J.; Ruiz-Ojeda, F.J.; Gil-Campos, M.; Gil, A. Mechanisms of Action of Probiotics. Adv. Nutr. 2019, 10, S49–S66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Batista, V.L.; da Silva, T.F.; de Jesus, L.C.L.; Coelho-Rocha, N.D.; Barroso, F.A.L.; Tavares, L.M.; Azevedo, V.; Mancha-Agresti, P.; Drumond, M.M. Probiotics, Prebiotics, Synbiotics, and Paraprobiotics as a Therapeutic Alternative for Intestinal Mucositis. Front. Microbiol. 2020, 11, 544490. [Google Scholar] [CrossRef]
- Cereda, E.; Caraccia, M.; Caccialanza, R. Probiotics and Mucositis. Curr. Opin. Clin. Nutr. Metab. Care 2018, 21, 399–404. [Google Scholar] [CrossRef]
- Bian, X.; Wu, W.; Yang, L.; Lv, L.; Wang, Q.; Li, Y.; Ye, J.; Fang, D.; Wu, J.; Jiang, X.; et al. Administration of Akkermansia muciniphila Ameliorates Dextran Sulfate Sodium-Induced Ulcerative Colitis in Mice. Front. Microbiol. 2019, 10, 2259. [Google Scholar] [CrossRef] [Green Version]
- Sokol, H.; Pigneur, B.; Watterlot, L.; Lakhdari, O.; Bermúdez-Humarán, L.G.; Gratadoux, J.-J.; Blugeon, S.; Bridonneau, C.; Furet, J.-P.; Corthier, G.; et al. Faecalibacterium prausnitzii Is an Anti-Inflammatory Commensal Bacterium Identified by Gut Microbiota Analysis of Crohn Disease Patients. Proc. Natl. Acad. Sci. USA 2008, 105, 16731–16736. [Google Scholar] [CrossRef] [Green Version]
- Santos Rocha, C.; Gomes-Santos, A.C.; Garcias Moreira, T.; de Azevedo, M.; Diniz Luerce, T.; Mariadassou, M.; Longaray Delamare, A.P.; Langella, P.; Maguin, E.; Azevedo, V.; et al. Local and Systemic Immune Mechanisms Underlying the Anti-Colitis Effects of the Dairy Bacterium Lactobacillus delbrueckii. PLoS ONE 2014, 9, e85923. [Google Scholar] [CrossRef]
- Quintanilha, M.F.; Miranda, V.C.; Souza, R.O.; Gallotti, B.; Cruz, C.; Santos, E.A.; Alvarez-Leite, J.I.; Jesus, L.C.L.; Azevedo, V.; Trindade, L.M.; et al. Bifidobacterium longum Subsp. longum 51A Attenuates Intestinal Injury against Irinotecan-Induced Mucositis in Mice. Life Sci. 2022, 289, 120243. [Google Scholar] [CrossRef]
- Koyama, S.; Fujita, H.; Shimosato, T.; Kamijo, A.; Ishiyama, Y.; Yamamoto, E.; Ishii, Y.; Hattori, Y.; Hagihara, M.; Yamazaki, E.; et al. Septicemia from Lactobacillus rhamnosus GG, from a Probiotic Enriched Yogurt, in a Patient with Autologous Stem Cell Transplantation. Probiotics Antimicrob. Proteins 2019, 11, 295–298. [Google Scholar] [CrossRef] [PubMed]
- Yelin, I.; Flett, K.B.; Merakou, C.; Mehrotra, P.; Stam, J.; Snesrud, E.; Hinkle, M.; Lesho, E.; McGann, P.; McAdam, A.J.; et al. Genomic and Epidemiological Evidence of Bacterial Transmission from Probiotic Capsule to Blood in ICU Patients. Nat. Med. 2019, 25, 1728–1732. [Google Scholar] [CrossRef] [PubMed]
