Gut Dysbiosis: A Target for Protective Interventions against Parkinson’s Disease
Abstract
1. Introduction
2. Materials and Methods
2.1. Mice
2.2. PD Induction and Evaluation of Locomotor Dysfunction
2.3. Deferiprone Treatment in Mice
2.4. Blood–Brain Barrier and Gut Permeability
2.5. Iron Measurement
2.6. Isolation of Brain-Infiltrated Immune Cells
2.7. Flow Cytometry
2.8. qRT-PCR
2.9. Calcein Measurement
2.10. ELISA
2.11. Statistical Analysis
3. Results
3.1. Age-Related Dysbiosis Primes to the Development of PD
3.2. Age-Related Dysbiosis Compromises Gut Integrity
3.3. Increased Gut Inflammation and Iron Content in Aged Mice
3.4. Increased Level of Intracellular Iron in Peripheral Blood Leukocytes during Aging
3.5. Increased Brain Permeability in Old Mice
3.6. Reduced Neuroinflammation and Intracellular Fe Accumulation in the Brain of Old GF Mice
3.7. Oral Administration of the Fe Chelator Deferiprone Protects Mice against Age-Related Dysbiosis and the Development of PD
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Oeppen, J.; Vaupel, J.W. Broken Limits to Life Expectancy. Science 2002, 296, 1029–1031. [Google Scholar] [CrossRef] [PubMed]
- Suzman, R.; Beard, J. Preface Overview Humanity’s Aging Living Longer New Disease Patterns Longer Lives and Disability New Data on Aging and Health Assessing the Cost of Aging and Health Care Changing Role of the Family Suggested Resources; Global Health and Aging; US Department of Health and Human Services: National Institute on Aging: Washington, DC, USA, 2011; pp. 2–15. [Google Scholar]
- Nations, U.; Economic, D.; Affairs, S.; Division, P. World Population Prospects 2019; Highlights ST/ESA/SER.A/423; Department of Economic and Social Affairs: New York, NY, USA, 2019; ISBN 978-92-1-148316-1. [Google Scholar]
- World Health Organization (WHO). Ageing and Health, 1 October 2022. Available online: https://www.who.int/news-room/fact-sheets/detail/ageing-and-health (accessed on 26 March 2023).
- Franceschi, C.; Garagnani, P.; Morsiani, C.; Conte, M.; Santoro, A.; Grignolio, A.; Monti, D.; Capri, M.; Salvioli, S. The Continuum of Aging and Age-Related Diseases: Common Mechanisms but Different Rates. Front. Med. 2018, 5, 61. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization (WHO). Parkinson Disease, 13 June 2022. Available online: https://www.who.int/news-room/fact-sheets/detail/parkinson-disease (accessed on 26 March 2023).
- Twelves, D.; Perkins, K.S.; Counsell, C. Systematic review of incidence studies of Parkinson’s disease. Mov. Disord. 2003, 18, 19–31. [Google Scholar] [CrossRef] [PubMed]
- Reekes, T.H.; Higginson, C.I.; Ledbetter, C.R.; Sathivadivel, N.; Zweig, R.M.; Disbrow, E.A. Sex specific cognitive differences in Parkinson disease. npj Park. Dis. 2020, 6, 7. [Google Scholar] [CrossRef]
