Next Article in Journal
Microbiota and Cyanotoxin Content of Retail Spirulina Supplements and Spirulina Supplemented Foods
Next Article in Special Issue
Acanthamoeba spp. as Factors for Severe Infectious Diseases in Humans
Previous Article in Journal
Glutamate Transporters GltS, GltP and GltI Are Involved in Escherichia coli Tolerance In Vitro and Pathogenicity in Mouse Urinary Tract Infections
Previous Article in Special Issue
Acanthamoeba castellanii Genotype T4: Inhibition of Proteases Activity and Cytopathic Effect by Bovine Apo-Lactoferrin
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 11
Issue 5
10.3390/microorganisms11051174
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Successive Acanthamoeba Corneal Isolates Identified in Poland Monitored in Terms of In Vitro Dynamics

by
Lidia Chomicz
1,*,
Jacek P. Szaflik
2,*,
Beata Szostakowska
3,
Justyna Izdebska
2,
Wanda Baltaza
4,
Monika Łazicka-Gałecka
2,
Agnieszka Kuligowska
5,
Anna Machalińska
5,
Paweł J. Zawadzki
6 and
Jerzy Szaflik
7
1
Department of Medical Biology, Medical University of Warsaw, 00-575 Warsaw, Poland
2
Department of Ophthalmology, Independent Public Clinical Ophthalmology Hospital, Medical University of Warsaw, 00-576 Warsaw, Poland
3
Department of Tropical Parasitology, Faculty of Health Sciences, Medical University of Gdansk, 80-210 Gdańsk, Poland
4
Department of Public Health, Medical University of Warsaw, 02-097 Warsaw, Poland
5
First Department of Ophthalmology, Pomeranian Medical University, 70-111 Szczecin, Poland
6
Clinic of Cranio-Maxillo-Facial and Oral Surgery and Implantology, Medical University of Warsaw, 02-005 Warsaw, Poland
7
Laser Eye Microsurgery Centre Clinic of Prof. Jerzy Szaflik, Brand Med Medical Research Centre, 00-215 Warsaw, Poland
*
Authors to whom correspondence should be addressed.
Microorganisms 2023, 11(5), 1174; https://doi.org/10.3390/microorganisms11051174
Submission received: 31 March 2023 / Revised: 24 April 2023 / Accepted: 27 April 2023 / Published: 29 April 2023
(This article belongs to the Special Issue Acanthamoeba spp. as Factors for Severe Infectious Diseases in Humans)
Browse Figures
Versions Notes

Abstract

:
Background: Amoebae of the genus Acanthamoeba cause a sight-threatening infection called Acanthamoeba keratitis. It is considered a rare disease in humans but poses an increasing threat to public health worldwide, including in Poland. We present successive isolates from serious keratitis preliminary examined in terms of the identification and monitoring of, among others, the in vitro dynamics of the detected strains. Methods: Clinical and combined laboratory methods were applied; causative agents of the keratitis were identified at the cellular and molecular levels; isolates were cultivated in an axenic liquid medium and regularly monitored. Results: In a phase-contrast microscope, Acanthamoeba sp. cysts and live trophozoites from corneal samples and in vitro cultures were assessed on the cellular level. Some isolates that were tested at the molecular level were found to correspond to A. mauritanensis, A. culbertsoni, A. castellanii, genotype T4. There was variability in the amoebic strain dynamics; high viability was expressed as trofozoites’ long duration ability to intense multiply. Conclusions: Some strains from keratitis under diagnosis verification and dynamics assessment showed enough adaptive capability to grow in an axenic medium, allowing them to exhibit significant thermal tolerance. In vitro monitoring that was suitable for verifying in vivo examinations, in particular, was useful to detect the strong viability and pathogenic potential of successive Acanthamoeba strains with a long duration of high dynamics.

