Next Article in Journal
Lactiplantibacillus plantarum from Unexplored Tunisian Ecological Niches: Antimicrobial Potential, Probiotic and Food Applications
Previous Article in Journal
Plant-Associated Representatives of the Bacillus cereus Group Are a Rich Source of Antimicrobial Compounds
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 11
Issue 11
10.3390/microorganisms11112678
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Regulatory Functions of the Multiple Alternative Sigma Factors RpoE, RpoHI, and RpoHII Depend on the Growth Phase in Rhodobacter sphaeroides

by
Jing Zhang
,
Meijia Zheng
,
Zizhong Tang
,
Shanpu Zhong
,
Tongliang Bu
and
Qingfeng Li
*
College of Life Sciences, Sichuan Agricultural University, Ya’an 625014, China
*
Author to whom correspondence should be addressed.
Microorganisms 2023, 11(11), 2678; https://doi.org/10.3390/microorganisms11112678
Submission received: 10 October 2023 / Revised: 26 October 2023 / Accepted: 27 October 2023 / Published: 31 October 2023
(This article belongs to the Section Medical Microbiology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Bacterial growth, under laboratory conditions or in a natural environment, goes through different growth phases. Some gene expressions are regulated with respect to the growth phase, which allows bacteria to adapt to changing conditions. Among them, many gene transcriptions are controlled by RpoHI or RpoHII in Rhodobacter sphaeroides. In a previous study, it was proven that the alternative sigma factors, RpoE, RpoHI, and RpoHII, are the major regulators of oxidative stress. Moreover, the growth of bacteria reached a stationary phase, and following the outgrowth, rpoE, rpoHI, and rpoHII mRNAs increased with respect to the growth phase. In this study, we demonstrated the regulatory function of alternative sigma factors in the rsp_0557 gene. The gene rsp_0557 is expressed with respect to the growth phase and belongs to the RpoHI/RpoHII regulons. Reporter assays showed that the antisigma factor ChrR turns on or over the RpoE activity to regulate rsp_0557 expression across the growth phase. In the exponential phase, RpoHII and sRNA Pos19 regulate the expression of rsp_0557 to an appropriate level under RpoE control. In the stationary phase, RpoHI and Pos19 stabilize the transcription of rsp_0557 at a high level. During outgrowth, RpoHI negatively regulates the transcription of rsp_0557. Taken together, our data indicate that these regulators are recruited by cells to adapt to or survive under different conditions throughout the growth phase. However, they still did not display all of the regulators involved in growth phase-dependent regulation. More research is still needed to learn more about the interaction between the regulators and the process of adapting to changed growth conditions and environments.

1. Introduction

Throughout different growth phases, bacteria are always exposed to varying environments that influence survival, biosynthesis, and metabolism, which are recognized as general stresses, including osmotic stress, extreme pH, oxidative stress, and nutrient deficiency. Several decades ago, some molecular mechanisms that enable bacteria to adapt or survive in similar stress situations were identified. The function of sigma factors in growth phase-dependent gene regulation has been elucidated, but the mechanisms are not clear. Nevertheless, other players in growth phase-dependent gene regulation have not been identified, such as small noncoding RNAs, small proteins, or dwarf signal molecules.
To date, some regulatory factors that regulate gene expression in a growth phase-dependent manner have been identified in Gammaproteobacteria. For example, the process of entering the stationary phase is orderly; in this process, diverse regulators are involved at different levels, extending transcriptional, translational, and post-translational controls in Enteric bacilli. The main regulator of this process is the sigma factor. In many Gram-negative bacteria, the sigma factor RpoS regulates observable physiological changes and plays a major role in resistance to diverse stresses [1]. During the stationary phase, increased rpoS transcription contributes to enhancing rpoS transcription, improving the efficiency of translation, and increasing protein stability [2]. Some regulatory factors affect rpoS transcription in this process, such as the membrane sensor kinase BarA [2], weak acids such as benzoate or propionate [3], phosphorylated ArcA [4], etc. The RNA chaperon Hfq and sRNAs (OxyS, RprA, and DsrA) participate in the regulation of RpoS translation [5,6,7]. Moreover, it was revealed that nucleoid-associated proteins like Lrp, IHF, and Fis regulate gene expressions in the stationary phase of intestinal bacteria [1,8,9]. In Escherichia coli, many genes induced in the stationary phase are regulated by Lrp, which in turn is regulated by ppGpp [10,11]. The involvement of sigma factors in growth-dependent gene expression was also reported for the Gram-positive Bacillus subtilis. Genes belonging to the SigW regulon are highly upregulated at the initiation of the late stationary phase [12]. Another global regulator in the stationary phase of B. subtilis and other Gram-positive bacteria is CodY. CodY represses more than one hundred genes during exponential growth. The activation of its repressor function is under the control of branched-chain amino acids and GTP [13], whereas the inactivation of the CodY repressor is mediated by (p)ppGpp [14].
Rhodobacter sphaeroides is a facultative phototrophic Alphaproteobacterium, which does not have a sigma factor with a function similar to that of RpoS in E. coli [15]. There are three alternative sigma factors in R. sphaeroides: RpoE, RpoHI, and RpoHII,. RpoHI and RpoHII are the main factors responsible for resistance to oxidative and heat stress responses and are involved in growth phase-dependent gene regulation [16]. The RpoHI and RpoHII regulons have considerable overlap; both of them and RpoE are considered to be global regulators in the oxidative stress response of R. sphaeroides, and RpoHII transcription is controlled by another sigma factor, RpoE [17,18,19]. The antisigma factor, ChrR, sequesters RpoE under normal conditions [20]. However, RpoE is activated after the degradation of ChrR under the action of the proteases DegS and RseP under oxidative stress. The process of degradation in response to singlet oxygen is promoted by the unknown functional proteins RSP_1090 and RSP_1091 [21]. RpoE, RpoHI, and RpoHII also regulate the expression of small noncoding RNAs, which play a role in the resistance to different stresses in R. sphaeroides [21,22,23,24,25]; e.g., noncoding small RNA Pos19 transcription is controlled by RpoE and increases under oxidative stress [26]. Moreover, the sRNA StsR is induced by iron starvation under the control of RpoHI/RpoHII [24,25]. In R. sphaeroides, the genes encoding the PhyR-NepR-σEcfG with a function in the general stress response also show different expressions across growth phases [27,28]. Recently, it was found that RNase E can affect bacterial adaptation to different growth conditions [29].
R. sphaeroides is a well-studied model organism for biological processes. In order to study more about the regulatory functions of RpoE, RpoHI, and RpoHII in gene expression depending on the growth phase in R. sphaeroides, we constructed a reporter plasmid that contained a promoter recognized by RpoHI/RpoHII, and measured the promoter activity across growth phases in various R. sphaeroides strains to understand the interplay between sigma factors and sRNA in different growth phases.

2. Materials and Methods

2.1. Plasmids, Strains, Media, and Culture Conditions

Rhodobacter sphaeroides 2.4.1 was the parental strain used to construct the mutant strains in this study. All strains are listed in Table 1. R. sphaeroides strains were cultivated in the dark at 32 °C on malate minimal-salt (RÄ) medium solid media containing 1.6% (w/v) agar or in liquid media [30]. For semi-aerobic growth conditions, the liquid medium was filled to 80% of the maximum volume of the Erlenmeyer flasks and shaken at 140 rpm. If necessary, gentamicin (10 μg mL–1), tetracycline (1.5 μg mL–1), kanamycin (25 μg mL–1), trimethoprim (200 μg mL–1), or spectinomycin (10 μg mL–1) was added to the media. E. coli strains were cultivated in Lysogeny Broth-Lennox (LB) media or on solid growth media containing 1.6% (w/v) agar, and cells were continuously shaken at 180 rpm at 37 °C. When necessary, ampicillin (200 μg mL–1), tetracycline (20 μg mL–1), or gentamicin (10 μg mL–1) was added to the growth media.