- Haaxma, C.A.; Bloem, B.R.; Borm, G.F.; Oyen, W.J.G.; Leenders, K.L.; Eshuis, S.; Booij, J.; Dluzen, D.E.; Horstink, M.W.I.M. Gender Differences in Parkinson’s Disease. J. Neurol. Neurosurg. Psychiatry 2007, 78, 819. [Google Scholar] [CrossRef]
- Guatteo, E.; Berretta, N.; Monda, V.; Ledonne, A.; Mercuri, N.B. Pathophysiological Features of Nigral Dopaminergic Neurons in Animal Models of Parkinson’s Disease. Int. J. Mol. Sci. 2022, 23, 4508. [Google Scholar] [CrossRef] [PubMed]
- Warnecke, T.; Schäfer, K.-H.; Claus, I.; Del Tredici, K.; Jost, W.H. Gastrointestinal involvement in Parkinson’s disease: Pathophysiology, diagnosis, and management. npj Park. Dis. 2022, 8, 31. [Google Scholar] [CrossRef]
- Fasano, A.; Visanji, N.P.; Liu, L.W.C.; Lang, A.E.; Pfeiffer, R.F. Gastrointestinal Dysfunction in Parkinson’s Disease. Lancet Neurol. 2015, 14, 625–639. [Google Scholar] [CrossRef]
- Dogra, N.; Mani, R.J.; Katare, D.P. The Gut-Brain Axis: Two Ways Signaling in Parkinson’s Disease. Cell. Mol. Neurobiol. 2021, 42, 315–332. [Google Scholar] [CrossRef]
- Sampson, T.R.; Debelius, J.W.; Thron, T.; Janssen, S.; Shastri, G.G.; Ilhan, Z.E.; Challis, C.; Schretter, C.E.; Rocha, S.; Gradinaru, V.; et al. Gut Microbiota Regulate Motor Deficits and Neuroinflammation in a Model of Parkinson’s Disease. Cell 2016, 167, 1469–1480.e12. [Google Scholar] [CrossRef]
- Cao, H.; Liu, X.; An, Y.; Zhou, G.; Liu, Y.; Xu, M.; Dong, W.; Wang, S.; Yan, F.; Jiang, K.; et al. Dysbiosis Contributes to Chronic Constipation Development via Regulation of Serotonin Transporter in the Intestine. Sci. Rep. 2017, 7, 10322. [Google Scholar] [CrossRef]
- Carding, S.; Verbeke, K.; Vipond, D.T.; Corfe, B.M.; Owen, L.J. Dysbiosis of the gut microbiota in disease. Microb. Ecol. Health Dis. 2015, 26, 26191. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; He, C.; Li, X.; Cai, Y.; Hu, J.; Liao, Y.; Zhao, J.; Xia, L.; He, W.; Liu, L.; et al. Gut Microbiota Dysbiosis Worsens the Severity of Acute Pancreatitis in Patients and Mice. J. Gastroenterol. 2019, 54, 347–358. [Google Scholar] [CrossRef]
- Danilenko, V.; Devyatkin, A.; Marsova, M.; Shibilova, M.; Ilyasov, R.; Shmyrev, V. Common Inflammatory Mechanisms in Covid-19 and Parkinson’s Diseases: The Role of Microbiome, Pharmabiotics and Postbiotics in Their Prevention. J. Inflamm. Res. 2021, 14, 6349–6381. [Google Scholar] [CrossRef] [PubMed]
- Houser, M.C.; Tansey, M.G. The gut-brain axis: Is intestinal inflammation a silent driver of Parkinson’s disease pathogenesis? npj Park. Dis. 2017, 3, 1–9. [Google Scholar] [CrossRef]
- Lubomski, M.; Tan, A.H.; Lim, S.-Y.; Holmes, A.J.; Davis, R.L.; Sue, C.M. Parkinson’s disease and the gastrointestinal microbiome. J. Neurol. 2019, 267, 2507–2523. [Google Scholar] [CrossRef]
