Evidence of Homeostatic Regulation in Mycobacterium avium Subspecies paratuberculosis as an Adaptive Response to Copper Stress
Abstract
:1. Introduction
2. Material and Methods
2.1. Selection of Genes Involved in Copper Homeostasis
Primer Design and Confirmation of Gene Presence
2.2. Exploring the Adaptive Responses of MAP to Copper Stresses
2.2.1. Experimental Design
2.2.2. Preparation of MAP Cultures
2.2.3. MAP Detection and Quantification
2.2.4. Treatment with Copper Ions
2.2.5. Determination of Copper Concentration
2.2.6. Analysis of Gene Expression
2.2.7. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Poole, K. Bacterial stress responses as determinants of antimicrobial resistance. J. Antimicrob. Chemother. 2012, 67, 2069–2089. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, M.; Gross, C. Stress induced remodeling of the bacterial proteome. Curr. Biol. 2014, 24, R424–R434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nachin, L.; Nannmarck, U.; Nystrom, T. Differential Roles of the Universal Stress Proteins of Escherichia coli in Oxidative Stress Resistance, Adhesion, and Motility. J. Bacteriol. 2005, 187, 6265–6272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moll, I.; Engelberg-Kulka, H. Selective translation during stress in Escherichia coli. Trends Biochem. Sci. 2012, 37, 493–498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagar, S.D.; Aggarwal, B.; Joon, S.; Bhatnagar, R.; Bhatnagar, S. A network biology approach to decipher stress response in bacteria using Escherichia coli as a model. Omics A J. Integr. Biol. 2016, 20, 310–324. [Google Scholar] [CrossRef] [Green Version]
- Bisht, N.; Dwivedi, N.; Kumar, P.; Venkatesh, M.; Yadav, A.K.; Mishra, D.; Dhand, C. Recent advances in copper and copper-derived materials for antimicrobial resistance and infection control. Curr. Opin. Biomed. Eng. 2022, 24, 100408. [Google Scholar] [CrossRef]
- Ladomersky, E.; Petris, M.J. Copper tolerance and virulence in bacteria. Metallomics 2015, 7, 957–964. [Google Scholar] [CrossRef] [Green Version]
- Ward, S.K.; Hoye, E.A.; Talaat, A.M. The global responses of Mycobacterium tuberculosis to physiological levels of copper. J. Bacteriol. 2008, 190, 2939–2946. [Google Scholar] [CrossRef] [Green Version]
- Wolschendorf, F.; Ackart, D.; Shrestha, T.B.; Hascall-Dove, L.; Nolan, S.; Lamichhane, G.; Niederweis, M. Copper resistance is essential for virulence of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 2011, 108, 1621–1626. [Google Scholar] [CrossRef] [Green Version]
- Shi, X.; Darwin, K.H. Copper homeostasis in Mycobacterium tuberculosis. Metallomics 2015, 7, 929–934. [Google Scholar] [CrossRef] [Green Version]
- Harris, N.B.; Barletta, R.G. Mycobacterium avium subsp. paratuberculosis in veterinary medicine. Clin. Microbiol. Rev. 2001, 14, 489–512. [Google Scholar] [CrossRef] [Green Version]
- Rathnaiah, G.; Zinniel, D.K.; Bannantine, J.P.; Stabel, J.R.; Gröhn, Y.T.; Collins, M.T.; Barletta, R.G. Pathogenesis, molecular genetics, and genomics of Mycobacterium avium subsp. paratuberculosis, the etiologic agent of Johne’s disease. Front. Vet. Sci. 2017, 4, 187. [Google Scholar] [CrossRef] [Green Version]
- Steuer, P.; Avilez, C.; Tejeda, C.; González, N.; Ramirez-Reveco, A.; Ulloa, F.; Salgado, M. In vitro inactivation of Mycobacterium avium subsp. paratuberculosis (MAP) by use of copper ions. BMC Microbiol. 2018, 18, 172. [Google Scholar] [CrossRef]
- Steuer, P.; Tejeda, C.; Martinez, O.; Ramirez-Reveco, A.; González, N.; Grant, I.R.; Salgado, M. Effectiveness of copper ions against Mycobacterium avium subsp. paratuberculosis and bacterial communities in naturally contaminated raw cow’s milk. J. Appl. Microbiol. 2021, 13, 146–154. [Google Scholar] [CrossRef] [PubMed]
- Tejeda, C.; Steuer, P.; Villegas, M.; Reyes-Jara, A.; Iranzo, E.C.; Umaña, R.; Salgado, M. More Insights about the Efficacy of Copper Ion Treatment on Mycobacterium avium subsp paratuberculosis (MAP): A Clue for the Observed Tolerance. Pathogens 2022, 11, 272. [Google Scholar] [CrossRef]