2.2. Expression and Purification of His6-Tagged RpoHI or RpoHII Protein

To produce 6 × His-tagged RpoHI or RpoHII protein, the region encoding rpoHI or rpoHII was amplified using the genomic DNA of R. sphaeroides 2.4.1 as a template. Primers used in PCR were (see Table 2) designed with NdeI and NotI restriction sites to amplify rpoHI (primers are RpoHI-E-f/r) or rpoHII (primers are RpoHII-E-f/r). The CloneJET PCR cloning kit (Thermo) was used to sub-clone PCR amplification products with vector pJET1.2. After digestion with NdeI and NotI, the rpoHI or rpoHII fragments were cloned into the expression vector pET30b to generate the RpoHI protein expression vector or RpoHII protein expression vector.
The resulting plasmid of the protein expression vector was transferred into E. coli BL21 (DE3) cells for RpoHI-His6 or RpoHII-His6 (N-terminal His6-tagged recombinant protein) expression. Recombinants were cultivated in LB medium at 37 °C with a final concentration of kanamycin (25 μg mL−1) until the optical density achieved 0.8–0.9 at 600 nm. Next, a final concentration of 1 mM IPTG was used to induce protein expressions, and the cells were harvested after 3 h (RpoHI protein) or 20 h (RpoHII protein) grown at 28 °C. Culture cell pellets were collected and resuspended in PBS buffer at 4 °C. Then, sonication was performed with an ultrasonic crusher on ice for 3 s with a 5 s interval break until the bacterial solution was clear. Cell debris and supernatant were separated using centrifugation at 8000 rpm at 4 °C for 10 min to obtain the recombinant protein. The recombinant protein samples were analyzed using a 12% SDS–polyacrylamide gel.
For the purification of RpoHI or RpoHII protein, the broken cell debris was purified using a His-Tagged Protein Purification Kit (Inclusion Body Protein, ComWin). The 12% SDS-PAGE was used to analyze the purified 6 × His-tagged proteins.

2.3. Electrophoresis Mobility Shift Assay

The primer set 0557-EMSA-F/R (Table 2) labeled with FAM was used to amplify the promoter fragment of rsp_0557 from the genome of R. sphaeroides 2.4.1 via PCR. The 0557-M12-F/R primers and 0557-M35-F/R primers were used to amplify the rsp_0557 promoter sequence after the mutation in the −12 and −35 regions. The fragment of rsp_0557 promoter (273 bp) was incubated using purified RpoHI protein or RpoHII protein in the reaction buffer (0.75 M NaCl, 0.5 mM DTT, 50 mM Tris, 0.5 mM EDTA, pH 7.4) at 25 °C for 30 min. The reaction solution was then checked using 8% native PAGE in 0.5 × TBE electrophoresis buffer. A 282 bp fragment including the rsp_0960 promoter was used as a negative control.

2.4. Construction of Reporter Plasmid

The fragment of the rsp_0557 promoter was transcriptionally fused to the reporter gene lacZ. The primer set RSP_0557-f/r (Table 2) was used to amplify the promoter fragment of rsp_0557 from the genome of R. sphaeroides 2.4.1 via PCR. The target fragment was sub-cloned using the vector pJET1.2 (Thermo), digested with the restriction enzymes HindIII and EcoRI, and ligated into EcoRI/HindIII-digested pBBRIMCS5-lacZ to generate the rsp_0557 reporter plasmid vector pBBRI-0557-lacZ with the lacZ reporter gene (Table 1). The reporter plasmid was transferred into various strains, including R. sphaeroides wild type, ΔRpoHI (rpoHI deletion mutant), ΔRpoHII (rpoHII deletion mutant), ΔRpoHI/RpoHII (rpoHI and rpoHII double deletion mutant), ΔChrR (chrR deletion mutant), or TF18 (rpoE-chrR deletion mutant) by diparental conjugation.

2.5. Construction of pos19 Deletion Strain

Splicing by overlap extension (SOE) PCR was used to construct the pos19 deletion strain (ΔPos19, Table 1) using the suicide vector pK18mobsacB::pos19. Primer pairs 0019-XbaI-up/0019-up or 0019-down/0019-BamHI-down were used to amplify an upstream or downstream fragment of pos19 (Table 2) using the genomic DNA of R. sphaeroides 2.4.1 as a template. The upstream and downstream fragments were spliced by SOE PCR, which resulted in a 472 bp fragment. Following the XbaI/BamHI digestion, the fragment was ligated into the pK18mobsacB to generate pK18mobsacB::pos19.
For the construction of ΔPos19, the pK18mobsacB::pos19 was conjugated to R. sphaeroides 2.4.1. After a single homologous recombination event, the kanamycin-resistant clones were screened using RÄ media with kanamycin and then cultivated in media without any antibiotics for about 60 h. Subsequently, the culture was spread on malate minimal salt plates at a concentration of 10% (w/w) sucrose to select for the deletion strain. Finally, potential mutants were checked via PCR using 0019-up-XbaI/0019-down-BamHI primers.

2.6. Overexpression Plasmid Construction

In order to construct the overexpression vector of pos19 (pRKPos19, Table 1), the primers pPos19-F/R were used to amplify by PCR to obtain a 339 bp fragment without a native promoter (Table 2). The target fragment was sub-cloned by the vector pJET1.2 Blunt. The target fragment was ligated into the vector pRK16S after the degradation of BamHI and EcoRI restriction enzymes, which contained a 16S promoter.

2.7. Diparental Conjugation

The method of biparental conjugation was used as described in a previous study [31,32], with slight modifications in this study. E. coli S17-1 carried the corresponding plasmid to the R. sphaeroides strains. First, 0.5 mL of E. coli S17-1 carrying the plasmid and 1 mL of R. sphaeroides cells (OD660 = 0.6–0.8) were collected via centrifugation at 4000 rpm at 25 °C for 5 min. The 150 μL RÄ media was used to resuspend the cell pellet. Then, the mixed suspension was pipetted onto the Carl-Roth membrane (0.45 μm) and incubated on a PY agar plate at 32 °C. After 6 h of cultivation, the cells were washed from the membrane, streaked on RÄ agar plates containing the corresponding antibiotics, and cultivated at 32 °C for 3 days.

2.8. β-Galactosidase Assay

R. sphaeroides strains containing a plasmid-borne RSP_0557-lacZ fusion were cultivated in RÄ media under micro-aerobic growth conditions. Cells were harvested across growth phases after inoculation in RÄ liquid media from 0 h to 72 h and outgrowth (culture was diluted to fresh media with an optical density of 0.2 at 660 nm) at 24 h, 48 h, and 72 h of cultivation. Different volumes of samples were collected for testing according to the OD660 of the culture. The β-galactosidase activity of transcriptional fusions was measured using the hydrolysis of O-nitrophenyl-β-D-galactopyranoside (ONPG) and expressed as Miller Units [33]. At least three biological repeats were measured.

2.9. Quantitative Real-Time RT PCR

R. sphaeroides 2.4.1 cultures were harvested via centrifugation at 10,000 rpm for 10 min at 4 °C in different growth phases. Then, RNA was extracted and purified for RT-PCR using the RNAprep Pure Cell/Characteristic Kit of TIANGEN. As described in the manufacturer’s manual, reverse transcription and PCR reactions were performed using the Brilliant III Ultra-Fast SYBR Green QRT-PCR Master Mix (Agilent, Santa Clara, CA, USA), and amplification was performed using a CFX96 RT-PCR machine (Bio-Rad, Hercules, CA, USA). To ensure the accuracy of the data, all RT-PCR experiments were conducted in triplicate. The rpoZ gene was used as an endogenous control. Relative mRNA levels were calculated according to the Pfaffl method. The primers are listed in Table 2.