- Heintz-Buschart, A.; Pandey, U.; Wicke, T.; Sixel-Döring, F.; Janzen, A.; Sittig-Wiegand, E.; Trenkwalder, C.; Oertel, W.H.; Mollenhauer, B.; Wilmes, P. The nasal and gut microbiome in Parkinson’s disease and idiopathic rapid eye movement sleep behavior disorder. Mov. Disord. 2017, 33, 88–98. [Google Scholar] [CrossRef] [PubMed]
- Thursby, E.; Juge, N. Introduction to the Human Gut Microbiota. Biochem. J. 2017, 474, 1823–1836. [Google Scholar] [CrossRef]
- Turco, F.; Sarnelli, G.; Cirillo, C.; Palumbo, I.; De Giorgi, F.; D’Alessandro, A.; Cammarota, M.; Giuliano, M.; Cuomo, R. Enteroglial-Derived S100B Protein Integrates Bacteria-Induced Toll-like Receptor Signalling in Human Enteric Glial Cells. Gut 2014, 63, 105–115. [Google Scholar] [CrossRef]
- Bosco, N.; Noti, M. The Aging Gut Microbiome and Its Impact on Host Immunity. Genes Immun. 2021, 22, 289–303. [Google Scholar] [CrossRef]
- Ragonnaud, E.; Biragyn, A. Gut microbiota as the key controllers of “healthy” aging of elderly people. Immun. Ageing 2021, 18, 2. [Google Scholar] [CrossRef]
- Agirman, G.; Yu, K.B.; Hsiao, E.Y. Signaling Inflammation across the Gut-Brain Axis. Science 2021, 374, 1087–1092. [Google Scholar] [CrossRef] [PubMed]
- Bhattarai, Y.; Si, J.; Pu, M.; Ross, O.A.; McLean, P.J.; Till, L.; Moor, W.; Grover, M.; Kandimalla, K.K.; Margolis, K.G.; et al. Role of Gut Microbiota in Regulating Gastrointestinal Dysfunction and Motor Symptoms in a Mouse Model of Parkinson’s Disease. Gut Microbes 2021, 13, 1866974. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.; Fang, F.; Pedersen, N.L.; Tillander, A.; Ludvigsson, J.F.; Ekbom, A.; Svenningsson, P.; Chen, H.; Wirdefeldt, K. Vagotomy and Parkinson Disease. Neurology 2017, 88, 1996. [Google Scholar] [CrossRef] [PubMed]
- Barichella, M.; Severgnini, M.; Cilia, R.; Cassani, E.; Bolliri, C.; Caronni, S.; Ferri, V.; Cancello, R.; Ceccarani, C.; Faierman, S.; et al. Unraveling gut microbiota in Parkinson’s disease and atypical parkinsonism. Mov. Disord. 2018, 34, 396–405. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, S.; Goto, S.; Tsuji, H.; Okuno, T.; Asahara, T.; Nomoto, K.; Shibata, A.; Fujisawa, Y.; Minato, T.; Okamoto, A.; et al. Intestinal Dysbiosis and Lowered Serum Lipopolysaccharide-Binding Protein in Parkinson’s Disease. PLoS ONE 2015, 10, e0142164. [Google Scholar] [CrossRef]
- Scheperjans, F.; Aho, V.; Pereira, P.A.B.; Koskinen, K.; Paulin, L.; Pekkonen, E.; Haapaniemi, E.; Kaakkola, S.; Eerola-Rautio, J.; Pohja, M.; et al. Gut Microbiota Are Related to Parkinson’s Disease and Clinical Phenotype. Mov. Disord. 2015, 30, 350–358. [Google Scholar] [CrossRef]
- Gorecki, A.M.; Preskey, L.; Bakeberg, M.C.; Kenna, J.E.; Gildenhuys, C.; MacDougall, G.; Dunlop, S.A.; Mastaglia, F.L.; Akkari, P.A.; Koengten, F.; et al. Altered gut microbiome in Parkinson’s disease and the influence of lipopolysaccharide in a human α-synuclein over-expressing mouse model. Front. Neurosci. 2019, 13, 839. [Google Scholar] [CrossRef]
