Impact of In-Feed versus In-Water Chlortetracycline and Tiamulin Administrations on Fecal Prevalence and Antimicrobial Susceptibilities of Campylobacter in a Population of Nursery Pigs
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal and Experimental Design
2.2. Fecal Samples
2.3. Isolation of Campylobacter from Fecal Samples
2.4. DNA Isolation and Speciation
2.5. Antimicrobial Susceptibility Testing
2.6. PCR Detection of Tetracycline Resistance Genes
2.7. Statistical Analysis
3. Results
3.1. Prevalence of Campylobacter
3.2. Antimicrobial Susceptibilities
3.3. Prevalence of Tetracycline Resistance Genes
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- ECDC/EFSA/EMA. ECDC/EFSA/EMA first joint report on the integrated analysis of the consumption of antimicrobial agents and occurrence of antimicrobial resistance in bacteria from humans and food-producing animals. EFSA J. 2015, 13, 4006. [Google Scholar] [CrossRef]
- WHO. Urgent Health Challenges for the Next Decade. 2020. Available online: https://www.who.int/news-room/photo-story/photo-story-detail/urgent-health-challenges-for-the-next-decade (accessed on 27 November 2023).
- CDC. Antibiotic Resistance Threats in the United States; U.S. Department of Health and Human Services, CDC: Atlanta, GA, USA, 2019; Volume 114. [Google Scholar]
- O’Neill, J. Tackling drug-resistant infections globally: Final report and recommendations. Rev. Antimicrob. Resist. 2016, 1–84. Available online: https://amr-review.org/sites/default/files/160518_Finalpaper_withcover.pdf (accessed on 15 November 2023).
- Aarestrup, F.M. The livestock reservoir for antimicrobial resistance: A personal view on changing patterns of risks, effects of interventions and the way forward. Phil. Trans. R. Soc. B 2015, 370, 20140085. [Google Scholar] [CrossRef] [PubMed]
- FDA. Summary Report on Antimicrobials Sold or Distributed for Use in Food-Producing Animals. In Center for Veterinary Medicine; FDA: Silver Spring, MD, USA, 2019. Available online: https://www.fda.gov/media/144427/download (accessed on 15 November 2023).
- Scallan, E.; Hoekstra, R.M.; Angulo, F.J.; Tauxe, R.V.; Widdowson, M.A.; Roy, S.L.; Jones, J.L.; Griffin, P.M. Foodborne illness acquired in the United States-Major pathogens. Emerg. Infect. Dis. 2011, 17, 7–15. [Google Scholar] [CrossRef] [PubMed]
- Di Donato, G.; Marotta, F.; Nuvoloni, R.; Zilli, K.; Neri, D.; Di Sabatino, D.; Calistri, P.; Di Giannatale, E. Prevalence, population diversity and antimicrobial resistance of Campylobacter coli isolated in Italian swine at slaughterhouse. Microorganisms 2020, 8, 222. [Google Scholar] [CrossRef]
- Weijtens, M.J.B.M.; Reinders, R.D.; Urlings, H.A.P.; Van Der Plas, J. Campylobacter infections in fattening pigs; Excretion pattern and genetic diversity. J. Appl. Microbiol. 1999, 86, 63–70. [Google Scholar] [CrossRef]
- Thakur, S.; Gebreyes, W.A. Campylobacter coli in swine production: Antimicrobial resistance mechanisms and molecular epidemiology. J. Clin. Microbiol. 2005, 43, 5705–5714. [Google Scholar] [CrossRef]