2.10. Data Analysis

Microsoft Office Professional Plus 2010 and GraphPad Prism 5 were employed for data and image processing, respectively.

3. Results

3.1. The rsp_0557 Is Regulated by RpoHI/RpoHII in R. sphaeroides

According to transcriptome data, most growth phase-dependent expression genes are regulated by alternative sigma factors, such as RpoHI, RpoHII, or either [16]. Within the group, we found that rsp_0557 presents growth phase-dependent expression, which encodes a small protein with 70 amino acids containing a DUF1127 domain. RSP_0557 is homologous to RSP_6037, and the latter also has a DUF1127 domain that functions in RNA turnover and sRNA maturation [23,34]. Earlier research has demonstrated that the presence of photo-oxidative stress and hydrogen peroxide leads to an elevation in rsp_0557 mRNA, which is influenced by RpoHI or RpoHII sigma factors in R. sphaeroides [35]. To verify the interactions between the promoter of rsp_0557 and RpoHI or RpoHII, the region upstream of the transcription start site of the rsp_0557 gene was searched for common motifs using the MEME program. We found that the TTG in the -35 region and TAT in the -12 region of the rsp_0557 transcription start site corresponded to the conserved motif recognized by RpoHI/RpoHII (Figure 1B) [16].
To further demonstrate the interactions between the promoter of rsp_0557 and RpoHI or RpoHII, electrophoresis mobility shift assays were carried out to determine whether RpoHI protein interacted with the rsp_0557 promoter in vitro. The RpoHI protein at final concentrations of 2.9 pM and 5.8 pM was incubated with 160 ng rsp_0557 promoter. As shown in Figure 1B, the RpoHI protein did not bind to the rsp_0557 promoter without the RNA polymerase core enzyme; however, a shifted band was observed when the RNA polymerase core enzyme was present, which confirmed the interaction between the RpoHI protein and the rsp_0557 promoter. No interaction was observed between RpoHI and the negative control of the rsp_0960 promoter (Figure 1B). As shown in Figure 1C, we also proved that the RpoHII protein interacted directly with the promoter region of rsp_0557 when the core enzyme was present, as well as with the RpoHI protein. In addition, after the TTG and TAT in the -35 and -12 regions of the rsp_0557 transcription start site were mutated, the interaction was still not observed after adding excessive RpoHI or RpoHII protein under the action of the RNA polymerase core enzyme (Figure 1D). This suggests that the interaction of RpoHI or RpoHII with the rsp_0557 promoter region was direct and specific.

3.2. Growth Phase-Dependent Expression of rsp_0557

To analyze rsp_0557 expression with respect to growth phases, we tested the rsp_0557 promoter transcriptional activity to indirectly reflect the expression level of rsp_0557 using the reporter plasmid pBBRI-0557-lacZ in the wild-type strain. Cells from the reporter strain were harvested at various time intervals throughout the growth phases (0 h–72 h of growth) and outgrowth phases at 24 h, 48 h, and 72 h of cultivation under semiaerobic growth conditions.
The β-Gal results showed that the activity of the rsp_0557 promoter changed continuously and significantly in different culture periods in the wild-type strain, particularly during the exponential phase and the early stationary phase (Figure 2), which indicates that rsp_0557 is a growth phase-dependent expression gene. The activity of β-Gal was in a state of constant fluctuation before 12 h. Then, the activity decreased rapidly, with only 952 Miller Units at 24 h of growth. After 48 h, the β-Gal activity increased from the lowest activity at 24 h of growth to a high level. After cultures were diluted in fresh media to OD660 of 0.2 at 24 h, 48 h, and 72 h of growth, a temporary increase in the β-Gal activity was detected. Following further cultivation, the β-Gal activity declined steadily. These results further prove that rsp_0557 exhibits growth phase-dependent expression.

3.3. Major Roles of RpoHI/RpoHII in the Transcription of rsp_0557 in Different Growth Phases

A recent study indicated that the regulons of RpoHI and RpoHII were partially overlapped [17]. Although RpoHI mainly plays a role after heat stress and photo-oxidative stress, RpoHII mainly functions under exposure to photo-oxidative stress [19]. RpoHII activates many genes with different functions in response to oxidative stress [17,18]. Moreover, other than heat shock and singlet oxygen, previous studies have shown that the RpoHI/RpoHII-dependent promoter can also be activated by several other stress factors, such as organic peroxide, hydrogen peroxide, superoxide, and CdCl2 [23]. The alternative sigma factors of RpoHI/HII regulate entry into the stationary phase and subsequent outgrowth [16].
To learn more about the effect of RpoHI/RpoHII on rsp_0557 in different growth phases, we fused the reporter plasmid pBBRI-0557-lacZ into the rpoHI deletion mutant, along with rpoHII deletion mutant as well as rpoHI/rpoHII double deletion mutant.
Compared to the wild type, the expression pattern of rsp_0557 was completely different in the absence of rpoHI (Figure 2 and Figure 3A). The activity of β-Gal in the rpoHI deletion mutant was significantly lower than that in the wild-type strain. The transcriptional activity increased at the onset of the exponential phase and then decreased gradually, and was maintained at a low level when the culture entered the stationary phase in the rpoHI deletion mutant. The β-Gal activity remained almost unchanged, especially at 48 h and 72 h of outgrowth periods. The above shows that RpoHI mainly has a function in the outgrowth phase due to the duration of the stationary phase.
In the rpoHII deletion mutant, the promoter activity of rsp_0557 was significantly higher than that in the rpoHI deletion mutant, but definitely lower than that in the wild type (Figure 2 and Figure 3A,B). The β-Gal activity was different during the whole growth phase. The β-Gal activity exhibited a consistent increase from the initial exponential phase to the initial stationary phase, followed by its maintenance in a high platform during the stationary phase in the rpoHII deletion mutant. The activity of β-Gal increased first and then decreased in the 24 h of outgrowth, and decreased continuously in the 48 h of outgrowth, similarly to the wild-type strain. However, it remained unchanged in the 72 h of outgrowth. This indicates that RpoHI and RpoHII regulate rsp_0557 transcription in different strategies during outgrowth, depending on the duration of the stationary phase, but the role of RpoHI is greater.
The measurement of rsp_0557 promoter activity across growth phases was not significantly different between the rpoHI/HII double deletion mutant and the rpoHI deletion mutant; the sole difference was that the activity of β-Gal in the rpoHI deletion mutant was higher before 24 h compared to the rpoHI/HII double deletion mutant (Figure 3A,C). During the outgrowth, the β-Gal activity remained constant. Because RpoHI and RpoHII regulated the outgrowth period of the stationary phase of R. sphaeroides [16], therefore, when both RpoHI and RpoHII were removed, the β-Gal activity during the outgrowth phase was almost unchanged. In addition, we also measured the relative expression levels of rpoHI and rpoHII in the wild-type strain using the 6 h expression level as a control (Figure 4A,B). The results showed that the expression level of rpoHI did not change significantly during the exponential phase. At 24 h of the stationary phase, the expression level of rpoHI significantly decreased compared to the exponential phase. However, at 48 h of the stationary phase, the expression level increased compared to that at 24 h, and at 72 h of the stationary phase, there was no significant change compared to 48 h. During the three outgrowth phases of the stationary phase, the expression level of rpoHI increased when the culture was diluted (Figure 4A). The rpoHII expression results showed that the trend of rpoHII expression was similar to that of rpoHI during the exponential and stationary phase; however, the relative expression level of rpoHII was higher during the exponential phase of 12 and 18 h compared to that of rpoHII. In the outgrowth phase at 24 h, the expression of rpoHII significantly increased after diluting the culture. During the 48 and 72 h outgrowth phases, there was no significant change in rpoHII expression after diluting the culture (Figure 4B). The above results indicate that RpoHI and RpoHII are important regulators of gene expression during the outgrowth phase. RpoHI produces a marked effect in the stationary and outgrowth phases. RpoHII mainly affected the lag phase, exponential phase, and transition phases from the late exponential to the stationary phase.