- Li, C.; Cui, L.; Yang, Y.; Miao, J.; Zhao, X.; Zhang, J.; Cui, G.; Zhang, Y. Gut Microbiota Differs Between Parkinson’s Disease Patients and Healthy Controls in Northeast China. Front. Mol. Neurosci. 2019, 12, 171. [Google Scholar] [CrossRef]
- Rai, S.N.; Singh, P.; Varshney, R.; Chaturvedi, V.K.; Vamanu, E.; Singh, M.P.; Singh, B.K. Promising Drug Targets and Associated Therapeutic Interventions in Parkinson’s Disease. Neural Regen. Res. 2021, 16, 1730–1739. [Google Scholar]
- Thevaranjan, N.; Puchta, A.; Schulz, C.; Naidoo, A.; Szamosi, J.C.; Verschoor, C.P.; Loukov, D.; Schenck, L.P.; Jury, J.; Foley, K.P.; et al. Age-Associated Microbial Dysbiosis Promotes Intestinal Permeability, Systemic Inflammation, and Macrophage Dysfunction. Cell Host Microbe 2017, 21, 455–466.e4. [Google Scholar] [CrossRef] [PubMed]
- Das, N.K.; Schwartz, A.J.; Barthel, G.; Inohara, N.; Liu, Q.; Sankar, A.; Hill, D.R.; Ma, X.; Lamberg, O.; Schnizlein, M.K.; et al. Microbial Metabolite Signaling Is Required for Systemic Iron Homeostasis. Cell Metab. 2020, 31, 115–130.e6. [Google Scholar] [CrossRef] [PubMed]
- Yilmaz, B.; Li, H. Gut Microbiota and Iron: The Crucial Actors in Health and Disease. Pharmaceuticals 2018, 11, 98. [Google Scholar] [CrossRef] [PubMed]
- Gozzelino, R.; Arosio, P. Iron Homeostasis in Health and Disease. Int. J. Mol. Sci. 2016, 17, 130. [Google Scholar] [CrossRef]
- Martins, A.C.; Almeida, J.I.; Lima, I.S.; Kapitão, A.S.; Gozzelino, R. Iron Metabolism and the Inflammatory Response. IUBMB Life 2017, 69, 442–450. [Google Scholar] [CrossRef]
- Lima, I.S.; Pêgo, A.C.; Barros, J.T.; Prada, A.R.; Gozzelino, R. Cell Death-Osis of Dopaminergic Neurons and the Role of Iron in Parkinson’s Disease. Antioxid. Redox Signal. 2021, 35, 453–473. [Google Scholar] [CrossRef]
- Ward, R.J.; Dexter, D.T.; Martin-bastida, A.; Crichton, R.R. Is Chelation Therapy a Potential Treatment for Parkinson’s Disease? Int. J. Mol. Sci. 2021, 22, 3338. [Google Scholar] [CrossRef]
- Devos, D.; Moreau, C.; Devedjian, J.C.; Kluza, J.; Petrault, M.; Laloux, C.; Jonneaux, A.; Ryckewaert, G.; Garçon, G.; Rouaix, N.; et al. Targeting Chelatable Iron as a Therapeutic Modality in Parkinson’s Disease. Antioxid. Redox Signal. 2013, 21, 195–210. [Google Scholar] [CrossRef]
- Devos, D.; Labreuche, J.; Rascol, O.; Corvol, J.-C.; Duhamel, A.; Delannoy, P.G.; Poewe, W.; Compta, Y.; Pavese, N.; Růžička, E.; et al. Trial of Deferiprone in Parkinson’s Disease. N. Engl. J. Med. 2022, 387, 2045–2055. [Google Scholar] [CrossRef]
- Wood, H. Iron Chelator Therapy Leads to PD Worsening. Nat. Rev. Neurol. 2023, 19, 67. [Google Scholar] [CrossRef]
- Kaur, D.; Yantiri, F.; Rajagopalan, S.; Kumar, J.; Mo, J.Q.; Boonplueang, R.; Viswanath, V.; Jacobs, R.; Yang, L.; Beal, M.F.; et al. Genetic or Pharmacological Iron Chelation Prevents MPTP-Induced Neurotoxicity In Vivo: A Novel Therapy for Parkinson’s Disease. Neuron 2003, 37, 899–909. [Google Scholar] [CrossRef] [PubMed]
- Brooks, S.P.; Dunnett, S.B. Tests to Assess Motor Phenotype in Mice: A User’s Guide. Nat. Rev. Neurosci. 2009, 10, 519–529. [Google Scholar] [CrossRef]
- Pamplona, A.; Ferreira, A.; Balla, J.; Jeney, V.; Balla, G.; Epiphanio, S.; Chora, Â.; Rodrigues, C.D.; Gregoire, I.P.; Cunha-Rodrigues, M.; et al. Heme Oxygenase-1 and Carbon Monoxide Suppress the Pathogenesis of Experimental Cerebral Malaria. Nat. Med. 2007, 13, 703–710. [Google Scholar] [CrossRef] [PubMed]
- Stevens, B.R.; Goel, R.; Seungbum, K.; Richards, E.M.; Holbert, R.C.; Pepine, C.J.; Raizada, M.K. Increased Human Intestinal Barrier Permeability Plasma Biomarkers Zonulin and FABP2 Correlated with Plasma LPS and Altered Gut Microbiome in Anxiety or Depression. Gut 2018, 67, 1555. [Google Scholar] [CrossRef] [PubMed]
- Broderick, N.A.; Buchon, N.; Lemaitre, B. Microbiota-Induced Changes in Drosophila Melanogaster Host Gene Expression and Gut Morphology. mBio 2014, 5, e01117-14. [Google Scholar] [CrossRef]
- Jukic, A.; Bakiri, L.; Wagner, E.F.; Tilg, H.; Adolph, T.E. Calprotectin: From Biomarker to Biological Function. Gut 2021, 70, 1978. [Google Scholar] [CrossRef]
- Maliken, B.D.; Nelson, J.E.; Kowdley, K.V. The Hepcidin Circuits Act: Balancing Iron and Inflammation. Hepatology 2011, 53, 1764–1766. [Google Scholar] [CrossRef]
- Singh, S.; Anshita, D.; Ravichandiran, V. MCP-1: Function, Regulation, and Involvement in Disease. Int. Immunopharmacol. 2021, 101, 107598. [Google Scholar] [CrossRef]
- Mu, Q.; Chen, L.; Gao, X.; Shen, S.; Sheng, W.; Min, J.; Wang, F. The Role of Iron Homeostasis in Remodeling Immune Function and Regulating Inflammatory Disease. Sci. Bull. 2021, 66, 1806–1816. [Google Scholar] [CrossRef]
- Vogt, A.-C.; Arsiwala, T.; Mohsen, M.; Vogel, M.; Manolova, V.; Bachmann, M. On Iron Metabolism and Its Regulation. Int. J. Mol. Sci. 2021, 22, 4591. [Google Scholar] [CrossRef]
- Ponnappan, S.; Ponnappan, U. Aging and Immune Function: Molecular Mechanisms to Interventions. Antioxid. Redox Signal. 2010, 14, 1551–1585. [Google Scholar] [CrossRef] [PubMed]
- Ward, R.J.; Zucca, F.A.; Duyn, J.H.; Crichton, R.R.; Zecca, L. The Role of Iron in Brain Ageing and Neurodegenerative Disorders. Lancet Neurol. 2014, 13, 1045–1060. [Google Scholar] [CrossRef] [PubMed]
- Ayton, S.; Faux, N.G.; Bush, A.I.; Weiner, M.W.; Aisen, P.; Petersen, R.; Jack, C.R., Jr.; Jagust, W.; Trojanowki, J.Q.; Toga, A.W.; et al. Ferritin Levels in the Cerebrospinal Fluid Predict Alzheimer’s Disease Outcomes and Are Regulated by APOE. Nat. Commun. 2015, 6, 6760. [Google Scholar] [CrossRef] [PubMed]
- Uversky, V.N. Neuropathology, Biochemistry, and Biophysics of α-Synuclein Aggregation. J. Neurochem. 2007, 103, 17–37. [Google Scholar] [CrossRef]
- Singh, Y.P.; Pandey, A.; Vishwakarma, S.; Modi, G. A Review on Iron Chelators as Potential Therapeutic Agents for the Treatment of Alzheimer’s and Parkinson’s Diseases. Mol. Divers. 2019, 23, 509–526. [Google Scholar] [CrossRef]
- Xu, J.; Knutson, M.D.; Carter, C.S.; Leeuwenburgh, C. Iron Accumulation with Age, Oxidative Stress and Functional Decline. PLoS ONE 2008, 3, e2865. [Google Scholar] [CrossRef]
- Gozzelino, R.; Arosio, P. The Importance of Iron in Pathophysiologic Conditions. Front. Pharmacol. 2015, 6, 1–3. [Google Scholar] [CrossRef] [PubMed]
- Kong, Y.; Wang, L.; Jiang, B. The Role of Gut Microbiota in Aging and Aging Related Neurodegenerative Disorders: Insights from Drosophila Model. Life 2021, 11, 855. [Google Scholar] [CrossRef]
- Spychala, M.S.; Venna, V.R.; Jandzinski, M.; Doran, S.J.; Durgan, D.J.; Ganesh, B.P.; Ajami, N.J.; Putluri, N.; Graf, J.; Bryan, R.M.; et al. Age-Related Changes in the Gut Microbiota Influence Systemic Inflammation and Stroke Outcome. Ann. Neurol. 2018, 84, 23–36. [Google Scholar] [CrossRef]
- Zeppa, S.D.; Agostini, D.; Ferrini, F.; Gervasi, M.; Barbieri, E.; Bartolacci, A.; Piccoli, G.; Saltarelli, R.; Sestili, P.; Stocchi, V. Interventions on Gut Microbiota for Healthy Aging. Cells 2022, 12, 34. [Google Scholar] [CrossRef]
- Talapko, J.; Včev, A.; Meštrović, T.; Pustijanac, E.; Jukić, M.; Škrlec, I. Homeostasis and Dysbiosis of the Intestinal Microbiota: Comparing Hallmarks of a Healthy State with Changes in Inflammatory Bowel Disease. Microorganisms 2022, 10, 2405. [Google Scholar] [CrossRef]
- Malesza, I.J.; Bartkowiak-Wieczorek, J.; Winkler-Galicki, J.; Nowicka, A.; Dzięciołowska, D.; Błaszczyk, M.; Gajniak, P.; Słowińska, K.; Niepolski, L.; Walkowiak, J.; et al. The Dark Side of Iron: The Relationship between Iron, Inflammation and Gut Microbiota in Selected Diseases Associated with Iron Deficiency Anaemia—A Narrative Review. Nutrients 2022, 14, 3478. [Google Scholar] [CrossRef]
- Rehman, T. Role of the Gut Microbiota in Age-Related Chronic Inflammation. Endocr. Metab. Immune Disord.-Drug Targets 2012, 12, 361–367. [Google Scholar] [CrossRef]
- Pu, Y.; Chang, L.; Qu, Y.; Wang, S.; Zhang, K.; Hashimoto, K. Antibiotic-Induced Microbiome Depletion Protects against MPTP-Induced Dopaminergic Neurotoxicity in the Brain. Aging 2019, 11, 6915–6929. [Google Scholar] [CrossRef] [PubMed]
- Clairembault, T.; Leclair-Visonneau, L.; Coron, E.; Bourreille, A.; Le Dily, S.; Vavasseur, F.; Heymann, M.F.; Neunlist, M.; Derkinderen, P. Structural Alterations of the Intestinal Epithelial Barrier in Parkinson’s Disease. Acta Neuropathol. Commun. 2015, 3, 12. [Google Scholar] [CrossRef] [PubMed]
- Mulak, A.; Koszewicz, M.; Panek-Jeziorna, M.; Koziorowska-Gawron, E.; Budrewicz, S. Fecal Calprotectin as a Marker of the Gut Immune System Activation Is Elevated in Parkinson’s Disease. Front. Neurosci. 2019, 13, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Hachiya, K.; Masuya, M.; Kuroda, N.; Yoneda, M.; Tsuboi, J.; Nagaharu, K.; Nishimura, K.; Shiotani, T.; Ohishi, K.; Tawara, I.; et al. Irbesartan, an angiotensin II type 1 receptor blocker, inhibits colitis-associated tumourigenesis by blocking the MCP-1/CCR2 pathway. Sci. Rep. 2021, 11, 1–12. [Google Scholar] [CrossRef]
- Singh, U.P.; Singh, N.P.; Murphy, E.A.; Price, R.L.; Fayad, R.; Nagarkatti, M.; Nagarkatti, P.S. Chemokine and Cytokine Levels in Inflammatory Bowel Disease Patients. Cytokine 2016, 77, 44–49. [Google Scholar] [CrossRef]
- Fransen, F.; van Beek, A.A.; Borghuis, T.; El Aidy, S.; Hugenholtz, F.; van der Gaast-de Jongh, C.; Savelkoul, H.F.J.; de Jonge, M.I.; Boekschoten, M.V.; Smidt, H.; et al. Aged Gut Microbiota Contributes to Systemical Inflammaging after Transfer to Germ-Free Mice. Front. Immunol. 2017, 8, 1–12. [Google Scholar] [CrossRef]
- Ferrucci, L.; Semba, R.D.; Guralnik, J.M.; Ershler, W.B.; Bandinelli, S.; Patel, K.V.; Sun, K.; Woodman, R.C.; Andrews, N.C.; Cotter, R.J.; et al. Proinflammatory State, Hepcidin, and Anemia in Older Persons. Blood 2010, 115, 3810–3816. [Google Scholar] [CrossRef]
- Nemeth, E. Hepcidin Regulates Cellular Iron Efflux by Binding to Ferroportin and Inducing Its Internalization. Science 2004, 306, 2090–2093. [Google Scholar] [CrossRef] [PubMed]
- Tilg, H.; Zmora, N.; Adolph, T.E.; Elinav, E. The Intestinal Microbiota Fuelling Metabolic Inflammation. Nat. Rev. Immunol. 2020, 20, 40–54. [Google Scholar] [CrossRef]
- Cronin, S.J.F.; Woolf, C.J.; Weiss, G.; Penninger, J.M. The Role of Iron Regulation in Immunometabolism and Immune-Related Disease. Front. Mol. Biosci. 2019, 6, 116. [Google Scholar] [CrossRef] [PubMed]
- Soares, M.P.; Hamza, I. Macrophages and Iron Metabolism. Immunity 2016, 44, 492–504. [Google Scholar] [CrossRef] [PubMed]
- Weiss, G.; Ganz, T.; Goodnough, L.T. Anemia of Inflammation. Blood 2019, 133, 40–50. [Google Scholar] [CrossRef] [PubMed]
- Kruger, P.; Saffarzadeh, M.; Weber, A.N.R.; Rieber, N.; Radsak, M.; von Bernuth, H.; Benarafa, C.; Roos, D.; Skokowa, J.; Hartl, D. Neutrophils: Between Host Defence, Immune Modulation, and Tissue Injury. PLoS Pathog. 2015, 11, e1004651. [Google Scholar] [CrossRef]
- Parker, A.; Fonseca, S.; Carding, S.R. Gut Microbes and Metabolites as Modulators of Blood-Brain Barrier Integrity and Brain Health. Gut Microbes 2020, 11, 135–157. [Google Scholar] [CrossRef]