- Fosse, J.; Seegers, H.; Magras, C. Prevalence and risk factors for bacterial food-borne zoonotic hazards in slaughter pigs: A Review. Zoonoses Public Health 2009, 56, 429–454. [Google Scholar] [CrossRef]
- Tang, Y.; Jiang, Q.; Tang, H.; Wang, Z.; Yin, Y.; Ren, F.; Kong, L.; Jiao, X.; Huang, J. Characterization and Prevalence of Campylobacter spp. from Broiler Chicken Rearing Period to the Slaughtering Process in Eastern China. Front. Vet. Sci. 2020, 7, 227. [Google Scholar] [CrossRef]
- Hakeem Mohammed, J.; Lu, X. Survival and Control of Campylobacter in Poultry Production Environment. Front. Cell. Infect. Microbiol. 2021, 10, 615049. [Google Scholar] [CrossRef]
- Facciolà, A.; Riso, R.; Avventuroso, E.; Visalli, G.; Delia, S.A.; Laganà, P. Campylobacter: From microbiology to prevention. J. Prev. Med. Hyg. 2017, 58, E79–E92. [Google Scholar]
- Carrique-Mas, J.J.; Bryant, J.E.; Cuong, N.V.; Hoang, N.V.; Campbell, J.; Hoang, N.V.; Dung, T.T.; Duy, D.T.; Hoa, N.T.; Thompson, C.; et al. An epidemiological investigation of Campylobacter in pig and poultry farms in the Mekong delta of Vietnam. Epidemiol. Infect. 2014, 142, 1425–1436. [Google Scholar] [CrossRef] [PubMed]
- Holman, D.B.; Chénier, M.R. Impact of subtherapeutic administration of tylosin and chlortetracycline on antimicrobial resistance in farrow-to-finish swine. FEMS Microbiol. Ecol. 2013, 85, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Phillips, I.; Casewell, M.; Cox, T.; De Groot, B.; Friis, C.; Jones, R.; Nightingale, C.; Preston, R.; Waddell, J. Does the use of antibiotics in food animals pose a risk to human health? A critical review of published data. J. Antimicrob. Chemother. 2004, 53, 28–52. [Google Scholar] [CrossRef] [PubMed]
- Apley, M.D.; Bush, E.J.; Morrison, R.B.; Singer, R.S.; Snelson, H. Use estimates of in-feed antimicrobials in swine production in the United States. Foodborne Pathog. Dis. 2012, 9, 272–279. [Google Scholar] [CrossRef] [PubMed]
- Bøsling, J.; Poulsen, S.M.; Vester, B.; Long, K.S. Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein L3. Antimicrob. Agents Chemother. 2003, 47, 2892–2896. [Google Scholar] [CrossRef] [PubMed]
- Lykkeberg, A.K.; Halling-Sørensen, B.; Jensen, L.B. Susceptibility of bacteria isolated from pigs to tiamulin and enrofloxacin metabolites. Vet. Microbiol. 2007, 121, 116–124. [Google Scholar] [CrossRef] [PubMed]
- Sjölund, M.; Backhans, A.; Greko, C.; Emanuelson, U.; Lindberg, A. Antimicrobial usage in 60 Swedish farrow-to-finish pig herds. Prev. Vet. Med. 2015, 121, 257–264. [Google Scholar] [CrossRef] [PubMed]
- Van Rennings, L.; Von Münchhausen, C.; Ottilie, H.; Hartmann, M.; Merle, R.; Honscha, W.; Käsbohrer, A.; Kreienbrock, L. Cross-sectional study on antibiotic usage in pigs in Germany. PLoS ONE 2015, 10, e0119114. [Google Scholar] [CrossRef]
- NAHMS Swine Study. Antimicrobial Use and Stewardship on U.S. Swine Operations. 2017. Available online: https://www.aphis.usda.gov/animal_health/nahms/downloads/amu-feedlots.pdf (accessed on 15 November 2023).