3.4. Major Role of RpoE in the Transcription of rsp_0557 in Different Growth Phases

It has been revealed that the sigma factor RpoE has a central function in resistance to the photo-oxidative stress in R. sphaeroides [17,18,19]. RpoE regulates the transcription of its own gene and promotes the transcription of other genes, including photolyase genes, rpoHII, and some sRNAs [19]. The gene rsp_0557 transcription is mediated by RpoHII, so we speculate that RpoE may indirectly influence the expression of rsp_0557. In order to determine the regulatory function of RpoE on rsp_0557 expression in different growth phases, β-Gal activity was also assessed in the absence of RpoE (in the TF18 strain, rpoE-chrR deletion mutant).
During the whole growth phase, the pattern of rsp_0557 expression in TF18 (Figure 5) was slightly different from that in the wild-type strain (Figure 2), especially during the exponential phase, early stationary phase, and outgrowth phase. In the exponential phase and early stationary phase, the β-Gal activity of the TF18 strain was higher than that of the wild-type strain. In the wild type, the β-Gal activity exhibited a rapid increase, followed by a subsequent decrease following culture dilution during the outgrowth phase. On the contrary, the activity directly decreased in the TF18 strain. Therefore, we predicted that RpoE has functions of both positive regulation and negative regulation of the expression of rsp_0557, which was used to balance the total number of the rsp_0557 mRNA. Interestingly, if RpoE regulates the rsp_0557 expression only via RpoHII, the expression of rsp_0557 in the absence of RpoE across growth phases should be the same as that in the rpoHII deletion strain. However, the β-Gal activity in the TF18 strain was significantly higher than that in the rpoHII deletion strain (Figure 3 and Figure 5). In addition, we also measured the relative expression level of rpoE in the wild-type strain (Figure 4C), and the results showed that there was no significant change in the expression level of rpoE during the exponential phase. The rpoE expression level rose steadily over time during the stationary phase. During the 24 h outgrowth phase, when the culture was diluted, the expression level of rpoE first increased and then decreased. However, during the 48 h and 72 h outgrowth phases, the expression level of rpoE after dilution decreased. This indicates that RpoE regulates the expression of rsp_0557 via RpoHII, as well as other regulatory factors.

3.5. sRNA Pos19 Is Involved in Regulating the Expression of rsp_0557

Based on the aforementioned research, we can conclude that RpoHI and RpoHII promote the expression of rsp_0557, and RpoE controls other regulators to inhibit the expression of rsp_0557, especially in the exponential and early stationary phases. Previous studies indicated that sRNA Pos19 is a negative regulator of rsp_0557 expression. Pos19 has an RpoE-dependent promoter with a noncoding function that regulates the balance of thio-metabolism [26]. The overexpression of pos19 reduces the content of glutathione in the exponential phase in cells, and the level of reactive oxygen species (ROS) does not change significantly, but the level of ROS in the exponential phase will increase after the removal of pos19 [26]. According to microarray data analysis, overexpression of pos19 significantly reduces the level of rsp_0557 mRNA under singlet oxygen stress [26], and it has been shown that the sRNA Pos19 interacts with rsp_0557 mRNA.
Thus, to determine the regulatory role of sRNA Pos19 in the expression of rsp_0557, we constructed a pos19 deletion strain without a resistance marker. In contrast, the expression level of rsp_0557 was lower in the pos19 deletion mutant compared to the wild-type strain throughout the growth phases (Figure 2 and Figure 6A), which is inconsistent with our expectation that sRNA Pos19 inhibits the expression of rsp_0557. Therefore, to learn more about the influence of Pos19 on the expression of rsp_0557, we constructed a pos19 overexpression strain with a 16S promoter. Compared with the wild-type strain, the overexpression of pos19 significantly reduced the expression of rsp_0557 (Figure 2 and Figure 6B) in the exponential phase and early stationary phase. The above experiments show that the deletion or overexpression of pos19 will impede the transcription of rsp_0557. Therefore, in order to better understand the regulatory function of sRNA Pos19 in rsp_0557, the seed region (Figure 7A) was predicted using IntaRNA. We first analyzed the importance of the predicted binding region for rsp_0557 promoter activity. After removing the 1-15 base of the rsp_0557 mRNA seed region (Figure 7A), the β-Gal activity exhibited a remarkably diminished level (less than 50 Miller Units), which proves that the predicted binding region is necessary for the normal expression of rsp_0557. Then, we mutated the GCC of 7-9 base sites in the predicted rsp_0557 mRNA seed region to CGG, namely rsp_0557M3 (Figure 7A), and the expression pattern of rsp_0557M3 was analyzed. The results showed that compared with the unmutated reporter (Figure 2), the mutated rsp_0557 reporter plasmid resulted in less β-Gal activity than overall (Figure 7B), indicating that the GCC of 7-9 base sites in the seed region of rsp_0557 mRNA is necessary for the normal expression of rsp_0557. Müller proved that after the 7-9 base complementary mutation of Pos19 and rsp_0557 mRNA, there is no significant change in the β-Gal activity compared with the control [35], indicating that the combination of sRNA Pos19 and rsp_0557 mRNA can better maintain the stability of rsp_0557 mRNA, but the overexpression of pos19 also inhibits the expression of rsp_0557 in the exponential phase and early stationary phase.

3.6. ChrR Participates in Maintaining the Stability of rsp_0557 Expression Level

Under non-stress conditions, ChrR interacts with RpoE to form a heterodimer complex, thereby inhibiting the activity of RpoE protein. RpoE is released after the degradation of protein ChrR by proteases DegS and RseP under oxidative stress [21]. Therefore, RpoE remains active continuously after the deletion of ChrR, and RpoE actively and automatically regulates the expression of its own gene and activates the transcription of other target genes, including rpoHII [21]. Hence, for the purpose of understanding the regulatory function of ChrR in the rsp_0557 expression, the β-Gal activity in the chrR deletion mutant was detected. The results showed that the rsp_0557 expression level in the chrR deletion strain was significantly different from the other strains (Figure 2, Figure 3, Figure 4, Figure 5, Figure 6, Figure 7 and Figure 8). The β-Gal activity increased in the exponential phase more rapidly in the chrR deletion strain than in other strains (Figure 8), and then the level decreased rapidly from the exponential phase to the stationary phase. In addition, the β-Gal activity quickly increased and remained at a constant level after dilution at 24 h, 48 h, and 72 h of growth. It shows that the overexpression of RpoE will significantly increase the expression of rsp_0557 during the exponential phase and inhibit the expression of rsp_0557 during the stationary phase. Therefore, when RpoE is present, ChrR must exist simultaneously to maintain the normal expression level of rsp_0557 in the stationary phase.