- Salgado, M.; Collins, M.T.; Salazar, F.; Kruze, J.; Bolske, G.; Soderlund, R.; Alfaro, M. Fate of Mycobacterium avium subsp. paratuberculosis after application of contaminated dairy cattle manure to agricultural soils. Appl. Environ. Microbiol. 2011, 77, 2122–2129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kralik, P.; Babak, V.; Dziedzinska, R. Repeated cycles of chemical and physical disinfection and their influence on Mycobacterium avium subsp. paratuberculosis viability measured by propidium monoazide F57 quantitative real time PCR. Vet. J. 2014, 201, 359–364. [Google Scholar] [CrossRef] [PubMed]
- Kabara, E.; Kloss, C.C.; Wilson, M.; Tempelman, R.J.; Sreevatsan, S.; Janagama, H.; Coussens, P.M. A large-scale study of differential gene expression in monocyte-derived macrophages infected with several strains of Mycobacterium avium subspecies paratuberculosis. Brief. Funct. Genom. 2010, 9, 220–237. [Google Scholar] [CrossRef] [PubMed]
- Purdie, A.C.; Plain, K.M.; Begg, D.J.; de Silva, K.; Whittington, R.J. Gene expression profiles during subclinical Mycobacterium avium subspecies paratuberculosis infection in sheep can predict disease outcome. Sci. Rep. 2019, 9, 8245. [Google Scholar] [CrossRef] [Green Version]
- Wu, C.W.; Schmoller, S.K.; Shin, S.J.; Talaat, A.M. Defining the stressome of Mycobacterium avium subsp. paratuberculosis in vitro and in naturally infected cows. J. Bacteriol. 2007, 189, 7877–7886. [Google Scholar] [CrossRef] [Green Version]
- Kugadas, A.; Lamont, E.A.; Bannantine, J.P.; Shoyama, F.M.; Brenner, E.; Janagama, H.K.; Sreevatsan, S. A Mycobacterium avium subsp. paratuberculosis predicted serine protease is associated with acid stress and intraphagosomal survival. Front. Cell. Infect. Microbiol. 2016, 6, 85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ward, S.K.; Abomoelak, B.; Hoye, E.A.; Steinberg, H.; Talaat, A.M. CtpV: A putative copper exporter required for full virulence of Mycobacterium tuberculosis. Mol. Microbiol. 2010, 77, 1096–1110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, L.; Bannantine, J.P.; Zhang, Q.; Amonsin, A.; May, B.J.; Alt, D.; Kapur, V. The complete genome sequence of Mycobacterium avium subspecies paratuberculosis. Proc. Natl. Acad. Sci. USA 2005, 102, 12344–12349. [Google Scholar] [CrossRef] [Green Version]
- Goethe, R.; Basler, T.; Meissner, T.; Goethe, E.; Spröer, C.; Swiderski, J.; Bunk, B. Complete genome sequence and manual reannotation of Mycobacterium avium subsp. paratuberculosis strain DSM 44135. Microbiol. Resour. Announc. 2020, 9, e00711-20. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shin, S.J.; Han, J.H.; Manning, E.J.; Collins, M.T. Rapid and reliable method for quantification of Mycobacterium paratuberculosis by use of the BACTEC MGIT 960 system. J. Clin. Microbiol. 2007, 45, 1941–1948. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Granger, K.; Moore, R.J.; Davies, J.K.; Vaughan, J.A.; Stiles, P.L.; Stewart, D.J.; Tizard, M.L. Recovery of Mycobacterium avium subspecies paratuberculosis from the natural host for the extraction and analysis in vivo-derived RNA. J. Microbiol. Methods 2004, 57, 241–249. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protocols. 2001, 3, 1101–1108. [Google Scholar] [CrossRef]
- Solioz, M. Copper and Bacteria: Evolution, Homeostasis and Toxicity, 1st ed.; Springer: Cham, Switzerland, 2018; pp. 49–80. [Google Scholar]
- Solioz, M.; Stoyanov, J.V. Copper homeostasis in Enterococcus hirae. FEMS Microbiol. Rev. 2003, 27, 183–195. [Google Scholar] [CrossRef] [Green Version]
- Yamamoto, K.; Ishihama, A. Transcriptional response of Escherichia coli to external copper. Mol. Microbiol. 2005, 56, 215–227. [Google Scholar] [CrossRef] [PubMed]
- Abdallah, A.M.; Gey van Pittius, N.C.; DiGiuseppe Champion, P.A.; Cox, J.; Luirink, J.; Vandenbroucke-Grauls, C.M.; Bitter, W. Type VII secretion—Mycobacteria show the way. Nat. Rev. Microbiol. 2007, 5, 883–891. [Google Scholar] [CrossRef] [PubMed]