- Varga, C.; Rajić, A.; McFall, M.E.; Reid-Smith, R.J.; McEwen, S.A. Associations Among Antimicrobial Use and Antimicrobial Resistance of Salmonella spp. Isolates from 60 Alberta Finishing Swine Farms. Foodborne Pathog. Dis. 2009, 6, 23–31. [Google Scholar] [CrossRef]
- Lutz, E.A.; McCarty, M.J.; Mollenkopf, D.F.; Funk, J.A.; Gebreyes, W.A.; Wittum, T.E. Ceftiofur use in finishing swine barns and the recovery of fecal Escherichia coli or Salmonella spp. Resistant to ceftriaxone. Foodborne Pathog. Dis. 2011, 8, 1229–1234. [Google Scholar] [CrossRef]
- Burow, E.; Simoneit, C.; Tenhagen, B.A.; Käsbohrer, A. Oral antimicrobials increase antimicrobial resistance in porcine E. coli—A systematic review. Prev. Vet. Med. 2014, 113, 364–375. [Google Scholar] [CrossRef] [PubMed]
- Olah, P.A.; Doetkott, C.; Fakhr, M.K.; Logue, C.M. Prevalence of the Campylobacter multi-drug efflux pump (CmeABC) in Campylobacter spp. Isolated from freshly processed Turkeys. Food Microbiol. 2006, 23, 453–460. [Google Scholar] [CrossRef] [PubMed]
- Yamazaki-Matsune, W.; Taguchi, M.; Seto, K.; Kawahara, R.; Kawatsu, K.; Kumeda, Y.; Kitazato, M.; Nukina, M.; Misawa, N.; Tsukamoto, T. Development of a multiplex PCR assay for identification of Campylobacter coli, Campylobacter fetus, Campylobacter hyointestinalis subsp. hyointestinalis, Campylobacter jejuni, Campylobacter lari and Campylobacter upsaliensis. J. Med. Microbiol. 2007, 56, 1467–1473. [Google Scholar] [CrossRef] [PubMed]
- Linton, D.; Owen, R.J.; Stanley, J. Rapid identification by PCR of the genus Campylobacter and of five Campylobacter species enteropathogenic for man and animals. Res. Microbiol. 1996, 147, 707–718. [Google Scholar] [CrossRef] [PubMed]
- Inglis, G.D.; Kalischuk, L.D. Use of PCR for direct detection of Campylobacter species in bovine feces. Appl. Environ. Microbiol. 2003, 9, 3435–3447. [Google Scholar] [CrossRef]
- Linton, D.; Lawson, A.J.; Owen, R.J.; Stanley, J. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J. Clin. Microbiol. 1997, 35, 2568–2572. [Google Scholar] [CrossRef] [PubMed]
- Hum, S.; Quinn, K.; Brunner, J.; On, S.L. Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies. Aust. Vet. J. 1997, 75, 827–831. [Google Scholar] [CrossRef]
- Wang, G.; Clark, G.C.; Taylor, T.M.; Pucknell, C.; Barton, C.; Price, L.; Woodward, D.L.; Rodgers, F.G. Colony multiplex PCR assay for identification and differentation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J. Clin. Microbiol. 2002, 40, 4744–4747. [Google Scholar] [CrossRef]
- Wang, R.-F.; Slavik, M.F.; Cao, W.-W. A rapid PCR method for the detection of low numbers of Campylobacter jejuni. J. Rapid Methods Autom. Microbiol. 1992, 1, 101–108. [Google Scholar] [CrossRef]
- Abdi-Hachesoo, B.; Khoshbakht, R.; Sharifiyazdi, H.; Tabatabaei, M.; Hosseinzadeh, S.; Asasi, K. Tetracycline resistance genes in Campylobacter jejuni and C. coli isolated from poultry carcasses. Jundishapur J. Microbiol. 2014, 7, 7–11. [Google Scholar] [CrossRef]
- Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [PubMed]
- Garofalo, S.; Giovagnoli, S.; Orsoni, M.; Starita, F.; Benassi, M. Interaction effect: Are you doing the right thing? PLoS ONE 2022, 17, e0271668. [Google Scholar] [CrossRef]
- Anouschka, M.; Bas, K.; Elizabeth, B.J. Early feeding experiences of piglets and their impact on novel environment behaviour and food neophobia. Appl. Anim. Behav. Sci. 2020, 232, 105142. [Google Scholar] [CrossRef]
