Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia
Abstract
:1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Nia, Y.; Mutel, I.; Assere, A.; Lombard, B.; Auvray, F.; Hennekinne, J.-A. Review Over a 3-Year Period of European Union Proficiency Tests for Detection of Staphylococcal Enterotoxins in Food Matrices. Toxins 2016, 8, 107. [Google Scholar] [CrossRef] [PubMed]
- Rajkovic, A.; Jovanovic, J.; Monteiro, S.; Decleer, M.; Andjelkovic, M.; Foubert, A.; Beloglazova, N.; Tsilla, V.; Sas, B.; Madder, A.; et al. Detection of toxins involved in foodborne diseases caused by Gram-positive bacteria. Compr. Rev. Food Sci. Food Saf. 2020, 19, 1605–1657. [Google Scholar] [CrossRef] [PubMed]
- De Buyser, M.-L.; Dufour, B.; Maire, M.; Lafarge, V. Implication of milk and milk products in food-borne diseases in France and in different industrialised countries. Int. J. Food Microbiol. 2001, 67, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Delmas, G.; Gallay, A.; Espié, E.; Haeghebaert, S.; Pihier, N.; Weill, F.X.; De Valk, H.; Vaillant, V.; Desenclos, J.C. Les toxi-infections alimentaires collectives en France entre 1996 et 2005. Bull. Epidemiol. Hebd. 2006, 51–52, 418–422. [Google Scholar]
- Gajewska, J.; Zakrzewski, A.; Chajęcka-Wierzchowska, W.; Zadernowska, A. Meta-analysis of the global occurrence of S. aureus in raw cattle milk and artisanal cheeses. Food Control 2023, 147, 109603. [Google Scholar] [CrossRef]
- Cenci-Goga, B.T.; Karama, M.; Rossitto, P.V.; Morgante, R.A.; Cullor, J.S. Enterotoxin Production by Staphylococcus aureus Isolated from Mastitic Cows. J. Food Prot. 2003, 66, 1693–1696. [Google Scholar] [CrossRef] [PubMed]
- Grispoldi, L.; Karama, M.; Armani, A.; Hadjicharalambous, C.; Cenci-Goga, B.T. Staphylococcus aureus enterotoxin in food of animal origin and staphylococcal food poisoning risk assessment from farm to table. Ital. J. Anim. Sci. 2021, 20, 677–690. [Google Scholar] [CrossRef]
- Grispoldi, L.; Karama, M.; Ianni, F.; La Mantia, A.; Pucciarini, L.; Camaioni, E.; Sardella, R.; Sechi, P.; Natalini, B.; Cenci-Goga, B.T. The Relationship between S. aureus and Branched-Chain Amino Acids Content in Composite Cow Milk. Animals 2019, 9, 981. [Google Scholar] [CrossRef]
- Wan, Y.; Yang, L.; Li, Q.; Wang, X.; Zhou, T.; Chen, D.; Li, L.; Wang, Y.; Wang, X. Stability and emetic activity of enterotoxin like X (SElX) with high carrier rate of food poisoning Staphylococcus aureus. Int. J. Food Microbiol. 2023, 404, 110352. [Google Scholar] [CrossRef]
- Hu, D.-L.; Wang, L.; Fang, R.; Okamura, M.; Ono, H.K. Chapter 3—Staphylococcus aureus Enterotoxins. In Staphylococcus aureus; Fetsch, A., Ed.; Academic Press: New York, NY, USA, 2018; pp. 39–55. [Google Scholar]
- Balaban, N.; Rasooly, A. Staphylococcal enterotoxins. Int. J. Food Microbiol. 2000, 61, 1–10. [Google Scholar] [CrossRef]
- Ostyn, A.; De Buyser, M.L.; Guillier, F.; Groult, J.; Félix, B.; Salah, S.; Delmas, G.; Hennekinne, J.A. First evidence of a food poisoning outbreak due to staphylococcal enterotoxin type E, France, 2009. Eurosurveillance 2010, 15, 19528. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Zhang, Y.; Ruan, F.; Chang, G.; Lü, Z.; Tian, L.; Ji, H.; Zhou, T.; Wang, X. Genotypic diversity of staphylococcal enterotoxin B gene (seb) and its association with molecular characterization and antimicrobial resistance of Staphylococcus aureus from retail food. Int. J. Food Microbiol. 2024, 408, 110444. [Google Scholar] [CrossRef] [PubMed]