- Pasala, S.; Singer, L.; Arshad, T.; Roach, K. Lactobacillus Endocarditis in a Healthy Patient with Probiotic Use. IDCases 2020, 22, e00915. [Google Scholar] [CrossRef]
- D’Agostin, M.; Squillaci, D.; Lazzerini, M.; Barbi, E.; Wijers, L.; Da Lozzo, P. Invasive Infections Associated with the Use of Probiotics in Children: A Systematic Review. Children 2021, 8, 924. [Google Scholar] [CrossRef]
- Salminen, S.; Collado, M.C.; Endo, A.; Hill, C.; Lebeer, S.; Quigley, E.M.M.; Sanders, M.E.; Shamir, R.; Swann, J.R.; Szajewska, H.; et al. The International Scientific Association of Probiotics and Prebiotics (ISAPP) Consensus Statement on the Definition and Scope of Postbiotics. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 649–667. [Google Scholar] [CrossRef] [PubMed]
- Teame, T.; Wang, A.; Xie, M.; Zhang, Z.; Yang, Y.; Ding, Q.; Gao, C.; Olsen, R.E.; Ran, C.; Zhou, Z. Paraprobiotics and Postbiotics of Probiotic Lactobacilli, Their Positive Effects on the Host and Action Mechanisms: A Review. Front. Nutr. 2020, 7, 570344. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Xu, H.; Xu, J.; Guo, X.; Zhao, H.; Chen, Y.; Zhou, Y.; Nie, Y.F. prausnitzii and Its Supernatant Increase SCFAs-Producing Bacteria to Restore Gut Dysbiosis in TNBS-Induced Colitis. AMB Express 2021, 11, 33. [Google Scholar] [CrossRef]
- Jin, J.; Wu, S.; Xie, Y.; Liu, H.; Gao, X.; Zhang, H. Live and Heat-Killed Cells of Lactobacillus plantarum Zhang-LL Ease Symptoms of Chronic Ulcerative Colitis Induced by Dextran Sulfate Sodium in Rats. J. Funct. Foods 2020, 71, 103994. [Google Scholar] [CrossRef]
- De Jesus, L.C.L.; Drumond, M.M.; de Carvalho, A.; Santos, S.S.; Martins, F.S.; Ferreira, Ê.; Fernandes, R.S.; de Barros, A.L.B.; do Carmo, F.L.R.; Perez, P.F.; et al. Protective Effect of Lactobacillus delbrueckii Subsp. lactis CIDCA 133 in a Model of 5 Fluorouracil-Induced Intestinal Mucositis. J. Funct. Foods 2019, 53, 197–207. [Google Scholar] [CrossRef]
- Barroso, F.A.L.; de Jesus, L.C.L.; da Silva, T.F.; Batista, V.L.; Laguna, J.; Coelho-Rocha, N.D.; Vital, K.D.; Fernandes, S.O.A.; Cardoso, V.N.; Ferreira, E.; et al. Lactobacillus delbrueckii CIDCA 133 Ameliorates Chemotherapy-Induced Mucositis by Modulating Epithelial Barrier and TLR2/4/Myd88/NF-ΚB Signaling Pathway. Front. Microbiol. 2022, 13, 858036. [Google Scholar] [CrossRef]
- De Jesus, L.C.L.; Drumond, M.M.; Aburjaile, F.F.; de Jesus Sousa, T.; Coelho-Rocha, N.D.; Profeta, R.; Brenig, B.; Mancha-Agresti, P.; Azevedo, V. Probiogenomics of Lactobacillus delbrueckii Subsp. lactis CIDCA 133: In Silico, In Vitro, and In Vivo Approaches. Microorganisms 2021, 9, 829. [Google Scholar] [CrossRef] [PubMed]