4. Discussion

Adapting and surviving under changing environments through the growth phase requires organisms to alter their gene expression pattern. In bacteria, the processes are mainly regulated by alternative sigma factors, which can combine with RNA polymerase to recognize specific promoters in cells and quickly adjust gene expressions in response to various signal stimuli. Furthermore, additional levels of regulation, post-transcriptional regulation, and translational regulation have been revealed [36]. To date, the molecular mechanisms of gene regulation with respect to growth phases are only known in a few species. For instance, RpoS, an alternative sigma factor regulates the process of entering the stationary phase, which alters the gene expression pattern so as to generate more resistant cells in enteric bacilli [1]. Previous studies verified that it is a complex mechanism of RpoS regulation, including transcriptional regulation, post-transcriptional regulation, and translational regulation. All these closely cooperate to resist several stresses [2]. These stresses trigger RpoS synthesis to increase the RpoS level in the stationary phase, enhance rpoS transcription, and improve protein stability and efficiency of translation [2,5,37]. During the stationary phase, RpoS modulates the expression of 10% of the genes, enhancing cellular resistance and adaptability to diverse stress scenarios in E. coli [38].
Alphaproteobacteria have an important role to play in animal and plant pathogens and symbionts, nitrogen fixation, carbon dioxide fixation, chemical product synthesis, and so on. The knowledge of gene regulation with respect to the growth phase is limited in Alphaproteobacteria. There is no RpoS homolog with regulatory function in the process of entry into the stationary phase, similar to enteric bacteria in Alphaproteobacteria, instead of other alternative sigma factors RpoHI/HII. As an illustration, a large number of genes showed altered mRNA levels in the stationary phase and following outgrowth in R. sphaeroides. RpoHI or RpoHII governs the transcription of numerous genes in R. sphaeroides, which react to diverse stresses [16]. The regulatory mechanisms of RpoHI/HII in growth phase gene regulation are not clear, but their functions in resistance to stresses in R. sphaeroides are well studied.
Our findings indicate that RpoHI/HII plays distinct roles in gene regulation during the growth phase. RpoHI and RpoHII control the expression of rsp_0557 in response to singlet oxygen and heat shock, whereas RSP_0557 balances GSH metabolism [26]. However, RpoHI and RpoHII regulate the transcription of rsp_0557 during distinct growth stages. We found that RpoHI enhanced the transcription of rsp_0557 in the stationary phase rather than in the exponential phase (Figure 3A). After a prolonged stationary phase, the level of rsp_0557 expression is decreased in outgrowth in the wild-type strain due to adaptation to changing environments. Nevertheless, cells lacking RpoHI have many defects, particularly the resistance to oxidative stress, and loss of the regulatory function on rsp_0557 in the outgrowth phase after prolonged stationary phase (Figure 3A,C). The report assays in the RpoHII deletion mutant support that RpoHII directs the rsp_0557 expression in the exponential phase; thus, RpoHII is the main regulator that adjusts rsp_0557 expression in response to slightly changing environments (Figure 3B). Based on the quantitative results, we found that during the stationary phase and following outgrowth, RpoHI is more important than RpoHII to program gene expression for cell survival and adaptation to harsh living conditions. We can conclude that cells need to coordinate RpoHI and RpoHII levels to regulate the transcription of rsp_0557 in R. sphaeroides, and RpoHI plays a dominant role. These regulatory mechanisms apparently differ from those of E. coli.
The key to the success of this regulation strategy is to control the activity of RpoHI and RpoHII and to ensure that the sigma factors are turned on or off in the right ways at the appropriate times. Under typical circumstances, the operations of alternative sigma factors are managed at various levels, such as transcription, post-transcription, and translation, which are intricate. It has been revealed that RpoE promotes the transcription of the rpoHII gene, whereas RpoHII controls the rsp_0557 transcription. We can legitimately anticipate that the expression pattern of rsp_0557 throughout the growth phase in the absence of RpoE should be similar to that in the rpoHII deletion strain, but we did not observe a promising result. In addition, the relative expression patterns of rpoHII and rpoE are also different (Figure 4B,C). Thus, it can be seen there are other regulators involved in the regulatory pathway of the rsp_0557 expression. A previous study showed that an sRNA Pos19 negatively regulated the expression of rsp_0557 at the post-transcriptional level in response to singlet oxygen and hydrogen peroxide. The transcription of Pos19 is controlled by RpoE as well as the rpoHII gene [26]. The deletion or overexpression strain showed that Pos19 not only decreased the transcription of rsp_0557 in the exponential phase but also increased the rsp_0557 level in the stationary phase. Therefore, we conclude that RpoE can affect the expression of rsp_0557 via both the negative regulator Pos19 and positive regulation RpoHII, thereby controlling the amount of rsp_0557 mRNA. Moreover, the RpoE overexpression strain (chrR deletion) indicated that RpoE activity mainly affects the stationary phase, in which the transcription of rsp_0557 was at an extremely low level. The high expression level in the exponential phase suggests that the higher resistance of the chrR deletion strain compared to that of the wild-type strain leads to significantly reduced transcription. Therefore, the regulation of the underlying mechanisms in the stationary phase is more complex than our anticipation in the past. Hence, if degradation of ChrR is not the sole way to determine the total activity of RpoE during growth, it does so through an unknown pathway. We anticipated that ChrR would act as a regulator of RpoE activity in order to maintain equilibrium between the transcripts of Pos19 and rpoHII. The low expression of rsp_0557 might be due to a lack of chrR, which causes the overexpression of pos19 and rpoHII to break the balance of regulation. In addition, we can exclude the regulatory function of RpoE-RpoHII-StsR in response to stress during the stationary phase [36]. However, we still came to the conclusion that the expression of rsp_0557 is regulated by RpoE via RpoHII and Pos19 to balance the GSH content in response to stress throughout the growth phase.

5. Conclusions

For now, it is impossible to show the regulatory functions of RpoHI and RpoHII on the expression of each gene during different growth phases in cells. Although the functions of RpoE, RpoHI, RpoHII, ChrR, and Pos19 have been identified in numerous studies, the intricate network that regulates growth phase-dependent genes remains a mystery. Various combinations of these regulators are recruited by cells to adapt to or survive under different conditions throughout the growth phase. To summarize, we suggest that ChrR activates RpoE activity in order to control gene expression throughout the growth stage. In the exponential phase, RpoHII and Pos19 regulate the expression of rsp_0557 at an appropriate level under RpoE control. In the stationary phase, RpoHI and Pos19 stabilize the transcription of rsp_0557 at high levels. In the outgrowth phase, RpoHI negatively regulates the transcription of rsp_0557. Our study demonstrates that the regulation mechanism across the growth phase is more complex than that in oxidative stress. It still did not display all of the regulators involved in growth phase-dependent regulation. Consequently, additional research is required to comprehend the various regulators governing these intricate networks, gain further insights into their interplay, and comprehend the regulation of adaptation to the changing conditions and growth phases.

Author Contributions

Q.L. designed the research; J.Z. performed experiments; M.Z., S.Z., T.B., and Z.T. contributed study materials; Q.L. and J.Z. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Natural Science Foundation of Sichuan Province (grant no. 2023NSFSC1226).

Data Availability Statement

All data are provided in full in this paper.