- Argudín, M.Á.; Mendoza, M.C.; Rodicio, M.R. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2010, 2, 1751–1773. [Google Scholar] [CrossRef] [PubMed]
- Chao, G.; Bao, G.; Cao, Y.; Yan, W.; Wang, Y.; Zhang, X.; Zhou, L.; Wu, Y. Prevalence and diversity of enterotoxin genes with genetic background of Staphylococcus aureus isolates from different origins in China. Int. J. Food Microbiol. 2015, 211, 142–147. [Google Scholar] [CrossRef] [PubMed]
- Kérouanton, A.; Hennekinne, J.A.; Letertre, C.; Petit, L.; Chesneau, O.; Brisabois, A.; De Buyser, M.L. Characterization of Staphylococcus aureus strains associated with food poisoning outbreaks in France. Int. J. Food Microbiol. 2007, 115, 369–375. [Google Scholar] [CrossRef] [PubMed]
- Omoe, K.; Hu, D.-L.; Takahashi-Omoe, H.; Nakane, A.; Shinagawa, K. Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiol. Lett. 2005, 246, 191–198. [Google Scholar] [CrossRef] [PubMed]
- Sato’o, Y.; Omoe, K.; Naito, I.; Ono, H.K.; Nakane, A.; Sugai, M.; Yamagishi, N.; Hu, D.-L. Molecular Epidemiology and Identification of a Staphylococcus aureus Clone Causing Food Poisoning Outbreaks in Japan. J. Clin. Microbiol. 2014, 52, 2637–2640. [Google Scholar] [CrossRef] [PubMed]
- Pineda, A.P.A.; Cueva, C.L.R.; Chacón, R.D.; Ramírez, M.; de Almeida, O.G.G.; de Oliveira, D.P.; Franco, B.D.G.M.; Lacorte, G.; Landgraf, M.; Silva, N.C.C.; et al. Genomic characterization of Staphylococcus aureus from Canastra Minas Artisanal Cheeses. Braz. J. Microbiol. 2023, 54, 2103–2116. [Google Scholar] [CrossRef]
- Carfora, V.; Caprioli, A.; Marri, N.; Sagrafoli, D.; Boselli, C.; Giacinti, G.; Giangolini, G.; Sorbara, L.; Dottarelli, S.; Battisti, A.; et al. Enterotoxin genes, enterotoxin production, and methicillin resistance in Staphylococcus aureus isolated from milk and dairy products in Central Italy. Int. Dairy J. 2015, 42, 12–15. [Google Scholar] [CrossRef]
- Cremonesi, P.; Perez, G.; Pisoni, G.; Moroni, P.; Morandi, S.; Luzzana, M.; Brasca, M.; Castiglioni, B. Detection of enterotoxigenic Staphylococcus aureus isolates in raw milk cheese. Lett. Appl. Microbiol. 2007, 45, 586–591. [Google Scholar] [CrossRef]
- Morandi, S.; Brasca, M.; Lodi, R.; Cremonesi, P.; Castiglioni, B. Detection of classical enterotoxins and identification of enterotoxin genes in Staphylococcus aureus from milk and dairy products. Vet. Microbiol. 2007, 124, 66–72. [Google Scholar] [CrossRef] [PubMed]
- Normanno, G.; La Salandra, G.; Dambrosio, A.; Quaglia, N.C.; Corrente, M.; Parisi, A.; Santagada, G.; Firinu, A.; Crisetti, E.; Celano, G.V. Occurrence, characterization and antimicrobial resistance of enterotoxigenic Staphylococcus aureus isolated from meat and dairy products. Int. J. Food Microbiol. 2007, 115, 290–296. [Google Scholar] [CrossRef] [PubMed]
- Rola, J.G.; Czubkowska, A.; Korpysa-Dzirba, W.; Osek, J. Occurrence of Staphylococcus aureus on Farms with Small Scale Production of Raw Milk Cheeses in Poland. Toxins 2016, 8, 62. [Google Scholar] [CrossRef] [PubMed]
- Akineden, Ö.; Hassan, A.A.; Schneider, E.; Usleber, E. Enterotoxigenic properties of Staphylococcus aureus isolated from goats’ milk cheese. Int. J. Food Microbiol. 2008, 124, 211–216. [Google Scholar] [CrossRef] [PubMed]