- Dorr, P.M.; Tadesse, D.A.; Zewde, B.M.; Fry, P.; Thakur, S.; Gebreyes, W.A. Longitudinal study of Salmonella dispersion and the role of environmental contamination in commercial swine production systems. Appl. Environ. Microbiol. 2009, 75, 1478–1486. [Google Scholar] [CrossRef] [PubMed]
- Portes, A.B.; Panzenhagen, P.; Pereira Dos Santos, A.M.; Junior, C.A.C. Antibiotic Resistance in Campylobacter: A Systematic Review of South American Isolates. Antibiotics 2023, 12, 548. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Beyi, A.F.; Yin, Y. Zoonotic and antibiotic-resistant Campylobacter: A view through the One Health lens. One Health Adv. 2023, 1, 4. [Google Scholar] [CrossRef]
- Jennifer, M.N.; Tom, M.C.; John, H.P.; Frederick, J.A. Fluoroquinolone-Resistant Campylobacter Species and the Withdrawal of Fluoroquinolones from Use in Poultry: A Public Health Success Story. Clin. Infect. Dis. 2007, 44, 977–980. [Google Scholar] [CrossRef]
- Thakur, S.; Gebreyes, W.A. Prevalence and antimicrobial resistance of Campylobacter in antimicrobial-free and conventional pig production systems. J. Food Prot. 2005, 68, 2402–2410. [Google Scholar] [CrossRef]
- Rollo, S.N.; Norby, B.; Bartlett, P.C.; Scott, H.M.; Wilson, D.L.; Fajt, V.R.; Linz, J.E.; Bunner, C.E.; Kaneene, J.B.; Huber, J.C. Prevalence and patterns of antimicrobial resistance in Campylobacter spp. isolated from pigs reared under antimicrobial-free and conventional production methods in eight states in the Midwestern United States. J. Am. Vet. Med. Assoc. 2010, 236, 201–210. [Google Scholar] [CrossRef]
- Van Boeckel, T.P.; Brower, C.; Gilbert, M.; Grenfell, B.T.; Levin, S.A.; Robinson, T.P.; Teillant, A.; Laxminarayan, R. Global trends in antimicrobial use in food animals. Proc. Natl. Acad. Sci. USA 2015, 112, 5649–5654. [Google Scholar] [CrossRef]
- Jensen, V.F.; Emborg, H.D.; Aarestrup, F.M. Indications and patterns of therapeutic use of antimicrobial agents in the Danish pig production from 2002 to 2008. J. Vet. Pharmacol. Ther. 2012, 35, 33–46. [Google Scholar] [CrossRef] [PubMed]
- Hlashwayo, D.F.; Sigaúque, B.; Bila, C.G. Epidemiology and antimicrobial resistance of Campylobacter spp. in animals in Sub-Saharan Africa: A systematic review. Heliyon 2020, 6, e03537. [Google Scholar] [CrossRef] [PubMed]
- Quintana-Hayashi, M.P.; Thakur, S. Longitudinal study of the persistence of antimicrobial-resistant Campylobacter strains in distinct Swine production systems on farms, at slaughter, and in the environment. Appl. Environ. Microbiol. 2012, 78, 2698–2705. [Google Scholar] [CrossRef]
- Varela, N.P.; Friendship, R.M.; Dewey, C.E. Prevalence of Campylobacter spp. isolated from grower-finisher pigs in Ontario. Can. Vet. J. 2007, 48, 515–517. [Google Scholar] [PubMed]
- Asai, T.; Harada, K.; Ishihara, K.; Kojima, A.; Sameshima, T.; Tamura, Y.; Takahashi, T. Association of antimicrobial resistance in Campylobacter isolated from food-producing animals with antimicrobial use on farms. Jpn. J. Infect. Dis. 2007, 60, 290–294. [Google Scholar] [PubMed]
- Kempf, I.; Kerouanton, A.; Bougeard, S.; Nagard, B.; Rose, V.; Mourand, G.; Osterberg, J.; Denis, M.; Bengtsson, B.O. Campylobacter coli in organic and conventional pig production in France and Sweden: Prevalence and antimicrobial resistance. Front. Microbiol. 2017, 8, 955. [Google Scholar] [CrossRef] [PubMed]