Acknowledgments

We thank Gabriele Klug for sharing strains.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Llorens, J.M.N.; Tormo, A.; Martinez-Garcia, E. Stationary phase in Gram-negative bacteria. FEMS Microbiol. Rev. 2010, 34, 476–495. [Google Scholar] [CrossRef] [PubMed]
  2. Hengge-Aronis, R. Signal transduction and regulatory mechanisms involved in control of the sigma(S) (RpoS) subunit of RNA polymerase. Microbiol. Mol. Biol. Rev. 2002, 66, 373–395. [Google Scholar] [CrossRef] [PubMed]
  3. Schellhorn, H.E.; Stones, V.L. Regulation of katF and katE in Escherichia coli K-12 by weak acids. J. Bacteriol. 1992, 174, 4769–4776. [Google Scholar] [CrossRef] [PubMed]
  4. Mika, F.; Hengge, R. A two-component phosphotransfer network involving ArcB, ArcA, and RssB coordinates synthesis and proteolysis of sigmaS (RpoS) in E. coli. Gene Dev. 2005, 19, 2770–2781. [Google Scholar] [CrossRef] [PubMed]
  5. Majdalani, N.; Chen, S.; Murrow, J.; John, K.; Gottesman, S. Regulation of RpoS by a novel small RNA: The characterization of RprA. Mol. Microbiol. 2001, 39, 1382–1394. [Google Scholar] [CrossRef] [PubMed]
  6. Majdalani, N.; Cunning, C.; Sledjeski, D.; Elliott, T.; Gottesman, S. DsrA RNA regulates translation of RpoS message by an anti-antisense mechanism, independent of its action as an antisilencer of transcription. Proc. Natl. Acad. Sci. USA 1998, 95, 12462–12467. [Google Scholar] [CrossRef] [PubMed]
  7. Zhang, A.; Altuvia, S.; Tiwari, A.; Argaman, L.; Hengge-Aronis, R.; Storz, G. The OxyS regulatory RNA represses rpoS translation and binds the Hfq (HF-I) protein. EMBO J. 1998, 17, 6061–6068. [Google Scholar] [CrossRef]
  8. Azam, T.A.; Iwata, A.; Nishimura, A.; Ueda, S.; Ishihama, A. Growth phase-dependent variation in protein composition of the Escherichia coli nucleoid. J. Bacteriol. 1999, 181, 6361–6370. [Google Scholar] [CrossRef]
  9. Jin, D.J.; Cagliero, C.; Zhou, Y.N. Growth rate regulation in Escherichia coli. FEMS Microbiol. Rev. 2012, 36, 269–287. [Google Scholar] [CrossRef]
  10. Landgraf, J.R.; Wu, J.; Calvo, J.M. Effects of nutrition and growth rate on Lrp levels in Escherichia coli. J. Bacteriol. 1996, 178, 6930–6936. [Google Scholar] [CrossRef]
  11. Costanzo, A.; Ades, S.E. Growth phase-dependent regulation of the extracytoplasmic stress factor, sigmaE, by guanosine 3′,5′-bispyrophosphate (ppGpp). J. Bacteriol. 2006, 188, 4627–4634. [Google Scholar] [CrossRef] [PubMed]
  12. Blom, E.J.; Ridder, A.N.; Lulko, A.T.; Roerdink, J.B.; Kuipers, O.P. Time-resolved transcriptomics and bioinformatic analyses reveal intrinsic stress responses during batch culture of Bacillus subtilis. PLoS ONE 2011, 6, e27160. [Google Scholar] [CrossRef] [PubMed]
  13. Sonenshein, A.L. CodY, a global regulator of stationary phase and virulence in Gram-positive bacteria. Curr. Opin. Microbiol. 2005, 8, 203–207. [Google Scholar] [CrossRef] [PubMed]
  14. Geiger, T.; Wolz, C. Intersection of the stringent response and the CodY regulon in low GC Gram-positive bacteria. Int. J. Med. Microbiol. 2014, 304, 150–155. [Google Scholar] [CrossRef] [PubMed]
  15. Aretha, F.; Herrou, J.; Willett, J.; Crosson, S. General Stress Signaling in the Alphaproteobacteria. Annu. Rev. Genet. 2015, 49, 603. [Google Scholar]
  16. Remes, B.; Rische-Grahl, T.; Müller, K.M.H.; Klug, G. An RpoHI-dependent response promotes outgrowth after extended stationary phase in the Alphaproteobacterium Rhodobacter sphaeroides. J. Bacteriol. 2017, 199, 10–1128. [Google Scholar] [CrossRef] [PubMed]
  17. Nuss, A.M.; Glaeser, J.; Berghoff, B.A.; Klug, G. Overlapping alternative sigma factor regulons in the response to singlet oxygen in Rhodobacter sphaeroides. J. Bacteriol. 2010, 192, 2613–2623. [Google Scholar] [CrossRef]
  18. Dufour, Y.S.; Imam, S.; Koo, B.M.; Green, H.A.; Donohue, T.J. Convergence of the transcriptional responses to heat shock and singlet oxygen stresses. PLoS Genet. 2012, 8, e1002929. [Google Scholar] [CrossRef]
  19. Nuss, A.M.; Glaeser, J.; Klug, G. RpoHII activates oxidative-stress defense systems and is controlled by RpoE in the singlet oxygen-dependent response in Rhodobacter sphaeroides. J. Bacteriol. 2009, 191, 220–230. [Google Scholar] [CrossRef]
  20. Anthony, J.R.; Newman, J.D.; Donohue, T.J. Interactions between the Rhodobacter sphaeroides ECF sigma factor, sigma(E), and its anti-sigma factor, ChrR. J. Mol. Biol. 2004, 341, 345–360. [Google Scholar] [CrossRef]
  21. Nuss, A.M.; Adnan, F.; Weber, L.; Berghoff, B.A.; Glaeser, J.; Klug, G. DegS and RseP homologous proteases are involved in singlet oxygen dependent activation of RpoE in Rhodobacter sphaeroides. PLoS ONE 2013, 8, e79520. [Google Scholar] [CrossRef] [PubMed]
  22. Braatsch, S.; Gomelsky, M.; Kuphal, S.; Klug, G. A single flavoprotein, AppA, integrates both redox and light signals in Rhodobacter sphaeroides. Mol. Microbiol. 2002, 45, 827–836. [Google Scholar] [CrossRef] [PubMed]
  23. Billenkamp, F.; Peng, T.; Berghoff, B.A.; Klug, G. A cluster of four homologous small RNAs modulates C1 metabolism and the pyruvate dehydrogenase complex in Rhodobacter sphaeroides under various stress conditions. J. Bacteriol. 2015, 197, 1839–1852. [Google Scholar] [CrossRef] [PubMed]
  24. Peuser, V.; Remes, B.; Klug, G. Role of the Irr protein in the regulation of iron metabolism in Rhodobacter sphaeroides. PLoS ONE 2012, 7, e42231. [Google Scholar] [CrossRef] [PubMed]
  25. Grutzner, J.; Remes, B.; Eisenhardt, K.; Scheller, D.; Kretz, J.; Madhugiri, R.; McIntosh, M.; Klug, G. sRNA-mediated RNA processing regulates bacterial cell division. Nucleic Acids Res. 2021, 49, 7035–7052. [Google Scholar] [CrossRef] [PubMed]
  26. Müller, K.; Berghoff, B.A.; Eisenhardt, B.D.; Remes, B.; Klug, G. Characteristics of Pos19-A small coding RNA in the oxidative stress response of Rhodobacter sphaeroides. PLoS ONE 2016, 11, e0163425. [Google Scholar] [CrossRef] [PubMed]
  27. Francez-Charlot, A.; Kaczmarczyk, A.; Fischer, H.M.; Vorholt, J.A. The general stress response in Alphaproteobacteria. Trends Microbiol. 2015, 23, 164–171. [Google Scholar] [CrossRef]
  28. Li, Q.; Peng, T.; Klug, G. The PhyR homolog RSP_1274 of Rhodobacter sphaeroides is involved in defense of membrane stress and has a moderate effect on RpoE (RSP_1092) activity. BMC Microbiol. 2018, 18, 18. [Google Scholar] [CrossRef]
  29. Börner, J.; Friedrich, T.; Bartkuhn, M.; Klug, G. Ribonuclease E strongly impacts bacterial adaptation to different growth conditions. RNA Biol. 2023, 20, 120–135. [Google Scholar] [CrossRef]
  30. Remes, B.; Berghoff, B.A.; Förstner, K.U.; Klug, G. Role of oxygen and the OxyR protein in the response to iron limitation in Rhodobacter sphaeroides. BMC Genom. 2014, 15, 794. [Google Scholar] [CrossRef]
  31. Su, A.; Chi, S.; Li, Y.; Tan, S.; Qiang, S.; Chen, Z.; Meng, Y. Metabolic redesign of Rhodobacter sphaeroides for lycopene production. J. Agric. Food Chem. 2018, 66, 5879–5885. [Google Scholar] [CrossRef]
  32. Qu, Y.; Su, A.; Li, Y.; Meng, Y.; Chen, Z. Manipulation of the regulatory genes ppsR and prrA in Rhodobacter sphaeroides enhances lycopene production. J. Agric. Food Chem. 2021, 69, 4134–4143. [Google Scholar] [CrossRef] [PubMed]
  33. Hübner, P.; Willison, J.C.; Vignais, P.M.; Bickle, T.A. Expression of regulatory nif genes in Rhodobacter capsulatus. J. Bacteriol. 1991, 173, 2993–2999. [Google Scholar] [CrossRef] [PubMed]