- Basanisi, M.G.; Nobili, G.; La Bella, G.; Russo, R.; Spano, G.; Normanno, G.; La Salandra, G. Molecular characterization of Staphylococcus aureus isolated from sheep and goat cheeses in southern Italy. Small Rumin. Res. 2016, 135, 17–19. [Google Scholar] [CrossRef]
- Cavicchioli, V.Q.; Scatamburlo, T.M.; Yamazi, A.K.; Pieri, F.A.; Nero, L.A. Occurrence of Salmonella, Listeria monocytogenes, and enterotoxigenic Staphylococcus in goat milk from small and medium-sized farms located in Minas Gerais State, Brazil. J. Dairy Sci. 2015, 98, 8386–8390. [Google Scholar] [CrossRef] [PubMed]
- De Buyser, M.L.; Dilasser, F.; Hummel, R.; Bergdoll, M.S. Enterotoxin and toxic shock syndrome toxin-1 production by staphylococci isolated from goat’s milk. Int. J. Food Microbiol. 1987, 5, 301–309. [Google Scholar] [CrossRef]
- Gonano, M.; Hein, I.; Zangerl, P.; Rammelmayr, A.; Wagner, M. Phenotypic and molecular characterization of Staphylococcus aureus strains of veterinary, dairy and human origin. Epidemiol. Infect. 2009, 137, 688–699. [Google Scholar] [CrossRef]
- Hàjek, V. Identification of enterotoxigenic staphylococci from sheep and sheep cheese. Appl. Environ. Microbiol. 1978, 35, 264–268. [Google Scholar] [CrossRef]
- Jørgensen, H.J.; Mørk, T.; Høgåsen, H.R.; Rørvik, L.M. Enterotoxigenic Staphylococcus aureus in bulk milk in Norway. J. Appl. Microbiol. 2005, 99, 158–166. [Google Scholar] [CrossRef]
- Katsuda, K.; Hata, E.; Kobayashi, H.; Kohmoto, M.; Kawashima, K.; Tsunemitsu, H.; Eguchi, M. Molecular typing of Staphylococcus aureus isolated from bovine mastitic milk on the basis of toxin genes and coagulase gene polymorphisms. Vet. Microbiol. 2005, 105, 301–305. [Google Scholar] [CrossRef] [PubMed]
- Kav, K.; Col, R.; Ardic, M. Characterization of Staphylococcus aureus isolates from white-brined Urfa cheese. J. Food Prot. 2011, 74, 1788–1796. [Google Scholar] [CrossRef] [PubMed]
- Lamprell, H.; Villard, L.; Chamba, J.F.; Beuvier, E.; Borges, E.; Maurin, F.; Mazerolles, G.; Noel, Y.; Kodjo, A. Identification and biotyping of coagulase positive staphylococci (CPS) in ripened French raw milk cheeses and their in vitro ability to produce enterotoxins. Rev. Med. Vet. 2004, 155, 92–96. [Google Scholar]
- Loncarevic, S.; Jørgensen, H.J.; Løvseth, A.; Mathisen, T.; Rørvik, L.M. Diversity of Staphylococcus aureus enterotoxin types within single samples of raw milk and raw milk products. J. Appl. Microbiol. 2005, 98, 344–350. [Google Scholar] [CrossRef] [PubMed]
- Normanno, G.; Firinu, A.; Virgilio, S.; Mula, G.; Dambrosio, A.; Poggiu, A.; Decastelli, L.; Mioni, R.; Scuota, S.; Bolzoni, G.; et al. Coagulase-positive Staphylococci and Staphylococcus aureus in food products marketed in Italy. Int. J. Food Microbiol. 2005, 98, 73–79. [Google Scholar] [CrossRef] [PubMed]
- Ostyn, A.; De Buyser, M.L.; Guillier, F.; Krys, S.; Hennekinne, J.A. Benefits of the Combined Use of Immunological- and PCR-Based Methods for Determination of Staphylococcal Enterotoxin Food Safety Criteria in Cheeses. Food Anal. Methods 2012, 5, 173–178. [Google Scholar] [CrossRef]
- Pelisser, M.R.; Klein, C.S.; Ascoli, K.R.; Zotti, T.R.; Arisi, A.C. Ocurrence of Staphylococcus aureus and multiplex pcr detection of classic enterotoxin genes in cheese and meat products. Braz. J. Microbiol. Publ. Braz. Soc. Microbiol. 2009, 40, 145–148. [Google Scholar] [CrossRef]
- Rall, V.L.M.; Vieira, F.P.; Rall, R.; Vieitis, R.L.; Fernandes, A.; Candeias, J.M.G.; Cardoso, K.F.G.; Araújo, J.P. PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk. Vet. Microbiol. 2008, 132, 408–413. [Google Scholar] [CrossRef]
- Scherrer, D.; Corti, S.; Muehlherr, J.E.; Zweifel, C.; Stephan, R. Phenotypic and genotypic characteristics of Staphylococcus aureus isolates from raw bulk-tank milk samples of goats and sheep. Vet. Microbiol. 2004, 101, 101–107. [Google Scholar] [CrossRef]
- Valle, J.; Gomez-Lucia, E.; Piriz, S.; Goyache, J.; Orden, J.A.; Vadillo, S. Enterotoxin production by staphylococci isolated from healthy goats. Appl. Environ. Microbiol. 1990, 56, 1323–1326. [Google Scholar] [CrossRef]
- Bianchi, D.M.; Gallina, S.; Bellio, A.; Chiesa, F.; Civera, T.; Decastelli, L. Enterotoxin gene profiles of Staphylococcus aureus isolated from milk and dairy products in Italy. Lett. Appl. Microbiol. 2014, 58, 190–196. [Google Scholar] [CrossRef] [PubMed]
- Hummerjohann, J.; Naskova, J.; Baumgartner, A.; Graber, H.U. Enterotoxin-producing Staphylococcus aureus genotype B as a major contaminant in Swiss raw milk cheese. J. Dairy Sci. 2014, 97, 1305–1312. [Google Scholar] [CrossRef] [PubMed]
- Johler, S.; Macori, G.; Bellio, A.; Acutis, P.L.; Gallina, S.; Decastelli, L. Short communication: Characterization of Staphylococcus aureus isolated along the raw milk cheese production process in artisan dairies in Italy. J. Dairy Sci. 2018, 101, 2915–2920. [Google Scholar] [CrossRef] [PubMed]
- Poli, A.; Guglielmini, E.; Sembeni, S.; Spiazzi, M.; Dellaglio, F.; Rossi, F.; Torriani, S. Detection of Staphylococcus aureus and enterotoxin genotype diversity in Monte Veronese, a Protected Designation of Origin Italian cheese. Lett. Appl. Microbiol. 2007, 45, 529–534. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Wang, J.; Jin, J.; Li, X.; Zhang, H.; Shi, X.; Zhao, C. Prevalence, antibiotic resistance, and enterotoxin genes of Staphylococcus aureus isolated from milk and dairy products worldwide: A systematic review and meta-analysis. Food Res. Int. 2022, 162, 111969. [Google Scholar] [CrossRef] [PubMed]
- Hennekinne, J.A.; De Buyser, M.L.; Dragacci, S. Staphylococcus aureus and its food poisoning toxins: Characterization and outbreak investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [PubMed]
- Asao, T.; Kumeda, Y.; Kawai, T.; Shibata, T.; Oda, H.; Haruki, K.; Nakazawa, H.; Kozaki, S. An extensive outbreak of staphylococcal food poisoning due to low-fat milk in Japan: Estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiol. Infect. 2003, 130, 33–40. [Google Scholar] [CrossRef] [PubMed]
- Notermans, S.; Dormans, J.A.M.A.; Mead, G.C. Contribution of surface attachment to the establishment of micro-organisms in food processing plants: A review. Biofouling 1991, 5, 21–36. [Google Scholar] [CrossRef]
- Ljevaković-Musladin, I.; Lakić, M.; Levak, S.; Kozačinski, L. Microbiological Quality of Domestic Cheese in Dubrovnik Croatia Region. In Prooceedings of the Hygiena Alimentorum XXXVII, Safety and Quality of Dairy and Vegetable Commodities, Štrbské pleso, Slovakia, 18–20 May 2016; pp. 228–233. [Google Scholar]
- EN ISO 6888-1:2021; C.S. Mikrobiologija u Lancu Hrane—Horizontalna Metoda Određivanja Broja Koagulaza-Pozitivnih Stafilokoka (Staphylococcus aureus i Ostale Vrste)—1. Dio: Postupak Primjene Baird-Parker Agara. Croatian Standards Institute: Zagreb, Croatia, 2021.
- (EUCAST) European Committee on Antimicrobial Susceptibility Testing. Disk Diffusion Method for Antimicrobial Susceptibility Testing Manual, Version 8.0. Available online: https://www.eucast.org (accessed on 18 September 2020).
- (EUCAST) European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 13.1. Available online: https://www.eucast.org (accessed on 18 October 2023).
- Nakayama, A.; Okayama, A.; Hashida, M.; Yamamoto, Y.; Takebe, H.; Ohnaka, T.; Tanaka, T.; Imai, S. Development of a routine laboratory direct detection system of staphylococcal enterotoxin genes. J. Med. Microbiol. 2006, 55, 273–277. [Google Scholar] [CrossRef]
- Salasia, S.I.; Khusnan, Z.; Lammler, C.; Zschock, M. Comparative studies on pheno- and genotypic properties of Staphylococcus aureus isolated from bovine subclinical mastitis in central Java in Indonesia and Hesse in Germany. J. Vet. Sci. 2004, 5, 103–109. [Google Scholar] [CrossRef]
- Jaki Taklec, V. Detection of Genes Encoding Virulence Factors and mecA Gene in Staphylococcus aureus Field Strains Isolated from Mastitic Cows; University of Zagreb: Zagreb, Croatia, 2013. [Google Scholar]
- Stephan, R.; Annemüller, C.; Hassan, A.A.; Lämmler, C. Characterization of enterotoxigenic Staphylococcus aureus strains isolated from bovine mastitis in north-east Switzerland. Vet. Microbiol. 2001, 78, 373–382. [Google Scholar] [CrossRef] [PubMed]
- Jørgensen, H.J.; Mørk, T.; Rørvik, L.M. The Occurrence of Staphylococcus aureus on a Farm with Small-Scale Production of Raw Milk Cheese. J. Dairy Sci. 2005, 88, 3810–3817. [Google Scholar] [CrossRef] [PubMed]
- Hájek, V.; Marsálek, E. A study of staphylococci of bovine origin Staphylococcus aureus var. bovis. Zentralblatt Bakteriol. Parasitenkd. Infekt. Hyg. 1969, 209, 154–160. [Google Scholar]
- André, M.C.D.P.B.; Campos, M.R.H.; Borges, L.J.; Kipnis, A.; Pimenta, F.C.; Serafini, Á.B. Comparison of Staphylococcus aureus isolates from food handlers, raw bovine milk and Minas Frescal cheese by antibiogram and pulsed-field gel electrophoresis following SmaI digestion. Food Control 2008, 19, 200–207. [Google Scholar] [CrossRef]
- Grispoldi, L.; Massetti, L.; Sechi, P.; Iulietto, M.F.; Ceccarelli, M.; Karama, M.; Popescu, P.A.; Pandolfi, F.; Cenci-Goga, B.T. Short communication: Characterization of enterotoxin-producing Staphylococcus aureus isolated from mastitic cows. J. Dairy Sci. 2019, 102, 1059–1065. [Google Scholar] [CrossRef] [PubMed]
- Papadopoulos, P.; Papadopoulos, T.; Angelidis, A.S.; Kotzamanidis, C.; Zdragas, A.; Papa, A.; Filioussis, G.; Sergelidis, D. Prevalence, antimicrobial susceptibility and characterization of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus isolated from dairy industries in north-central and north-eastern Greece. Int. J. Food Microbiol. 2019, 291, 35–41. [Google Scholar] [CrossRef] [PubMed]