- De Jesus, L.C.L.; de Jesus Sousa, T.; Coelho-Rocha, N.D.; Profeta, R.; Barroso, F.A.L.; Drumond, M.M.; Mancha-Agresti, P.; Ferreira, Ê.; Brenig, B.; Aburjaile, F.F.; et al. Safety Evaluation of Lactobacillus delbrueckii Subsp. lactis CIDCA 133: A Health-Promoting Bacteria. Probiotics Antimicrob. Proteins 2021, in press. [Google Scholar] [CrossRef] [PubMed]
- Prisciandaro, L.D.; Geier, M.S.; Butler, R.N.; Cummins, A.G.; Howarth, G.S. Probiotic Factors Partially Improve Parameters of 5-Fluorouracil-Induced Intestinal Mucositis in Rats. Cancer Biol. Ther. 2011, 11, 671–677. [Google Scholar] [CrossRef] [Green Version]
- Souza, D.G.; Cara, D.C.; Cassali, G.D.; Coutinho, S.F.; Silveira, M.R.; Andrade, S.P.; Poole, S.P.; Teixeira, M.M. Effects of the PAF Receptor Antagonist UK74505 on Local and Remote Reperfusion Injuries Following Ischaemia of the Superior Mesenteric Artery in the Rat. Br. J. Pharmacol. 2000, 131, 1800–1808. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strath, M.; Warren, D.J.; Sanderson, C.J. Detection of Eosinophils Using an Eosinophil Peroxidase Assay. Its Use as an Assay for Eosinophil Differentiation Factors. J. Immunol. Methods 1985, 83, 209–215. [Google Scholar] [CrossRef]
- Giulietti, A.; Overbergh, L.; Valckx, D.; Decallonne, B.; Bouillon, R.; Mathieu, C. An Overview of Real-Time Quantitative PCR: Applications to Quantify Cytokine Gene Expression. Methods 2001, 25, 386–401. [Google Scholar] [CrossRef] [Green Version]
- Song, M.-K.; Park, M.-Y.; Sung, M.-K. 5-Fluorouracil-Induced Changes of Intestinal Integrity Biomarkers in BALB/C Mice. J. Cancer Prev. 2013, 18, 322–329. [Google Scholar] [CrossRef] [Green Version]
- Volynets, V.; Rings, A.; Bárdos, G.; Ostaff, M.J.; Wehkamp, J.; Bischoff, S.C. Intestinal Barrier Analysis by Assessment of Mucins, Tight Junctions, and α-Defensins in Healthy C57BL/6J and BALB/CJ Mice. Tissue Barriers 2016, 4, e1208468. [Google Scholar] [CrossRef] [Green Version]
- Chang, C.-W.; Lee, H.-C.; Li, L.-H.; Chiang Chiau, J.-S.; Wang, T.-E.; Chuang, W.-H.; Chen, M.-J.; Wang, H.-Y.; Shih, S.-C.; Liu, C.-Y.; et al. Fecal Microbiota Transplantation Prevents Intestinal Injury, Upregulation of Toll-Like Receptors, and 5-Fluorouracil/Oxaliplatin-Induced Toxicity in Colorectal Cancer. Int. J. Mol. Sci. 2020, 21, 386. [Google Scholar] [CrossRef] [Green Version]
- Zheng, L.; Zhang, Y.-L.; Dai, Y.-C.; Chen, X.; Chen, D.-L.; Dai, Y.-T.; Tang, Z.-P. Jianpi Qingchang Decoction Alleviates Ulcerative Colitis by Inhibiting Nuclear Factor-ΚB Activation. World J. Gastroenterol. 2017, 23, 1180. [Google Scholar] [CrossRef]
- Soares, P.M.G.; Mota, J.M.S.C.; Gomes, A.S.; Oliveira, R.B.; Assreuy, A.M.S.; Brito, G.A.C.; Santos, A.A.; Ribeiro, R.A.; Souza, M.H.L.P. Gastrointestinal Dysmotility in 5-Fluorouracil-Induced Intestinal Mucositis Outlasts Inflammatory Process Resolution. Cancer Chemother. Pharmacol. 2008, 63, 91–98. [Google Scholar] [CrossRef] [PubMed]