  34. Grutzner, J.; Billenkamp, F.; Spanka, D.T.; Rick, T.; Monzon, V.; Forstner, K.U.; Klug, G. The small DUF1127 protein CcaF1 from Rhodobacter sphaeroides is an RNA-binding protein involved in sRNA maturation and RNA turnover. Nucleic Acids Res. 2021, 49, 3003–3019. [Google Scholar] [CrossRef] [PubMed]
  35. Müller, K. Small Regulatory RNAs Promoting the Oxidative Stress Response and Adaptive Metabolic Changes in Rhodobacter sphaeroides. Ph.D. Thesis, Universitaet Giessen, Giessen, Germany, 2016. [Google Scholar]
  36. Eisenhardt, K.M.H.; Remes, B.; Grutzner, J.; Spanka, D.T.; Jager, A.; Klug, G. A complex network of sigma factors and sRNA StsR regulates stress responses in R. sphaeroides. Int. J. Mol. Sci. 2021, 22, 7557. [Google Scholar] [CrossRef] [PubMed]
  37. Lange, R.; Hengge-Aronis, R. The cellular concentration of the sigma S subunit of RNA polymerase in Escherichia coli is controlled at the levels of transcription, translation, and protein stability. Gene Dev. 1994, 8, 1600–1612. [Google Scholar] [CrossRef] [PubMed]
  38. Weber, H.; Polen, T.; Heuveling, J.; Wendisch, V.F.; Hengge, R. Genome-wide analysis of the general stress response network in Escherichia coli: SigmaS-dependent genes, promoters, and sigma factor selectivity. J. Bacteriol. 2005, 187, 1591–1603. [Google Scholar] [CrossRef] [PubMed]
Microorganisms 11 02678 g001
Figure 1. EMSAs of RpoHI or RpoHII interactions with the rsp_0557 promoter. (A) The upstream region of rsp_0557 matching the consensus sequences of RpoHI/HII promoter -35 (TTG) and -12 (TAT) using the MEME program. (B,C) A FAM-labeled 282 bp fragment of the rsp_0557 promoter was mixed with a certain amount (unit) of E. coli core RNA polymerase (core RNAP) and a certain amount (pM) of purified RpoH protein with His tag, and then incubated at room temperature for 30 min. A FAM-labeled 273 bp fragment of the rsp_ 0960 promoter used as a negative control. (D) The rsp_0557 promoter mutated in -12 or -35 region was mixed with core RNAP and purified RpoH protein. CK is blank control, I represents RpoHI protein, and II represents RpoHII protein.
Figure 1. EMSAs of RpoHI or RpoHII interactions with the rsp_0557 promoter. (A) The upstream region of rsp_0557 matching the consensus sequences of RpoHI/HII promoter -35 (TTG) and -12 (TAT) using the MEME program. (B,C) A FAM-labeled 282 bp fragment of the rsp_0557 promoter was mixed with a certain amount (unit) of E. coli core RNA polymerase (core RNAP) and a certain amount (pM) of purified RpoH protein with His tag, and then incubated at room temperature for 30 min. A FAM-labeled 273 bp fragment of the rsp_ 0960 promoter used as a negative control. (D) The rsp_0557 promoter mutated in -12 or -35 region was mixed with core RNAP and purified RpoH protein. CK is blank control, I represents RpoHI protein, and II represents RpoHII protein.
Microorganisms 11 02678 g001
Microorganisms 11 02678 g002
Figure 2. β-Gal activity throughout the growth phase in R. sphaeroides 2.4.1. The line connected by the solid circle represents the growth curve throughout the growth phase; the solid circle connected with the red line represents the growth curve of outgrowth; the line connected by the hollow circle represents the β-Gal activity throughout the growth phase; the blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Figure 2. β-Gal activity throughout the growth phase in R. sphaeroides 2.4.1. The line connected by the solid circle represents the growth curve throughout the growth phase; the solid circle connected with the red line represents the growth curve of outgrowth; the line connected by the hollow circle represents the β-Gal activity throughout the growth phase; the blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Microorganisms 11 02678 g002
Microorganisms 11 02678 g003
Figure 3. Major roles of RpoHI/RpoHII on the expression of rsp_0557 during different growth phases. (A) rpoHI deletion mutant. (B) rpoHII deletion mutant. (C) rpoHI/rpoHII double deletion mutant. The line connected by the solid circle represents the growth curve throughout the growth phase; the solid circle connected with the red line represents the growth curve of outgrowth; the line connected by the hollow circle represents the β-Gal activity throughout the growth phase; the blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Figure 3. Major roles of RpoHI/RpoHII on the expression of rsp_0557 during different growth phases. (A) rpoHI deletion mutant. (B) rpoHII deletion mutant. (C) rpoHI/rpoHII double deletion mutant. The line connected by the solid circle represents the growth curve throughout the growth phase; the solid circle connected with the red line represents the growth curve of outgrowth; the line connected by the hollow circle represents the β-Gal activity throughout the growth phase; the blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Microorganisms 11 02678 g003
Microorganisms 11 02678 g004
Figure 4. Real-time quantitative PCR results. The ratio of expression (log2-fold change) of selected genes as determined using real-time RT-PCR at different phases compared to the exponential phase of 6 h in the wild type of R. sphaeroides. The results were obtained from three independent biological experiments. The error bars represent the standard error of the mean. (A) The relative expression level of rpoHI in wild-type strain. (B) The relative expression level of rpoHII in wild-type strain. (C) The relative expression level of rpoE in wild-type strain.
Figure 4. Real-time quantitative PCR results. The ratio of expression (log2-fold change) of selected genes as determined using real-time RT-PCR at different phases compared to the exponential phase of 6 h in the wild type of R. sphaeroides. The results were obtained from three independent biological experiments. The error bars represent the standard error of the mean. (A) The relative expression level of rpoHI in wild-type strain. (B) The relative expression level of rpoHII in wild-type strain. (C) The relative expression level of rpoE in wild-type strain.
Microorganisms 11 02678 g004
Microorganisms 11 02678 g005
Figure 5. Growth phase-dependent expression of rsp_0557 in rpoE-chrR deletion strain. The line connected by the solid circle represents the growth curve throughout the growth phase; the solid circle connected with the red line represents the growth curve of outgrowth; the line connected by the hollow circle represents the β-Gal activity throughout the growth phase; the blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Figure 5. Growth phase-dependent expression of rsp_0557 in rpoE-chrR deletion strain. The line connected by the solid circle represents the growth curve throughout the growth phase; the solid circle connected with the red line represents the growth curve of outgrowth; the line connected by the hollow circle represents the β-Gal activity throughout the growth phase; the blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Microorganisms 11 02678 g005
Microorganisms 11 02678 g006