- Hunt, K.; Schelin, J.; Rådström, P.; Butler, F.; Jordan, K. Classical enterotoxins of coagulase-positive Staphylococcus aureus isolates from raw milk and products for raw milk cheese production in Ireland. Dairy Sci. Technol. 2012, 92, 487–499. [Google Scholar] [CrossRef]
- Shalaby, M.; Reboud, J.; Forde, T.; Zadoks, R.N.; Busin, V. Distribution and prevalence of enterotoxigenic Staphylococcus aureus and staphylococcal enterotoxins in raw ruminants’ milk: A systematic review. Food Microbiol. 2024, 118, 104405. [Google Scholar] [CrossRef]
- Morandi, S.; Brasca, M.; Andrighetto, C.; Lombardi, A.; Lodi, R. Phenotypic and Genotypic Characterization of Staphylococcus aureus Strains from Italian Dairy Products. Int. J. Microbiol. 2009, 2009, 501362. [Google Scholar] [CrossRef]
- Ertas, N.; Gonulalan, Z.; Yildirim, Y.; Kum, E. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique. Int. J. Food Microbiol. 2010, 142, 74–77. [Google Scholar] [CrossRef]
- Rosec, J.P.; Gigaud, O. Staphylococcal enterotoxin genes of classical and new types detected by PCR in France. Int. J. Food Microbiol. 2002, 77, 61–70. [Google Scholar] [CrossRef]
- Rosec, J.P.; Guiraud, J.P.; Dalet, C.; Richard, N. Enterotoxin production by staphylococci isolated from foods in France. Int. J. Food Microbiol. 1997, 35, 213–221. [Google Scholar] [CrossRef]
- Tamarapu, S.; McKillip, J.L.; Drake, M. Development of a Multiplex Polymerase Chain Reaction Assay for Detection and Differentiation of Staphylococcus aureus in Dairy Products. J. Food Prot. 2001, 64, 664–668. [Google Scholar] [CrossRef]
- Fueyo, J.M.; Martín, M.C.; González-Hevia, M.A.; Mendoza, M.C. Enterotoxin production and DNA fingerprinting in Staphylococcus aureus isolated from human and food samples. Relations between genetic types and enterotoxins. Int. J. Food Microbiol. 2001, 67, 139–145. [Google Scholar] [CrossRef]
- Borelli, B.M.; Ferreira, E.G.; Lacerda, I.C.A.; Santos, D.A.; Carmo, L.S.; Dias, R.S.; Silva, M.C.C. Enteroxigenic Staphylococcus spp. and other microbial contaminants during production of Canastra cheese. Brazil. Braz. J. Microbiol. 2006, 37, 545–550. [Google Scholar] [CrossRef]
- Holecková, B.; Holoda, E.; Fotta, M.; Kalinácova, V.; Gondol, J.; Grolmus, J. Occurrence of enterotoxigenic Staphylococcus aureus in food. Ann. Agric. Environ. Med. AAEM 2002, 9, 179–182. [Google Scholar] [PubMed]
Gene | Primer/Probe | Oligonucleotide Sequence (5′-3′) [54] | Position * | GenBank Accession no. |
---|---|---|---|---|
sea | eta-F | TTTGGAAACGGTTAAAACGAATAAG | 489–513 | M18970 |
eta-R | TTTCCTGTAAATAACGTCTTGCTTGA | 543–568 | ||
eta-T | FAM-CTGTTCAGGAGTTGGATC-MGB | 524–541 | ||
seb | etb-F | AGGTGACTGCTCAAGAATTAGATTACC | 785–811 | M11118 |
etb-R | AAGGCGAGTTGTTAAATTCATAGAGTT | 842–868 | ||
etb-T | FAM-AACTCGTCACTATTTGGTG-MGB | 813–831 | ||
sec | etc-F | GGCGATAAGTTTGACCAATCTAAATAT | 811–837 | X05815 |
etc-R | AAGGTGGACTTCTATCTTCACACTTTT | 864–900 | ||
etc-T | FAM-TGTACAACGACAATAAA-MGB | 845–861 | ||
sed | etd-F | CACAAGCAAGGCGCTATTTG | 836–855 | M28521 |