- Papadopoulos, D.; Petridou, E.; Filioussis, G.; Papadopoulos, T.; Papageorgiou, K.; Chatzistilianou, M.; Kritas, S.K. Prevalence and antibiotic resistance of Campylobacter coli and Campylobacter jejuni in Greek swine farms. Am. J. Microbiol. Immunol. 2020, 5, 6. [Google Scholar] [CrossRef]
- Allos, B.M.; Iovine, N.M.; Blaser, M.J. Campylobacter jejuni and Related Species. Bennett’s Princ. Pract. Infect. Dis. 2015, 2, 2485–2493. [Google Scholar] [CrossRef]
- Gorkiewicz, G.; Feierl, G.; Zechner, R.; Zechner, E.L. Transmission of Campylobacter hyointestinalis from a pig to a human. J. Clin. Microbiol. 2002, 40, 2601–2605. [Google Scholar] [CrossRef]
- Gebreyes, W.A.; Thakur, S.; Morrow, W.E.M. Campylobacter coli: Prevalence and antimicrobial resistance in antimicrobial-free (ABF) swine production systems. J. Antimicrob. Chemother. 2005, 56, 765–768. [Google Scholar] [CrossRef]
- Taylor, D.E.; Courvalin, P. Mechanisms of Antibiotic Resistance in Campylobacter Species. Antimicrob. Agents Chemother. 1988, 32, 1107–1112. [Google Scholar] [CrossRef] [PubMed]
- Juntunen, P.; Laurila, T.; Heinonen, M.; Hänninen, M.L. Absence of tetracycline resistance in Campylobacter coli isolates from Finnish finishing pigs treated with chlortetracycline. J. Appl. Microbiol. 2013, 114, 974–981. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Huang, Y.; Zhou, Y.; Buckley, T.; Wang, H.H. Antibiotic administration routes significantly influence the levels of antibiotic resistance in gut microbiota. Antimicrob. Agents Chemother. 2013, 57, 3659–3666. [Google Scholar] [CrossRef] [PubMed]
- Langdon, A.; Crook, N.; Dantas, G. The effects of antibiotics on the microbiome throughout development and alternative approaches for therapeutic modulation. Genome Med. 2016, 8, 39. [Google Scholar] [CrossRef] [PubMed]
- Zheng, D.; Liwinski, T.; Elinav, E. Interaction between microbiota and immunity in health and disease. Cell Res. 2020, 30, 492–506. [Google Scholar] [CrossRef] [PubMed]
- Gough, E.K. The impact of mass drug administration of antibiotics on the gut microbiota of target populations. Infect. Dis. Poverty 2022, 11, 76. [Google Scholar] [CrossRef] [PubMed]
- Ce, H.; Shengyu, F.; Fengjiao, H.; Hailiang, L. Effects of Four Antibiotics on the Diversity of the Intestinal Microbiota. Microbiol. Spectr. 2022, 10, e01904-21. [Google Scholar] [CrossRef]
- FDA. Food and Drug Administration. CFR—Code of Federal Regulations Title 21. Www.Fda.Gov. 2020. Available online: https://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfCFR/CFRSearch.cfm?fr=170.3&SearchTerm=170.3 (accessed on 15 November 2023).
- Peeters, L.E.J.; Daeseleire, E.; Devreese, M.; Rasschaert, G.; Smet, A.; Dewulf, J.; Heyndrickx, M.; Imberechts, H.; Haesebrouck, F.; Butaye, P.; et al. Residues of chlortetracycline, doxycycline and sulfadiazine-trimethoprim in intestinal content and feces of pigs due to cross-contamination of feed. BMC Vet. Res. 2016, 12, 209. [Google Scholar] [CrossRef]
- Price, G.; Patel, D.A. Drug Bioavailability. In StatPearls [Internet]; StatPearls Publishing: Treasure Island, FL, USA, 2023. [Google Scholar]
- Cybulski, P.; Gajda, A.; Bilecka, M.; Jabłoński, A. Determination of Tiamulin Concentration in Sow Milk and in Sera of Suckling Piglets. Molecules 2023, 28, 6940. [Google Scholar] [CrossRef]
- Burch, D.G.S. Pharmacokinetics Pharmacodynamics of Denagard® and Econor®; and Their Use for Enteric and Respiratory Disease Control in Pigs. 2012. Available online: http://www.octagon-services.co.uk/articles/therapeutics.pdf (accessed on 15 November 2023).