Figure 6. The major role of sRNA Pos19 on rsp_0557 with respect to the growth phase. (A) pos19 deletion strain. (B) pos19 overexpression strain. The line connected by the solid circle represents the growth curve throughout the growth phase; the solid circle connected with the red line represents the growth curve of outgrowth; the line connected by the hollow circle represents the β-Gal activity throughout the growth phase; the blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Figure 6. The major role of sRNA Pos19 on rsp_0557 with respect to the growth phase. (A) pos19 deletion strain. (B) pos19 overexpression strain. The line connected by the solid circle represents the growth curve throughout the growth phase; the solid circle connected with the red line represents the growth curve of outgrowth; the line connected by the hollow circle represents the β-Gal activity throughout the growth phase; the blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Microorganisms 11 02678 g006
Microorganisms 11 02678 g007
Figure 7. Transcriptional activity of the mutated rsp_0557 promoter throughout the growth phase in the wild type. The GCC of 7-9 base sites relative to the start codon of rsp_0557 mRNA was mutated to CGG. (A) Predicted interaction (seed region) between Pos19 and the rsp_0557 mRNA using IntaRNA. The numbers on the rsp_0557 mRNA sequence represent the position referred to by the start codon, while the numbers on Pos19 are relative to the 5′ end. The red text in the box represents the rsp_0557 mRNA mutation site. (B) Mutated rsp_0557 promoter sequences were inserted into pBBRIMCS5 fused with the lacZ gene. The resulting reporter plasmids were transferred to the wild type. Samples were collected for β-Gal assays. The line connected by the solid circle represents the growth curve throughout the growth phase; the solid circle connected with the red line represents the growth curve of outgrowth; the line connected by the hollow circle represents the β-Gal activity throughout the growth phase; the blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Figure 7. Transcriptional activity of the mutated rsp_0557 promoter throughout the growth phase in the wild type. The GCC of 7-9 base sites relative to the start codon of rsp_0557 mRNA was mutated to CGG. (A) Predicted interaction (seed region) between Pos19 and the rsp_0557 mRNA using IntaRNA. The numbers on the rsp_0557 mRNA sequence represent the position referred to by the start codon, while the numbers on Pos19 are relative to the 5′ end. The red text in the box represents the rsp_0557 mRNA mutation site. (B) Mutated rsp_0557 promoter sequences were inserted into pBBRIMCS5 fused with the lacZ gene. The resulting reporter plasmids were transferred to the wild type. Samples were collected for β-Gal assays. The line connected by the solid circle represents the growth curve throughout the growth phase; the solid circle connected with the red line represents the growth curve of outgrowth; the line connected by the hollow circle represents the β-Gal activity throughout the growth phase; the blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Microorganisms 11 02678 g007
Microorganisms 11 02678 g008
Figure 8. Growth phase-dependent expression of rsp_0557 gene in chrR deletion strain. The line connected by the solid circle represents the growth curve throughout the growth phase; The solid circle connected with the red line represents the growth curve of outgrowth; The line connected by the hollow circle represents the β-Gal activity throughout the growth phase; The blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Figure 8. Growth phase-dependent expression of rsp_0557 gene in chrR deletion strain. The line connected by the solid circle represents the growth curve throughout the growth phase; The solid circle connected with the red line represents the growth curve of outgrowth; The line connected by the hollow circle represents the β-Gal activity throughout the growth phase; The blue hollow circle connected with the blue line represents the β-Gal activity of outgrowth.
Microorganisms 11 02678 g008
Table 1. Bacterial strains and plasmids used in this study.
Table 1. Bacterial strains and plasmids used in this study.
Strain or PlasmidDescription or Relevant FeaturesSource/Reference
E. coli strains
DH5αFor Sub-Cloning Weidi
BL21 (DE3)For protein expressionTIANGEN
S17-1For diparental conjugationLab preservation
R. sphaeroide strains
2.4.1Wild typeLab preservation
TF18rpoE chrR mutation inWT, TprLab preservation
ΔrpoHIWT rpoHI::Kmr cassetteLab preservation
ΔrpoHIIWT rpoHII::Spr cassetteLab preservation
ΔrpoHIΔrpoHIIWT rpoHIIrpoHI::Kmr.Spr cassetteLab preservation
ΔChrR WT chrR::Tpr cassetteLab preservation
ΔPos19Pos19 markerless deletion mutantThis study
Plasmids
pJET1.2/blunt cloning vectorApr, 2.97 kbThermo
pBBRIMCS5-lacZGmrLab preservation
pBBRI-0557-lacZExpression of rsp_0557; GmrThis study
pK18mobsacBsuicide vector, sacB (sucrose sensitivity), KmrLab preservation
pK18mobsacB::pos19For pos19 deletion in 2.4.1This study
pET30bFor protein expressionLab preservation
pET30-RpoHIRpoHI protein expression vectorThis study
pET30-RpoHIIRpoHII protein expression vectorThis study
pRK16SOverexpression vector controlled by 16S promoterLab preservation
pRKPos19pos19 overexpression vectorThis study
Table 2. Oligodeoxynucleotides used in this study.
Table 2. Oligodeoxynucleotides used in this study.
Name Sequence 5′-3′Purpose
RpoHI-E-fCATATGAGCACTTACACCAGCCTTCCCEMSA
RpoHI-E-rGCGGCCGCGGCGGGGATCGTCATGEMSA
RpoHII-E-fCATATGGCACTGGACGGATATACCGATCEMSA
RpoHII-E-rGCGGCCGCTAGGAGGAAGTGATGCACCTCCEMSA
0557-EMSA-FTGCCTGCAGGTCGACGATCCGCACGGCGCCACEMSA
0557-EMSA-RCTCGAAGGCGGCCATGGEMSA
0557-35M-FGAACCAAGTTCCGACATCAAGCEMSA
0557-35M-RGTCGGAACTTGGTTCCGGAEMSA
0557-12M-FGCCGGCTAAATTGCCTGTTCEMSA
0557-12M-RCGTCTGAACAGGCAATTTAGCCEMSA
0960-EMSA-FTGCCTGCAGGTCGACGATTCCGACGGAAAACAGGATCCEMSA
0960-EMSA-RGCTTGCCTCCTGTAGGGCCEMSA
FAM Fluorescent primerTGCCTGCAGGTCGACGATEMSA
RSP_0557-fGAATTCCCGCACGGCGCloning
RSP_0557-rAAGCTTCTCGAAGGCGGCCloning
0019-XbaI-upTCTAGACGATCAGGCGACGGCloning-knockout
0019-upGGCCTTCTCCGGGGCACAGCTTACGCAGGGTCGCloning-knockout
0019-downGACCCTGCGTAAGCTGTGCCCCGGAGAAGGCCCCloning-knockout
0019-BamHI-downGGATCCTGCGCCCTCAGCloning-knockout
pPos19-FGGATCCCGATCAACCCAAGCAGAAOverexpression
pPos19-RGAATTCGGATGTCCCGCTCAGGOverexpression
rpoZ_RT-fATCGCGGAAGAGACCCAGAGRT-PCR
rpoZ_RT-rGAGCAGCGCCATCTGATCCTRT-PCR
rpoHI_RT-fGATCGCCAAGGATCTRT-PCR
rpoHI_RT-rCTGGTCGCTGTCTTCART-PCR
rpoHII_RT-fGCCGATGAACGACCTGATRT-PCR
rpoHII_RT-rAAGAACAGCGCCTTCTGGRT-PCR
rpoE_RT-fGTCTGGCAGAAGGCTCATRT-PCR
rpoE_RT-rGTTCTCCTGCTGCATCTCRT-PCR
The restriction enzyme cleavage sites are indicated by underlined bases.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, J.; Zheng, M.; Tang, Z.; Zhong, S.; Bu, T.; Li, Q. The Regulatory Functions of the Multiple Alternative Sigma Factors RpoE, RpoHI, and RpoHII Depend on the Growth Phase in Rhodobacter sphaeroides. Microorganisms 2023, 11, 2678. https://doi.org/10.3390/microorganisms11112678

AMA Style

Zhang J, Zheng M, Tang Z, Zhong S, Bu T, Li Q. The Regulatory Functions of the Multiple Alternative Sigma Factors RpoE, RpoHI, and RpoHII Depend on the Growth Phase in Rhodobacter sphaeroides. Microorganisms. 2023; 11(11):2678. https://doi.org/10.3390/microorganisms11112678

Chicago/Turabian Style

Zhang, Jing, Meijia Zheng, Zizhong Tang, Shanpu Zhong, Tongliang Bu, and Qingfeng Li. 2023. "The Regulatory Functions of the Multiple Alternative Sigma Factors RpoE, RpoHI, and RpoHII Depend on the Growth Phase in Rhodobacter sphaeroides" Microorganisms 11, no. 11: 2678. https://doi.org/10.3390/microorganisms11112678

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop