Development of a Droplet Digital PCR to Monitor SARS-CoV-2 Omicron Variant BA.2 in Wastewater Samples
Abstract
:1. Introduction
2. Materials and Methods
2.1. Selection and Evaluation of a BA.2 Target Using Whole-Genome Sequencing Data
2.2. Development of RT-ddPCR Method for the Detection of the SARS-CoV-2 Variant BA.2
2.3. Validation of In Vitro Sensitivity of RT-ddPCR Assay for BA.2
2.4. Validation of In Vitro Specificity of RT-ddPCR Assay for BA.2
2.5. A Proof of Concept for the Monitoring of Virus Variants in Wastewater
3. Results
3.1. In Silico Inclusivity Evaluation for the T19I, ORF1a, and RdRp Assays
3.2. In Vitro Sensitivity Assessment of the Mutant I19 Assay
3.3. In Vitro Specificity Assessment of the T19I Assay
Kingdom | Genus | Species | Strain Number | I19 Mutant |
---|---|---|---|---|
Animalia | Homo | sapiens | / | − |
Plantae | Zea | mays | / | − |
Bacteria | Bacillus | subtilis | SI0005 | − |
Escherichia | coli | MB1068 | − | |
Fungi | Aspergillus | acidus | 26285 | − |
Candida | cylindracea | 041387 | − | |
Family | Species | I19 Mutant | ||
Viruses | Picornaviridae | Rhinovirus B | − | |
Reoviridae | Rotavirus | − | ||
Orthomyxoviridae | Influenza A (H1N1) | − | ||
Orthomyxoviridae | Influenza A (H3) | − | ||
Orthomyxoviridae | Influenza B | − | ||
Adenoviridae | Adenovirus | − | ||
Picornaviridae | Enterovirus D68 | − | ||
Caliciviridae | Norovirus | − | ||
Pneumoviridae | RSV A | − | ||
Coronaviridae | SARS-CoV | − | ||
Coronaviridae | MERS-CoV | − | ||
Coronaviridae | Corona OC43 | − | ||
Coronaviridae | Coronavirus control | − | ||
Coronaviridae | SARS-CoV-2 WT | − | ||
Coronaviridae | SARS-CoV-2 B.1.1.7 | − | ||
Coronaviridae | SARS-CoV-2 B.1.351 | − | ||
Coronaviridae | SARS-CoV-2 P.1 | − | ||
Coronaviridae | SARS-CoV-2 B.1.617.2 | − | ||
Coronaviridae | SARS-CoV-2 BA.1 | − | ||
Coronaviridae | SARS-CoV-2 BA.2 | + |
3.4. A Proof of Concept for the Monitoring of Virus Variants in Wastewater
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gong, W.; Parkkila, S.; Wu, X.; Aspatwar, A. SARS-CoV-2 Variants and COVID-19 Vaccines: Current Challenges and Future Strategies. Int. Rev. Immunol. 2022, 1–22. [Google Scholar] [CrossRef] [PubMed]
- Saththasivam, J.; El-Malah, S.S.; Gomez, T.A.; Jabbar, K.A.; Remanan, R.; Krishnankutty, A.K.; Ogunbiyi, O.; Rasool, K.; Ashhab, S.; Rashkeev, S.; et al. COVID-19 (SARS-CoV-2) Outbreak Monitoring Using Wastewater-Based Epidemiology in Qatar. Sci. Total Environ. 2021, 774, 145608. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez, R.; Curtis, K.; Bivins, A.; Bibby, K.; Weir, M.H.; Yetka, K.; Thompson, H.; Keeling, D.; Mitchell, J.; Gonzalez, D. COVID-19 Surveillance in Southeastern Virginia Using Wastewater-Based Epidemiology. Water Res. 2020, 186, 116296. [Google Scholar] [CrossRef]
- Prado, T.; Fumian, T.M.; Mannarino, C.F.; Resende, P.C.; Motta, F.C.; Eppinghaus, A.L.F.; Chagas do Vale, V.H.; Braz, R.M.S.; de Andrade, J.d.S.R.; Maranhão, A.G.; et al. Wastewater-Based Epidemiology as a Useful Tool to Track SARS-CoV-2 and Support Public Health Policies at Municipal Level in Brazil. Water Res. 2021, 191, 116810. [Google Scholar] [CrossRef]