- Durfee, T.; Hansen, A.M.; Zhi, H.; Blattner, F.R.; Jin, D.J. Transcription profiling of the stringent response in Escherichia coli. J. Bacteriol. 2008, 190, 1084–1096. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dragosits, M.; Mozhayskiy, V.; Quinones-Soto, S.; Park, J.; Tagkopoulos, I. Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli. Mol. Syst. Biol. 2013, 9, 643. [Google Scholar] [CrossRef] [PubMed]
- Bird, A. DNA methylation patterns and epigenetic memory. Genes Dev. 2002, 16, 6–21. [Google Scholar] [CrossRef] [Green Version]
- Marcus, S.A.; Sidiropoulos, S.W.; Steinberg, H.; Talaat, A.M. CsoR is essential for maintaining copper homeostasis in Mycobacterium tuberculosis. PLoS ONE 2016, 11, e0151816. [Google Scholar] [CrossRef]
- Steuer, P.; Tejeda, C.; Moroni, M.; Verdugo, C.; Collins, M.T.; Salgado, M. Attempted Control of Paratuberculosis in Dairy Calves by Only Changing the Quality of Milk Fed to Calves. Animals 2021, 11, 2569. [Google Scholar] [CrossRef]
- Tejeda, C.; Villegas, M.; Steuer, P.; Iranzo, E.; Gonzalez, N.; Ramirez-Reveco, A.; Salgado, M. Understanding the antibacterial mechanisms of copper ion treatment on Mycobacterium avium subsp. paratuberculosis. Vet. Microbiol. 2022, 268, 109412. [Google Scholar] [CrossRef]
- Warnes, S.L.; Keevil, C.W. Mechanism of copper surface toxicity in vancomycin-resistant enterococci following wet or dry surface contact. Appl. Environ. Microbiol. 2011, 77, 6049–6059. [Google Scholar] [CrossRef] [Green Version]
- Villegas, M.; Tejeda, C.; Umaña, R.; Iranzo, E.C.; Salgado, M. Are Reactive Oxygen Species (ROS) the Main Mechanism by Which Copper Ion Treatment Degrades the DNA of Mycobacterium avium subsp. paratuberculosis Suspended in Milk? Microorganisms 2022, 10, 2272. [Google Scholar] [CrossRef]
- Tejeda, C.; Villegas, M.; Steuer, P.; Ulloa, F.; Iranzo, E.C.; Reyes-Jara, A.; Salgado, M. Experimental evidence of the anti-bacterial activity pathway of copper ion treatment on Mycobacterium avium subsp. paratuberculosis. Braz. J. Microbiol. 2022, 54, 407–413. [Google Scholar] [CrossRef] [PubMed]
- Mehtar, S.; Wiid, I.; Todorov, S.D. The antimicrobial activity of copper and copper alloys against nosocomial pathogens and Mycobacterium tuberculosis isolated from healthcare facilities in the Western Cape: An in-vitro study. J. Hosp. Infect. 2008, 68, 45–51. [Google Scholar] [CrossRef] [PubMed]
- Steuer, P.N.; Tejeda, C.; Moroni, M.; Soto, J.P.; Salgado, M.A. Is the effectivity of copper ions treatment of milk enough to block Mycobacterium avium subsp. paratuberculosis infection in calves? Austral J. Vet. Sci. 2021, 53, 115–120. [Google Scholar] [CrossRef]
- Beceiro, A.; Tomás, M.; Bou, G. Antimicrobial resistance and virulence: A successful or deleterious association in the bacterial world? Clin. Microbiol. Rev. 2013, 26, 185–230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primer Sequence (5′-3′) | Annealing Temperature (Tm) |
---|---|---|
csoR | GCGCTGATCTGAGTGAGGA | 57 °C |
ATGACCAACGAACACGGGTA | ||
ctpV | CCAACCTCAAACATGGCGTC | 57 °C |
CGTACAGCGACCACAGGAAG | ||
mctB | TGATCTCGCTACGCCAACAC | 57 °C |
TCGTTGAGCCCGTTGATCTG | ||
mmcO | GGCGGCAACATGATCCAGTA | 57 °C |
TGCAGGTGAATCGGGTGATAC | ||
mymT | CGGAACCCTGCTGACCTG | 57 °C |
ACAGGTGCAGCGGTACTC | ||
gapDH | ATCGGGCGCAACTTCTACC | 60 °C |
GTCGAATTTCAGCAGGTGAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tejeda, C.; Steuer, P.; Villegas, M.; Ulloa, F.; Hernández-Agudelo, J.M.; Salgado, M. Evidence of Homeostatic Regulation in Mycobacterium avium Subspecies paratuberculosis as an Adaptive Response to Copper Stress. Microorganisms 2023, 11, 898. https://doi.org/10.3390/microorganisms11040898
Tejeda C, Steuer P, Villegas M, Ulloa F, Hernández-Agudelo JM, Salgado M. Evidence of Homeostatic Regulation in Mycobacterium avium Subspecies paratuberculosis as an Adaptive Response to Copper Stress. Microorganisms. 2023; 11(4):898. https://doi.org/10.3390/microorganisms11040898
Chicago/Turabian StyleTejeda, Carlos, Pamela Steuer, Marcela Villegas, Fernando Ulloa, José M. Hernández-Agudelo, and Miguel Salgado. 2023. "Evidence of Homeostatic Regulation in Mycobacterium avium Subspecies paratuberculosis as an Adaptive Response to Copper Stress" Microorganisms 11, no. 4: 898. https://doi.org/10.3390/microorganisms11040898