etd-R | TCGGGAAAATCACCCTTAACA | 966–986 | ||
etd-T | FAM-ATACAGCGCGGAAA-MGB | 901–914 | ||
see | ete-F | CTTTGGCGGTAAGGTGCAA | 594–612 | M21319 |
ete-R | ACCGTGGACCCTTCAGAAGA | 634–653 | ||
ete-T | FAM-AGGCTTGATTGTGTTTCA-MGB | 615–632 |
Gene | Primer | Oligonucleotide Sequence (5′-3′) [54,55] | Amplification Conditions |
---|---|---|---|
sea | eta-F | AAAGTCCCGATCAATTTATGGCTA | 94 °C 5′; 94 °C 3′; 58 °C 30″; 72 °C 5″; 30 cycles 72°C 10′ |
eta-R | GTAATTAACCGAAGGTTCTGTAGA | ||
seb | etb-F | TCGCATCAAACTGACAAACG | 94 °C 5′; 94 °C 2′ 55 °C 2′; 72 °C 1′; 30 cycles 72 °C 10′ |
etb-R | GCAGGTACTCTATAAGTGCC | ||
sec | etc-F | GACATAAAAGCTAGGAATTT | 94 °C 5′; 94 °C 2′ 55 °C 2′; 72 °C 1′; 30 cycles 72 °C 10′ |
etc-R | AAATCGGATTAACATTATCC | ||
sed | etd-F | CTAGTTTGGTAATATCTCCT | 94 °C 5′; 94 °C 2′ 55 °C 2′; 72 °C 1′; 30 cycles 72 °C 10′ |
etd-R | TAATGCTATATCTTATAGGG | ||
see | ete-F | AGGTTTTTTCACAGGTCATCC | 94 °C 5′; 94 °C 2′ 57 °C 2′; 72 °C 1′; 35 cycles 72 °C 7′ |
ete-R | CTTTTTTTTCTTCGGTCAATC |
Coagulase | Latex Agglutination | Egg Yolk Reaction | Catalase | Dnase | Haemolysis | |
---|---|---|---|---|---|---|
Positive | 175 | 175 | 94 a + 32 b | 175 | 175 | 103 c + 64 d |
Negative | 0 | 0 | 49 | 0 | 0 | 8 |
Sample | No. of Isolates | RPLA Phenotype | Real-Time PCR Genotype | Classical PCR Genotype |
---|---|---|---|---|
S1 | 7 | SEC (5) | sec (5) | sec (4) |
S2 | 9 | SEC (9) | sec (9) | sec (9) |
S3 | 10 | Negative | Negative | - |
S4 | 10 | Negative | Negative | - |
S8 | 10 | Negative | Negative | - |
S11 | 10 | Negative | Negative | - |
S12 | 10 | Negative | Negative | - |
S13 | 10 | Negative | Negative | - |
S14 | 10 | SEC (7) | sec (7) | sec (5) |
S15 | 9 | Negative | Negative | - |
S16 | 10 | SEC (8) | sec (8) | sec (8) |
S17 | 10 | Negative | Negative | - |
S21 | 10 | SEC (1) | sec (1) | sec (1) |
S22 | 10 | SEC (1) | sec (1) | sec (1) |
S23 | 10 | SEC (3) | sec (3) | sec (3) |
S28 | 10 | Negative | Negative | - |
S29 | 10 | Negative | Negative | - |
S30 | 10 | Negative | Negative | - |
Total | 175 | 34 | 34 | 31 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ljevaković-Musladin, I.; Kozačinski, L.; Krilanović, M.; Vodnica Martucci, M.; Lakić, M.; Grispoldi, L.; Cenci-Goga, B.T. Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia. Microorganisms 2023, 11, 2993. https://doi.org/10.3390/microorganisms11122993
Ljevaković-Musladin I, Kozačinski L, Krilanović M, Vodnica Martucci M, Lakić M, Grispoldi L, Cenci-Goga BT. Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia. Microorganisms. 2023; 11(12):2993. https://doi.org/10.3390/microorganisms11122993
Chicago/Turabian StyleLjevaković-Musladin, Ivana, Lidija Kozačinski, Marija Krilanović, Marina Vodnica Martucci, Mato Lakić, Luca Grispoldi, and Beniamino T. Cenci-Goga. 2023. "Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia" Microorganisms 11, no. 12: 2993. https://doi.org/10.3390/microorganisms11122993