- Van Poelvoorde, L.A.E.; Gand, M.; Fraiture, M.-A.; De Keersmaecker, S.C.J.; Verhaegen, B.; Van Hoorde, K.; Cay, A.B.; Balmelle, N.; Herman, P.; Roosens, N. Strategy to Develop and Evaluate a Multiplex RT-DdPCR in Response to SARS-CoV-2 Genomic Evolution. CIMB 2021, 43, 1937–1949. [Google Scholar] [CrossRef]
- Janssens, R.; Hanoteaux, S.; Maloux, H.; Klamer, S.; Laisnez, V.; Verhaegen, B.; Linard, C.; Lahousse, L.; Delputte, P.; Terwagne, M.; et al. SARS-CoV-2 Surveillance in Belgian Wastewaters. Viruses 2022, 14, 1950. [Google Scholar] [CrossRef] [PubMed]
- Pellegrinelli, L.; Uceda Renteria, S.C.; Ceriotti, F.; Ammoni, E.; Galli, C.; Seiti, A.; Castiglioni, S.; Cereda, D.; Binda, S.; Pariani, E. Wastewater Surveillance Captured an Increase in Adenovirus Circulation in Milan (Italy) during the First Quarter of 2022. Viruses 2022, 14, 2351. [Google Scholar] [CrossRef]
- Medema, G.; Been, F.; Heijnen, L.; Petterson, S. Implementation of Environmental Surveillance for SARS-CoV-2 Virus to Support Public Health Decisions: Opportunities and Challenges. Curr. Opin. Environ. Sci. Health 2020, 17, 49–71. [Google Scholar] [CrossRef]
- Betancourt, W.Q.; Schmitz, B.W.; Innes, G.K.; Prasek, S.M.; Pogreba Brown, K.M.; Stark, E.R.; Foster, A.R.; Sprissler, R.S.; Harris, D.T.; Sherchan, S.P.; et al. COVID-19 Containment on a College Campus via Wastewater-Based Epidemiology, Targeted Clinical Testing and an Intervention. Sci. Total Environ. 2021, 779, 146408. [Google Scholar] [CrossRef]
- Ahmed, W.; Tscharke, B.; Bertsch, P.M.; Bibby, K.; Bivins, A.; Choi, P.; Clarke, L.; Dwyer, J.; Edson, J.; Nguyen, T.M.H.; et al. SARS-CoV-2 RNA Monitoring in Wastewater as a Potential Early Warning System for COVID-19 Transmission in the Community: A Temporal Case Study. Sci. Total Environ. 2021, 761, 144216. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Miller, J.A.; Verghese, M.; Sibai, M.; Solis, D.; Mfuh, K.O.; Jiang, B.; Iwai, N.; Mar, M.; Huang, C.; et al. Multiplex SARS-CoV-2 Genotyping Reverse Transcriptase PCR for Population-Level Variant Screening and Epidemiologic Surveillance. J. Clin. Microbiol. 2021, 59, e00859-21. [Google Scholar] [CrossRef] [PubMed]
- Umunnakwe, C.N.; Makatini, Z.N.; Maphanga, M.; Mdunyelwa, A.; Mlambo, K.M.; Manyaka, P.; Nijhuis, M.; Wensing, A.; Tempelman, H.A. Evaluation of a Commercial SARS-CoV-2 Multiplex PCR Genotyping Assay for Variant Identification in Resource-Scarce Settings. PLOS ONE 2022, 17, e0269071. [Google Scholar] [CrossRef]
- Wegrzynska, K.; Komiazyk, M.; Walory, J.; Kozinska, A.; Wasko, I.; Baraniak, A. Differentiation of SARS-CoV-2 Variants Using RT-QPCRs by Targeting Recurrent Mutation Sites: A Diagnostic Laboratory Experience from Multi-Center Regional Study, August 2020–December 2021, Poland. Int. J. Mol. Sci. 2022, 23, 9416. [Google Scholar] [CrossRef]
- Guglielmi, G. The Explosion of New Coronavirus Tests That Could Help to End the Pandemic. Nature 2020, 583, 506–510. [Google Scholar] [CrossRef]
- Hamaguchi, M.; Shimabukuro, H.; Hori, M.; Yoshida, G.; Terada, T.; Miyajima, T. Quantitative Real-Time Polymerase Chain Reaction (PCR) and Droplet Digital PCR Duplex Assays for Detecting Zostera Marina DNA in Coastal Sediments. Limnol. Oceanogr. Methods 2018, 16, 253–264. [Google Scholar] [CrossRef] [Green Version]
- Subramoney, K.; Mtileni, N.; Bharuthram, A.; Davis, A.; Kalenga, B.; Rikhotso, M.; Maphahlele, M.; Giandhari, J.; Naidoo, Y.; Pillay, S.; et al. Identification of SARS-CoV-2 Omicron Variant Using Spike Gene Target Failure and Genotyping Assays, Gauteng, South Africa, 2021. J. Med. Virol. 2022, 94, 3676–3684. [Google Scholar] [CrossRef]
- Gand, M.; Vanneste, K.; Thomas, I.; Van Gucht, S.; Capron, A.; Herman, P.; Roosens, N.H.C.; De Keersmaecker, S.C.J. Deepening of In Silico Evaluation of SARS-CoV-2 Detection RT-QPCR Assays in the Context of New Variants. Genes 2021, 12, 565. [Google Scholar] [CrossRef]
- Lee, W.L.; Imakaev, M.; Armas, F.; McElroy, K.A.; Gu, X.; Duvallet, C.; Chandra, F.; Chen, H.; Leifels, M.; Mendola, S.; et al. Quantitative SARS-CoV-2 Alpha Variant B.1.1.7 Tracking in Wastewater by Allele-Specific RT-QPCR. Environ. Sci. Technol. Lett. 2021, 8, 675–682. [Google Scholar] [CrossRef]
- Rotondo, J.C.; Martini, F.; Maritati, M.; Caselli, E.; Gallenga, C.E.; Guarino, M.; De Giorgio, R.; Mazziotta, C.; Tramarin, M.L.; Badiale, G.; et al. Advanced Molecular and Immunological Diagnostic Methods to Detect SARS-CoV-2 Infection. Microorganisms 2022, 10, 1193. [Google Scholar] [CrossRef]
- Wolter, N.; Jassat, W.; Walaza, S.; Welch, R.; Moultrie, H.; Groome, M.; Amoako, D.G.; Everatt, J.; Bhiman, J.N.; Scheepers, C.; et al. Early Assessment of the Clinical Severity of the SARS-CoV-2 Omicron Variant in South Africa: A Data Linkage Study. Lancet 2022, 399, 437–446. [Google Scholar] [CrossRef] [PubMed]
- Boogaerts, T.; Van den Bogaert, S.; Van Poelvoorde, L.A.E.; El Masri, D.; De Roeck, N.; Roosens, N.H.C.; Lesenfants, M.; Lahousse, L.; Van Hoorde, K.; van Nuijs, A.L.N.; et al. Optimization and Application of a Multiplex Digital PCR Assay for the Detection of SARS-CoV-2 Variants of Concern in Belgian Influent Wastewater. Viruses 2022, 14, 610. [Google Scholar] [CrossRef] [PubMed]
- You, Y.; Moreira, B.G.; Behlke, M.A.; Owczarzy, R. Design of LNA Probes That Improve Mismatch Discrimination. Nucleic Acids Res. 2006, 34, e60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shu, Y.; McCauley, J. GISAID: Global Initiative on Sharing All Influenza Data – from Vision to Reality. Eurosurveillance 2017, 22, 30494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- World Health Organization. World Health Organization (WHO) Molecular Assays to Diagnose COVID-19: Summary Table of Available Protocols. Available online: https://www.who.int/docs/default-source/coronaviruse/whoinhouseassays.pdf (accessed on 2 July 2021).