Species | Primer | Target Gene | Sequence (5′ to 3′) | Amplicon Size | Reference |
---|---|---|---|---|---|
Genus Campylobacter | C412F C1228R | 16S rRNA | 5′-GGATGACACTTTTCGGAGC-3′ 5′-CATTGTAGCACGTGTGTC-3′ | 816 | [29] |
C. hyointestinalis subsp. hyointestinalis | HYO1F HYOFET23SR | 23S rRNA | 5′-ATAATCTAGGTGAGAATCCTAG-3′ 5′-GCTTCGCATAGCTAACAT-3′ | 611 | [30] |
C. coli | CC18F CC519R | askD | 5′-GGTATGATTTCTACAAAGCGAG-3′ 5′-ATAAAAGACTATCGTCGCGTG-3′ | 502 | [31] |
C. fetus | MG3F CF359R | cstA | 5′-GGTAGCCGCAGCTGCTAAGAT-3′ 5′-AGCCAGTAACGCATATTATAGTAG-3′ | 359 | [32] |
C. lari | CLF CLR | glyA | 5′-TAGAGAGATAGCAAAAGAGA-3′ 5′-TACACATAATAATCCCACCC-3′ | 251 | [33] |
C. jejuni | C-1 C-3 | cj0414 | 5′-CAAATAAAGTTAGAGGTAGAATGT-3′ 5′-CCATAAGCACTAGCTAGCTGAT-3′ | 161 | [34] |
C. upsaliensis | CU61F CU146R | lpxA | 5′-CGATGATGTGCAAATTGAAGC-3′ 5′-TTCTAGCCCCTTGCTTGATG-3′ | 86 | [28] |
Primer | Target Gene | Sequence (5′ to 3′) | Amplicon (bp) | Reference |
---|---|---|---|---|
tetA-F | tet(A) | GTGAAACCCAACATACCCC | 888 | [35,36] |
tetA-R | GAAGGCAAGCAGGATGTAG | |||
tetB-F | tet(B) | CCTTATCATGCCAGTCTTGC | 774 | [35,36] |
tetB-R | ACTGCCGTTTTTTCGCC | |||
tetS-F | tet(S) | CATAGACAAGCCGTTGACC | 667 | [35,36] |
tetS-R | ATG TTT TTG GAA CGC CAG AG | |||
tetO-F tetO-R | tet(O) | AACTTAGGCATTCTGGCTCAC TCCCACTGTTCCATATCGTCA | 515 | [35,36] |
Treatment Groups | Treatment Phases | ||||||
---|---|---|---|---|---|---|---|
Pre-Treatment | Treatment | Post-Treatment | Treatment Total (%) | ||||
Week 1 | Week 2 | Week 3 | Week 4 | Week 5 | Week 6 | ||
Control | 1 | 2 | 8 | 9 | 15 | 13 | 49 (20.4) |
In-feed CTC | 0 | 5 | 6 | 12 | 11 | 18 | 52 (21.7) |
In-water CTC | 2 | 3 | 4 | 3 | 12 | 14 | 37 (15.4) |
In-feed Tiamulin | 0 | 1 | 5 | 11 | 19 | 17 | 53 (22.1) |
In-water Tiamulin | 0 | 2 | 3 | 2 | 14 | 13 | 34 (14.2) |
In-Feed CTC + Tiamulin | 0 | 3 | 5 | 7 | 13 | 9 | 37 (15.4) |
Weekly Total (%) | 3 (1.3) | 16 (6.7) | 31 (12.9) | 44 (18.3) | 84 (35.0) | 84 (35.0) | |
Total (%) | 19 (4.0) | 75 (15.6) | 168 (35) | 262 (18.2) |
Comparison to Control | |||
---|---|---|---|
Endpoint | Treatment | Prevalence +/− S.E. | Odds Ratio (p-Value for Testing Odds Ratio = 1) |
Campylobacter | Control | 0.274 +/− 0.048 | - |
(n = 262) | In-feed CTC | 0.273 +/− 0.049 | 0.99 (0.987) |
In-water CTC | 0.172 +/− 0.04 | 0.55 (0.105) | |
In-feed Tiamulin | 0.306 +/− 0.052 | 1.16 (0.655) | |
In-water Tiamulin | 0.153 +/− 0.04 | 0.48 (0.057) | |
In-feed CTC + Tiamulin | 0.199 +/− 0.041 | 0.66 (0.235) | |
C. hyointestinalis | Control | 0.275 +/− 0.047 | - |
(n = 258) | In-feed CTC | 0.268 +/− 0.049 | 0.97 (0.923) |
In-water CTC | 0.174 +/− 0.04 | 0.56 (0.109) | |
In-feed Tiamulin | 0.308 +/− 0.052 | 1.17 (0.639) | |
In-water Tiamulin | 0.153 +/− 0.04 | 0.48 (0.056) | |