- Gan, Y.; Ai, G.; Wu, J.; Luo, H.; Chen, L.; Huang, Q.; Wu, X.; Xu, N.; Li, M.; Su, Z.; et al. Patchouli Oil Ameliorates 5-Fluorouracil-Induced Intestinal Mucositis in Rats via Protecting Intestinal Barrier and Regulating Water Transport. J. Ethnopharmacol. 2020, 250, 112519. [Google Scholar] [CrossRef] [PubMed]
- Trindade, L.M.; Torres, L.; Matos, I.D.; Miranda, V.C.; de Jesus, L.C.L.; Cavalcante, G.; de Souza Oliveira, J.J.; Cassali, G.D.; Mancha-Agresti, P.; de Carvalho Azevedo, V.A.; et al. Paraprobiotic Lacticaseibacillus rhamnosus Protects Intestinal Damage in an Experimental Murine Model of Mucositis. Probiotics Antimicrob. Proteins 2021, in press. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.-T.; Ho, T.-Y.; Lin, H.; Liang, J.-A.; Huang, H.-C.; Li, C.-C.; Lo, H.-Y.; Wu, S.-L.; Huang, Y.-F.; Hsiang, C.-Y. 5-Fluorouracil Induced Intestinal Mucositis via Nuclear Factor-ΚB Activation by Transcriptomic Analysis and In Vivo Bioluminescence Imaging. PLoS ONE 2012, 7, e31808. [Google Scholar] [CrossRef] [Green Version]
- Li, H.-L.; Lu, L.; Wang, X.-S.; Qin, L.-Y.; Wang, P.; Qiu, S.-P.; Wu, H.; Huang, F.; Zhang, B.-B.; Shi, H.-L.; et al. Alteration of Gut Microbiota and Inflammatory Cytokine/Chemokine Profiles in 5-Fluorouracil Induced Intestinal Mucositis. Front. Cell. Infect. Microbiol. 2017, 7, 455. [Google Scholar] [CrossRef]
- Sang, L.-X.; Chang, B.; Dai, C.; Gao, N.; Liu, W.-X.; Jiang, M. Heat-Killed VSL#3 Ameliorates Dextran Sulfate Sodium (DSS)-Induced Acute Experimental Colitis in Rats. Int. J. Mol. Sci. 2013, 15, 15–28. [Google Scholar] [CrossRef]
- Oh, N.S.; Lee, J.Y.; Lee, J.M.; Lee, K.W.; Kim, Y. Mulberry Leaf Extract Fermented with Lactobacillus acidophilus A4 Ameliorates 5-Fluorouracil-Induced Intestinal Mucositis in Rats. Lett. Appl. Microbiol. 2017, 64, 459–468. [Google Scholar] [CrossRef]
- Li, M.O.; Wan, Y.Y.; Sanjabi, S.; Robertson, A.-K.L.; Flavell, R.A. Transforming Growth Factor-β Regulation of Immune Responses. Annu. Rev. Immunol. 2006, 24, 99–146. [Google Scholar] [CrossRef]
- Konkel, J.E.; Chen, W. Balancing Acts: The Role of TGF-β in the Mucosal Immune System. Trends Mol. Med. 2011, 17, 668–676. [Google Scholar] [CrossRef] [Green Version]
- Al-Khrashi, L.A.; Badr, A.M.; AL-Amin, M.A.; Mahran, Y.F. Thymol Ameliorates 5-fluorouracil-induced Intestinal Mucositis: Evidence of Down-regulatory Effect on TGF-β/MAPK Pathways through NF-κB. J. Biochem. Mol. Toxicol. 2022, 36, e22932. [Google Scholar] [CrossRef]