- Lu, R.; Zhao, X.; Li, J.; Niu, P.; Yang, B.; Wu, H.; Wang, W.; Song, H.; Huang, B.; Zhu, N.; et al. Genomic Characterisation and Epidemiology of 2019 Novel Coronavirus: Implications for Virus Origins and Receptor Binding. Lancet 2020, 395, 565–574. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stilla Technologies MEMO: How to Calculate the Limit of Blank. Available online: https://www.gene-pi.com/wp-content/uploads/2018/03/Memo_LOB_calculation_method.pdf (accessed on 8 July 2022).
- Villamil, C.; Calderon, M.N.; Arias, M.M.; Leguizamon, J.E. Validation of Droplet Digital Polymerase Chain Reaction for Salmonella Spp. Quantification. Front. Microbiol. 2020, 11, 1512. [Google Scholar] [CrossRef]
- Uhlig, S.; Frost, K.; Colson, B.; Simon, K.; Mäde, D.; Reiting, R.; Gowik, P.; Grohmann, L. Validation of Qualitative PCR Methods on the Basis of Mathematical–Statistical Modelling of the Probability of Detection. Accredit. Qual. Assur. 2015, 20, 75–83. [Google Scholar] [CrossRef]
- Belgian Sequencing Consortium Genomic Surveillance of SARS-CoV-2 in Belgium. Available online: https://www.uzleuven.be/nl/laboratoriumgeneeskunde/genomic-surveillance-sars-cov-2-belgium (accessed on 4 October 2022).
- Mills, M.G.; Hajian, P.; Bakhash, S.M.; Xie, H.; Mantzke, D.; Zhu, H.; Perchetti, G.A.; Huang, M.-L.; Pepper, G.; Jerome, K.R.; et al. Rapid and Accurate Identification of SARS-CoV-2 Omicron Variants Using Droplet Digital PCR (RT-DdPCR). J. Clin. Virol. 2022, 154, 105218. [Google Scholar] [CrossRef]
- Peterson, S.W.; Lidder, R.; Daigle, J.; Wonitowy, Q.; Dueck, C.; Nagasawa, A.; Mulvey, M.R.; Mangat, C.S. RT-QPCR Detection of SARS-CoV-2 Mutations S 69–70 Del, S N501Y and N D3L Associated with Variants of Concern in Canadian Wastewater Samples. Sci. Total Environ. 2022, 810, 151283. [Google Scholar] [CrossRef]
Target | Primer/Probe | Sequence | Nucleotide Position | Final Concentration | Amplicon Length (bp) |
---|---|---|---|---|---|
T19I | T19I_FW | TTATTGCCACTAGTCTCTAGTCA | 21,581–21,603 | 0.5 µM | 96 |
T19I_RV | GGTAATAAACACCACGTGTGAA | 21,656–21,677 | 0.5 µM | ||
T19I_MUT | FAM/CT+T+A+T+AA+C+CA+GAA/IABkFQ | 21,614–21,626 | 0.2 µM | ||
T19I_WT | HEX/CTT+A+C+AA+C+C+AGAA/IABkFQ | 21,614–21,626 | 0.2 µM | ||
ORF1a | ORF1a-F | AGAAGATTGGTTAGATGATGATAGT | 3193–3217 | 0.9 µM | 117 |
ORF1a-R | TTCCATCTCTAATTGAGGTTGAACC | 3286–3310 | 0.9 µM | ||
ORF1a-P | FAM/TCCTCACTG-ZEN-CCGTCTTGTTGACCA/IABkFQ | 3229–3252 | 0.25 µM | ||
RdRp | RdRp_IP4-F | GGTAACTGGTATGATTTCG | 14,080–14,098 | 0.9 µM | 106 |
RdRp_IP4-R | CTGGTCAAGGTTAATATAGG | 14,167–14,186 | 0.9 µM | ||