In-feed CTC + Tiamulin | 0.198 +/− 0.041 | 0.65 (0.221) |
Endpoint | Treatment | Sampling Day | Prevalence +/− S.E. | Odds Ratio (p-Value for Testing Odds Ratio = 1) Comparison to | ||
---|---|---|---|---|---|---|
Day 14 | Day 21 | Day 28 | ||||
Campylobacter | Control | Day 14 | 0.198 +/− 0.068 | 0.86 (0.784) | 0.41 (0.086) | 0.52 (0.205) |
(n = 262) | Day 21 | 0.223 +/− 0.071 | -- | 0.48 (0.144) | 0.60 (0.316) | |
Day 28 | 0.375 +/− 0.085 | -- | -- | 1.25 (0.637) | ||
Day 35 | 0.324 +/− 0.082 | -- | -- | -- | ||
In-feed CTC | Day 14 | 0.143 +/− 0.058 | 0.41 (0.111) | 0.46 (0.173) | 0.21 (0.004) | |
Day 21 | 0.292 +/− 0.08 | -- | 1.13 (0.803) | 0.52 (0.164) | ||
Day 28 | 0.267 +/− 0.077 | -- | -- | 0.46 (0.103) | ||
Day 35 | 0.444 +/− 0.089 | -- | -- | -- | ||
In-water CTC | Day 14 | 0.097 +/− 0.048 | 1.37 (0.692) | 0.26 (0.031) | 0.20 (0.011) | |
Day 21 | 0.073 +/− 0.042 | -- | 0.19 (0.016) | 0.15 (0.005) | ||
Day 28 | 0.296 +/− 0.079 | -- | -- | 0.79 (0.630) | ||
Day 35 | 0.347 +/− 0.083 | -- | -- | -- | ||
In-feed Tiamulin | Day 14 | 0.125 +/− 0.055 | 0.37 (0.100) | 0.16 (0.001) | 0.19 (0.004) | |
Day 21 | 0.276 +/− 0.078 | -- | 0.42 (0.066) | 0.51 (0.160) | ||
Day 28 | 0.479 +/− 0.089 | -- | -- | 1.23 (0.651) | ||
Day 35 | 0.428 +/− 0.088 | -- | -- | -- | ||
In-water Tiamulin | Day 14 | 0.074 +/− 0.043 | 1.54 (0.646) | 0.15 (0.006) | 0.17 (0.009) | |
Day 21 | 0.049 +/− 0.035 | -- | 0.10 (0.003) | 0.11 (0.005) | ||
Day 28 | 0.35 +/− 0.084 | -- | -- | 1.12 (0.812) | ||
Day 35 | 0.324 +/− 0.082 | -- | -- | -- | ||
In-feed CTC + Tiamulin | Day 14 | 0.122 +/− 0.054 | 0.67 (0.531) | 0.29 (0.037) | 0.49 (0.242) | |
Day 21 | 0.171 +/− 0.063 | -- | 0.44 (0.123) | 0.73 (0.575) | ||
Day 28 | 0.322 +/− 0.082 | -- | -- | 1.67 (0.315) | ||
Day 35 | 0.221 +/− 0.071 | -- | -- | -- | ||
C. hyointestinalis | Control | Day 14 | 0.199 +/− 0.068 | 0.86 (0.784) | 0.41 (0.086) | 0.52 (0.205) |
(n = 258) | Day 21 | 0.224 +/− 0.071 | -- | 0.48 (0.144) | 0.60 (0.316) | |
Day 28 | 0.375 +/− 0.085 | -- | -- | 1.25 (0.638) | ||
Day 35 | 0.325 +/− 0.082 | -- | -- | -- | ||
In-feed CTC | Day 14 | 0.14 +/− 0.057 | 0.40 (0.110) | 0.46 (0.173) | 0.21 (0.004) | |
Day 21 | 0.287 +/− 0.079 | -- | 1.13 (0.803) | 0.52 (0.163) | ||
Day 28 | 0.262 +/− 0.076 | -- | -- | 0.46 (0.102) | ||
Day 35 | 0.438 +/− 0.089 | -- | -- | -- | ||
In-water CTC | Day 14 | 0.098 +/− 0.049 | 1.37 (0.692) | 0.26 (0.031) | 0.20 (0.011) | |
Day 21 | 0.073 +/− 0.042 | -- | 0.19 (0.016) | 0.15 (0.005) | ||
Day 28 | 0.299 +/− 0.08 | -- | -- | 0.79 (0.631) | ||
Day 35 | 0.349 +/− 0.084 | -- | -- | -- | ||
In-feed Tiamulin | Day 14 | 0.126 +/− 0.056 | 0.37 (0.100) | 0.16 (0.001) | 0.19 (0.004) | |
Day 21 | 0.278 +/− 0.078 | -- | 0.42 (0.066) | 0.51 (0.160) | ||
Day 28 | 0.481 +/− 0.088 | -- | -- | 1.23 (0.651) | ||