- Kim, H.J.; Kim, J.H.; Moon, W.; Park, J.; Park, S.J.; Song, G.A.; Han, S.H.; Lee, J.H. Rebamipide Attenuates 5-Fluorouracil-Induced Small Intestinal Mucositis in a Mouse Model. Biol. Pharm. Bull. 2015, 38, 179–183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barbosa, M.M.; de Araújo, A.A.; de Araújo Júnior, R.F.; Guerra, G.C.B.; de Castro Brito, G.A.; Leitão, R.C.; Ribeiro, S.B.; de Aragão Tavares, E.; Vasconcelos, R.C.; Garcia, V.B.; et al. Telmisartan Modulates the Oral Mucositis Induced by 5-Fluorouracil in Hamsters. Front. Physiol. 2018, 9, 1204. [Google Scholar] [CrossRef] [PubMed]
- Barroso, F.A.L.; de Jesus, L.C.L.; de Castro, C.P.; Batista, V.L.; Ferreira, Ê.; Fernandes, R.S.; de Barros, A.L.B.; Leclerq, S.Y.; Azevedo, V.; Mancha-Agresti, P.; et al. Intake of Lactobacillus delbrueckii (PExu:Hsp65) Prevents the Inflammation and the Disorganization of the Intestinal Mucosa in a Mouse Model of Mucositis. Microorganisms 2021, 9, 107. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Gan, Y.; Li, M.; Chen, L.; Liang, J.; Zhuo, J.; Luo, H.; Xu, N.; Wu, X.; Wu, Q.; et al. Patchouli Alcohol Attenuates 5-Fluorouracil-Induced Intestinal Mucositis via TLR2/MyD88/NF-KB Pathway and Regulation of Microbiota. Biomed. Pharmacother. 2020, 124, 109883. [Google Scholar] [CrossRef]
- Zhang, L.; Jin, Y.; Peng, J.; Chen, W.; Lisha, L.; Lin, J. Qingjie Fuzheng Granule Attenuates 5-Fluorouracil-Induced Intestinal Mucosal Damage. Biomed. Pharmacother. 2019, 118, 109223. [Google Scholar] [CrossRef]
- Gomes-Santos, A.C.; de Oliveira, R.P.; Moreira, T.G.; Castro-Junior, A.B.; Horta, B.C.; Lemos, L.; de Almeida, L.A.; Rezende, R.M.; Cara, D.C.; Oliveira, S.C.; et al. Hsp65-Producing Lactococcus lactis Prevents Inflammatory Intestinal Disease in Mice by IL-10- and TLR2-Dependent Pathways. Front. Immunol. 2017, 8, 30. [Google Scholar] [CrossRef] [Green Version]
- Rosenberg, H.F.; Masterson, J.C.; Furuta, G.T. Eosinophils, Probiotics, and the Microbiome. J. Leukoc. Biol. 2016, 100, 881–888. [Google Scholar] [CrossRef]
- Theiler, A.; Bärnthaler, T.; Platzer, W.; Richtig, G.; Peinhaupt, M.; Rittchen, S.; Kargl, J.; Ulven, T.; Marsh, L.M.; Marsche, G.; et al. Butyrate Ameliorates Allergic Airway Inflammation by Limiting Eosinophil Trafficking and Survival. J. Allergy Clin. Immunol. 2019, 144, 764–776. [Google Scholar] [CrossRef] [Green Version]
- Wachi, S.; Kanmani, P.; Tomosada, Y.; Kobayashi, H.; Yuri, T.; Egusa, S.; Shimazu, T.; Suda, Y.; Aso, H.; Sugawara, M.; et al. Lactobacillus delbrueckii TUA4408L and Its Extracellular Polysaccharides Attenuate Enterotoxigenic Escherichia coli- Induced Inflammatory Response in Porcine Intestinal Epitheliocytes via Toll-like Receptor-2 and 4. Mol. Nutr. Food Res. 2014, 58, 2080–2093. [Google Scholar] [CrossRef]
- Chandhni, P.R.; Pradhan, D.; Sowmya, K.; Gupta, S.; Kadyan, S.; Choudhary, R.; Gupta, A.; Gulati, G.; Mallappa, R.H.; Kaushik, J.K.; et al. Ameliorative Effect of Surface Proteins of Probiotic Lactobacilli in Colitis Mouse Models. Front. Microbiol. 2021, 12, 679773. [Google Scholar] [CrossRef]