RdRp_IP4-P | HEX/TCATACAAA-ZEN-CCACGCCAGG/IABkFQ | 14,105–14,123 | 0.25 µM |
Components | Initial Concentration | Volume (µL) |
---|---|---|
T19I_FW | 20 µM | 0.55 |
T19I_RV | 20 µM | 0.55 |
T19I_MUT | 10 µM | 0.44 |
T19I_WT | 10 µM | 0.44 |
DTT | 300 nM | 1.1 |
dH2O | 3.22 | |
Reverse transcriptase | 2.2 | |
Supermix | 2X | 5.5 |
Master mix | 14 | |
RNA template | 8 | |
Total | 22 |
All Sequences (4,593,520) | Sequences between W4 and W20 2022 (840,419) | |||||
---|---|---|---|---|---|---|
Primer/Probe | Inclusivity | FN | Inclusivity BA.2 | Inclusivity | FN | Inclusivity BA.2 |
T19I_FW | 96.30% | 170,144 | 99.81% | 91.14% | 74,453 | 99.83% |
T19I_RV | 99.52% | 21,991 | 99.58% | 99.81% | 1614 | 99.76% |
T19I_WT | 36.96% | 2,895,673 | 0.17% | 37.97% | 521,293 | 0.12% |
T19I_MUT | 29.49% | 3,238,711 | 99.61% | 61.54% | 323,265 | 99.70% |
ORF1a-F | 99.80% | 9062 | 99.87% | 99.85% | 1242 | 99.87% |
ORF1a-R | 99.63% | 16,994 | 99.74% | 99.83% | 1437 | 99.74% |
ORF1a-P | 98.70% | 59,301 | 99.48% | 97.86% | 17,958 | 99.48% |
RdRp_IP4-F | 99.88% | 5369 | 99.82% | 99.90% | 808 | 99.83% |
RdRp_IP4-R | 99.27% | 33,669 | 99.51% | 99.46% | 4577 | 99.55% |
RdRp_IP4-P | 97.63% | 108,643 | 99.42% | 98.75% | 10,478 | 99.44% |
Average Concentration (STDEV) | Sensitivity Assessment (I19 = Mutant) |
---|---|
71.61 ± 5.28 copies/µL | + (12/12) |
36.55 ± 3.14 copies/µL | + (12/12) |
13.25 ± 2.11 copies/µL | + (12/12) |
6.19 ± 1.64 copies/µL | + (12/12) |
2.29 ± 0.67 copies/µL | + (10/12) |
1.06 ± 0.46 copies/µL | + (7/12) |
0.83 ± 0.11 copies/µL | + (6/12) |
0 copies/µL | − (0/12) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Van Poelvoorde, L.A.E.; Picalausa, C.; Gobbo, A.; Verhaegen, B.; Lesenfants, M.; Herman, P.; Van Hoorde, K.; Roosens, N.H.C. Development of a Droplet Digital PCR to Monitor SARS-CoV-2 Omicron Variant BA.2 in Wastewater Samples. Microorganisms 2023, 11, 729. https://doi.org/10.3390/microorganisms11030729
Van Poelvoorde LAE, Picalausa C, Gobbo A, Verhaegen B, Lesenfants M, Herman P, Van Hoorde K, Roosens NHC. Development of a Droplet Digital PCR to Monitor SARS-CoV-2 Omicron Variant BA.2 in Wastewater Samples. Microorganisms. 2023; 11(3):729. https://doi.org/10.3390/microorganisms11030729
Chicago/Turabian StyleVan Poelvoorde, Laura A. E., Corinne Picalausa, Andrea Gobbo, Bavo Verhaegen, Marie Lesenfants, Philippe Herman, Koenraad Van Hoorde, and Nancy H. C. Roosens. 2023. "Development of a Droplet Digital PCR to Monitor SARS-CoV-2 Omicron Variant BA.2 in Wastewater Samples" Microorganisms 11, no. 3: 729. https://doi.org/10.3390/microorganisms11030729