- Braniste, V.; Al-Asmakh, M.; Kowal, C.; Anuar, F.; Abbaspour, A.; Tóth, M.; Korecka, A.; Bakocevic, N.; Ng, L.G.; Kundu, P.; et al. The Gut Microbiota Influences Blood-Brain Barrier Permeability in Mice. Sci. Transl. Med. 2014, 6, 263ra158. [Google Scholar] [CrossRef]
- Gelders, G.; Baekelandt, V.; Van Der Perren, A. Linking Neuroinflammation and Neurodegeneration in Parkinson’s Disease. J. Immunol. Res. 2018, 2018, 1–12. [Google Scholar] [CrossRef]
- Jayaraj, R.L.; Azimullah, S.; Beiram, R.; Jalal, F.Y.; Rosenberg, G.A. Neuroinflammation: Friend and Foe for Ischemic Stroke. J. Neuroinflamm. 2019, 16, 142. [Google Scholar] [CrossRef]
- Zhang, B.; Zhang, H.; Du, C.; Ng, Q.X.; Hu, C.; He, Y.; Ong, C.N. Metabolic Responses of the Growing Daphnia Similis to Chronic AgNPs Exposure as Revealed by GC-Q-TOF/MS and LC-Q-TOF/MS. Water Res. 2017, 114, 135–143. [Google Scholar] [CrossRef] [PubMed]
- Ng, Q.X.; Lim, Y.L.; Yaow, C.Y.L.; Ng, W.K.; Thumboo, J.; Liew, T.M. Effect of Probiotic Supplementation on Gut Microbiota in Patients with Major Depressive Disorders: A Systematic Review. Nutrients 2023, 15, 1351. [Google Scholar] [CrossRef]
Transcript | Primer Forward (5′-3′) | Primer Reverse (5′-3′) |
---|---|---|
ArbP0 | CTTTGGGCATCACCACGAA | GCTGGCTCCCACCTTGTCT |
Gadph | ACCACAGTCCATGCCATCAC | CACCACCCTGTTGCTGTAGCC |
Th | GGTATACGCCACGCTGAAGG | TAGCCACAGTACCGTTCCAGA |
FtH | CCATCAACCGCCAGATCAAC | GCCACATCATCTCGGTCAAA |
TfR-1 | TGTGACCTGTGTATTGGCCC | GCAGGGTTCTTTCCTTCGGT |
Dmt-1 | GCAGTGGTTAGCGTGGCTTATT | AGACAGACCCAATGCAATCAAA |
S100/A8 | TGTCCTCAGTTTGTGCAGAATATAAA | TCACCATCGCAAGGAACTCC |
S100/A9 | GGTGGAAGCACAGTTGGCA | GTGTCCAGGTCCTCCATGATG |
IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
Tnf | ACGGCATGGATCTCAAAGAC | AGATAGCAAATCGGCTGACG |
Mcp-1 | ACTCACCTGCTGCTACTCAT | CTACAGCTTCTTTGGGACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lima, I.S.; Pêgo, A.C.; Martins, A.C.; Prada, A.R.; Barros, J.T.; Martins, G.; Gozzelino, R. Gut Dysbiosis: A Target for Protective Interventions against Parkinson’s Disease. Microorganisms 2023, 11, 880. https://doi.org/10.3390/microorganisms11040880
Lima IS, Pêgo AC, Martins AC, Prada AR, Barros JT, Martins G, Gozzelino R. Gut Dysbiosis: A Target for Protective Interventions against Parkinson’s Disease. Microorganisms. 2023; 11(4):880. https://doi.org/10.3390/microorganisms11040880
Chicago/Turabian StyleLima, Illyane S., Ana C. Pêgo, Ana C. Martins, Ana R. Prada, João Tomás Barros, Gracelino Martins, and Raffaella Gozzelino. 2023. "Gut Dysbiosis: A Target for Protective Interventions against Parkinson’s Disease" Microorganisms 11, no. 4: 880. https://doi.org/10.3390/microorganisms11040880
APA StyleLima, I. S., Pêgo, A. C., Martins, A. C., Prada, A. R., Barros, J. T., Martins, G., & Gozzelino, R. (2023). Gut Dysbiosis: A Target for Protective Interventions against Parkinson’s Disease. Microorganisms, 11(4), 880. https://doi.org/10.3390/microorganisms11040880