- Deutsch, S.-M.; Mariadassou, M.; Nicolas, P.; Parayre, S.; Le Guellec, R.; Chuat, V.; Peton, V.; Le Maréchal, C.; Burati, J.; Loux, V.; et al. Identification of Proteins Involved in the Anti-Inflammatory Properties of Propionibacterium freudenreichii by Means of a Multi-Strain Study. Sci. Rep. 2017, 7, 46409. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Tomé, S.; Marin, A.C.; Ortega Moreno, L.; Baldan-Martin, M.; Mora-Gutiérrez, I.; Lanas-Gimeno, A.; Moreno-Monteagudo, J.A.; Santander, C.; Sánchez, B.; Chaparro, M.; et al. Immunomodulatory Effect of Gut Microbiota-Derived Bioactive Peptides on Human Immune System from Healthy Controls and Patients with Inflammatory Bowel Disease. Nutrients 2019, 11, 2605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zihni, C.; Mills, C.; Matter, K.; Balda, M.S. Tight Junctions: From Simple Barriers to Multifunctional Molecular Gates. Nat. Rev. Mol. Cell Biol. 2016, 17, 564–580. [Google Scholar] [CrossRef] [PubMed]
- Chelakkot, C.; Ghim, J.; Ryu, S.H. Mechanisms Regulating Intestinal Barrier Integrity and Its Pathological Implications. Exp. Mol. Med. 2018, 50, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Alvarez, C.-S.; Giménez, R.; Cañas, M.-A.; Vera, R.; Díaz-Garrido, N.; Badia, J.; Baldomà, L. Extracellular Vesicles and Soluble Factors Secreted by Escherichia coli Nissle 1917 and ECOR63 Protect against Enteropathogenic E. coli-Induced Intestinal Epithelial Barrier Dysfunction. BMC Microbiol. 2019, 19, 166. [Google Scholar] [CrossRef] [Green Version]
- Guan, J.; Liu, F.; Zhao, S.; Evivie, S.E.; Shi, J.; Li, N.; Zhao, L.; Yue, Y.; Xie, Q.; Huo, G.; et al. Effect of Bifidobacterium longum Subsp. longum on the Proliferative and Tight-Junction Activities of Human Fetal Colon Epithelial Cells. J. Funct. Foods 2021, 86, 104715. [Google Scholar] [CrossRef]
- Tsukita, S.; Furuse, M. Occludin and Claudins in Tight-Junction Strands: Leading or Supporting Players? Trends Cell Biol. 1999, 9, 268–273. [Google Scholar] [CrossRef]
- Findley, M.K.; Koval, M. Regulation and Roles for Claudin-Family Tight Junction Proteins. IUBMB Life 2009, 61, 431–437. [Google Scholar] [CrossRef] [Green Version]
- Yue, X.; Wen, S.; Long-kun, D.; Man, Y.; Chang, S.; Min, Z.; Shuang-yu, L.; Xin, Q.; Jie, M.; Liang, W. Three Important Short-Chain Fatty Acids (SCFAs) Attenuate the Inflammatory Response Induced by 5-FU and Maintain the Integrity of Intestinal Mucosal Tight Junction. BMC Immunol. 2022, 23, 19. [Google Scholar] [CrossRef]
- Carvalho, P.L.A.; Andrade, M.E.R.; Trindade, L.M.; Leocádio, P.C.L.; Alvarez-Leite, J.I.; dos Reis, D.C.; Cassali, G.D.; de Sales Souza e Melo, É.L.; dos Santos Martins, F.; Fernandes, S.O.A.; et al. Prophylactic and Therapeutic Supplementation Using Fructo-Oligosaccharide Improves the Intestinal Homeostasis after Mucositis Induced by 5- Fluorouracil. Biomed. Pharmacother. 2021, 133, 111012. [Google Scholar] [CrossRef]