Day 35 | 0.431 +/− 0.088 | -- | -- | -- | ||
In-water Tiamulin | Day 14 | 0.074 +/− 0.043 | 1.54 (0.646) | 0.15 (0.006) | 0.17 (0.009) | |
Day 21 | 0.049 +/− 0.035 | -- | 0.10 (0.003) | 0.11 (0.005) | ||
Day 28 | 0.35 +/− 0.083 | -- | -- | 1.12 (0.812) | ||
Day 35 | 0.325 +/− 0.082 | -- | -- | -- | ||
In-feed CTC + Tiamulin | Day 14 | 0.121 +/− 0.054 | 0.67 (0.531) | 0.29 (0.037) | 0.49 (0.242) | |
Day 21 | 0.17 +/− 0.063 | -- | 0.44 (0.123) | 0.73 (0.574) | ||
Day 28 | 0.32 +/− 0.081 | -- | -- | 1.67 (0.315) | ||
Day 35 | 0.199 +/− 0.068 | 0.86 (0.784) | 0.41 (0.086) | 0.52 (0.205) |
Antimicrobials | Resistant Breakpoints | % Resistant | 0.015 | 0.03 | 0.06 | 0.12 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | 32 | 64 | 128 | 256 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Azithromycin | ≥1 | 5 | 11 | 13 | 197 | 23 | 3 | 3 | 0 | 1 | 2 | 3 | 2 | 1 | 3 | ||
Ciprofloxacin | ≥1 | 89.3 | 1 | 0 | 11 | 10 | 6 | 2 | 4 | 8 | 204 | 16 | |||||
Clindamycin | ≥2 | 3.1 | 28 | 10 | 44 | 163 | 4 | 5 | 1 | 1 | 3 | 3 | |||||
Erythromycin | ≥16 | 3.4 | 22 | 10 | 9 | 39 | 153 | 16 | 4 | 1 | 1 | 1 | 1 | 4 | |||
Florfenicol | ≥8 | 1.2 | 1 | 18 | 213 | 22 | 4 | 1 | 1 | 1 | 1 | ||||||
Gentamicin | ≥4 | 8 | 28 | 9 | 25 | 109 | 70 | 4 | 2 | 1 | 1 | ||||||
Nalidixic Acid | ≥32 | 60.3 | 5 | 99 | 86 | 72 | |||||||||||
Telithromycin | ≥8 | 1.9 | 26 | 4 | 7 | 1 | 8 | 152 | 52 | 7 | 1 | 4 | |||||
Tetracycline | ≥4 | 98.5 | 1 | 1 | 1 | 1 | 4 | 14 | 75 | 86 | 79 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ishengoma, V.L.; Amachawadi, R.G.; Tokach, M.D.; Shi, X.; Kang, Q.; Goodband, R.D.; DeRouchey, J.; Woodworth, J.; Nagaraja, T.G. Impact of In-Feed versus In-Water Chlortetracycline and Tiamulin Administrations on Fecal Prevalence and Antimicrobial Susceptibilities of Campylobacter in a Population of Nursery Pigs. Microorganisms 2023, 11, 2876. https://doi.org/10.3390/microorganisms11122876
Ishengoma VL, Amachawadi RG, Tokach MD, Shi X, Kang Q, Goodband RD, DeRouchey J, Woodworth J, Nagaraja TG. Impact of In-Feed versus In-Water Chlortetracycline and Tiamulin Administrations on Fecal Prevalence and Antimicrobial Susceptibilities of Campylobacter in a Population of Nursery Pigs. Microorganisms. 2023; 11(12):2876. https://doi.org/10.3390/microorganisms11122876
Chicago/Turabian StyleIshengoma, Victor L., Raghavendra G. Amachawadi, Mike D. Tokach, Xiaorong Shi, Qing Kang, Robert D. Goodband, Joel DeRouchey, Jason Woodworth, and Tiruvoor G. Nagaraja. 2023. "Impact of In-Feed versus In-Water Chlortetracycline and Tiamulin Administrations on Fecal Prevalence and Antimicrobial Susceptibilities of Campylobacter in a Population of Nursery Pigs" Microorganisms 11, no. 12: 2876. https://doi.org/10.3390/microorganisms11122876