- Dahan, S.; Rabinowitz, K.M.; Martin, A.P.; Berin, M.C.; Unkeless, J.C.; Mayer, L. Notch-1 Signaling Regulates Intestinal Epithelial Barrier Function, Through Interaction With CD4+ T Cells, in Mice and Humans. Gastroenterology 2011, 140, 550–559. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primer Forward | Primer Reverse | Reference |
---|---|---|---|
Gapdh | TCACCACCATGGAGAAGGC | GCTAAGCAGTTGGTGGTGCA | [36] |
Actb | GCTGAGAGGGAAATCGTGCGTG | CCAGGGAGGAAGAGGATGCGG | [38] |
Tlr2 | ACAATAGAGGGAGACGCCTTT | AGTGTCTGGTAAGGATTTCCCAT | [39] |
Nfkb1 | GTGGAGGCATGTTCGGTAGTG | TCTTGGCACAATCTTTAGGGC | [40] |
Il12p40 | GGAAGCACGGCAGCAGAATA | AACTTGAGGGAGAAGTAGGAATGG | [36] |
Il17a | GCTCCAGAAGGCCCTCAGA | AGCTTTCCCTCCGCATTGA | [36] |
Tgfb1 | TGACGTCACTGGAGTTGTACGG | GGTTCATGTCATGGATGGTGC | [36] |
Il10 | GGTTGCCAAGCCTTATCGGA | ACCTGCTCCACTGCCTTGCT | [36] |
Tnf | ACGTGGAACTGGCAGAAGAG | CTCCTCCACTTGGTGGTTTG | [37] |
Il1b | CTCCATGAGCTTTGTACAAGG | TGCTGATGTACCAGTTGGGG | [37] |
Muc2 | GATGGCACCTACCTCGTTT | GTCCTGGCACTTGTTGGAAT | [38] |
Cldn1 | TCCTTGCTGAATCTGAACA | AGCCATCCACATCTTCTG | [38] |
Cldn2 | GTCATCGCCCATCAGAAGAT | ACTGTTGGACAGGGAACCAG | [38] |
Cldn5 | GCTCTCAGAGTCCGTTGACC | CTGCCCTTTCAGGTTAGCAG | [38] |
Ocln | ACTCCTCCAATGGACAAGTG | CCCCACCTGTCGTGTAGTCT | [38] |
Hp | CCACCTCTGTCCAGCTCTTC | CACCGGAGTGATGGTTTTCT | [38] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Batista, V.L.; De Jesus, L.C.L.; Tavares, L.M.; Barroso, F.L.A.; Fernandes, L.J.d.S.; Freitas, A.d.S.; Americo, M.F.; Drumond, M.M.; Mancha-Agresti, P.; Ferreira, E.; et al. Paraprobiotics and Postbiotics of Lactobacillus delbrueckii CIDCA 133 Mitigate 5-FU-Induced Intestinal Inflammation. Microorganisms 2022, 10, 1418. https://doi.org/10.3390/microorganisms10071418
Batista VL, De Jesus LCL, Tavares LM, Barroso FLA, Fernandes LJdS, Freitas AdS, Americo MF, Drumond MM, Mancha-Agresti P, Ferreira E, et al. Paraprobiotics and Postbiotics of Lactobacillus delbrueckii CIDCA 133 Mitigate 5-FU-Induced Intestinal Inflammation. Microorganisms. 2022; 10(7):1418. https://doi.org/10.3390/microorganisms10071418
Chicago/Turabian StyleBatista, Viviane Lima, Luís Cláudio Lima De Jesus, Laísa Macedo Tavares, Fernanda Lima Alvarenga Barroso, Lucas Jorge da Silva Fernandes, Andria dos Santos Freitas, Monique Ferrary Americo, Mariana Martins Drumond, Pamela Mancha-Agresti, Enio Ferreira, and et al. 2022. "Paraprobiotics and Postbiotics of Lactobacillus delbrueckii CIDCA 133 Mitigate 5-FU-Induced Intestinal Inflammation" Microorganisms 10, no. 7: 1418. https://doi.org/10.3390/microorganisms10071418