1. Introduction

The primary free-living acanthamoebae (FLA) distributed in natural and man-made environments exist in two forms: as the active vegetative trophozoites with characteristic protrusions—acanthopodia—and as double-walled dormant cysts developing after the growth phase and in harsh conditions. The amoebae occur in soil, air, dust, on/in vegetables, in animals, and in different aquatic habitats; they survive in domestic tap water, municipal sewage systems, in chlorinated swimming pools, and in air conditioning units [1,2,3,4,5,6,7]. They have also been detected in hospital environments on equipment surfaces, on accessories, in dialyzers, on surgical instruments, in dental irrigation units, and in contact lenses and their boxes. As Acanthamoeba strains can enter human tissues and exist as endozoic forms, they are believed to be amphizoic organisms able to exist as free-living forms and as facultative parasites. The amoebae were detected on skin, in paranasal sinuses and lungs, and among oral cavity microbiota associated with gingivitis and periodontitis [8,9,10]. They are known as causative agents of granulomatous amoebic encephalitis (GAE), a rare, usually fatal disease developing in immunocompromised persons, patients under immunosuppressive therapy, and HIV/AIDS patients [2,5,11].
Some Acanthamoeba strains generate serious human health threats as the causative agents of vision-threatening Acanthamoeba keratitis (AK). The disease occurs mainly in immunocompetent persons; nowadays, contact lens wearers are at the highest risk of this disease [12,13,14,15,16,17,18,19,20,21,22,23,24,25,26]. AK can also occur in persons not using contact lenses: micro-injuries of corneal epithelium, ocular surgery, and exposure of the eye to natural water bodies containing Acanthamoeba forms are predisposing circumstances for this ocular amoebic infection in humans [27,28,29,30,31]. Usually, one eye is affected; however, bilateral infections have also been reported. Some Acanthamoeba strains, which are potential agents of this ocular disease in humans, are common in natural and man-made environments. AK includes non-specific symptoms similar to those observed in the course of viral, fungal, or bacterial keratitis. In the AK diagnosis, non-invasive in vivo methods are applied [31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48]. Examinations of corneal scrapings may directly identify Acanthamoeba developmental forms by detection of the live protozoans. The in vitro cultivation of samples acquired from corneal scrapings is useful for the confirmation of the diagnosis of AK and the assessment of morpho-physiological amoebic characteristics. The evaluation of Acanthamoeba isolates at the molecular level should be made by PCR and other molecular techniques [18,24,29,30,31,38,39,40,49,50,51,52,53,54,55,56,57].
Acanthamoeba keratitis is challenging in terms of differential diagnosis, among others, because the amoebae may transmit endosymbionts that are potentially pathogenic for humans and are able to survive/proliferate intracellularly within the amoebae [32,33,34,35,36,37,38].
The treatment of AK is often unsuccessful due to extremely high resistance of the cysts of Acanthamoeba to chemical agents, disinfectants, and drugs [20,38,51].
The literature and our studies emphasize that human AK that easily leads to blindness caused by pathogenic strains of Acanthamoeba has recently been diagnosed more often worldwide [12,13,14,15,41,42,43,44,45,46,51,56].
In this interdisciplinary study, we present successive isolates originating from complicated keratitis incidents previously recognized incorrectly and unsuccessfully treated in various units. We examined and evaluated the material to identify etiological agents of this keratitis, assess the usefulness of particular methods for a comparison of the detected strains that are pathogenic for humans, and monitor of their population dynamics.

2. Materials and Methods

The study pertains to material originating from incidents of serious eye infections in 12 women aged 22–48 years and 8 men aged 18–70 years who were ineffectively treated in various ophthalmic units. Because of previous unsuccessful treatment of keratitis, there was a need for diagnostic verification. The study was performed in accordance with the tenets of the Declaration of Helsinki. In the search for pathogenic agents of keratitis, clinical symptoms that were visible in slit-lamp and in vivo confocal microscopy, appearing in the early and advanced infection stages, were taken into account.
Laboratory methods of species identification were based on combination of morphological and molecular characterization.
Samples originating from keratitis material that were initially examined using the phase-contrast microscope were assessed in wet-mount slides based on the amoebic morphology.
Ten samples of the material were investigated for specific identification using molecular techniques. DNA extraction from the material was performed using the commercial Sherlock AX Kit (A&ABiotechnology, Gdynia, Poland). The ASA.S1 fragment of Acanthamoeba 18S ribosomal RNA gene was amplified using JDP1 (5′GGCCCAGATCGTTTACCGTGAA3′) and JDP2 (5′TCTCACAAGCTGCTAGGGAGTCA3′) primers targeting ~450 bp fragment of the gene [57]. The reaction mixture consisted of 12.5 μL PCR Master MixPlus High GC (ready-to-use PCR mixture containing Taq DNA polymerase, PCR buffer, MgCl2, and dNTPs; A&A Biotechnology), 1 μL each primer (concentration 10 μm), and 2.5 μL DNA template, supplemented with deionized water up to 25 μL. Amplifications were performed in a GeneAmp PCR System 9700 thermocycler (Applied Biosystems, Waltham, MA, USA) according to following protocol: 3 min at 95 °C (initial denaturation) followed by 35 cycles of denaturation at 95 °C for 60 s, annealing of primers at 60 °C for 60 s, strand elongation at 72 °C for 3 min, and a final extension step of 10 min at 72 °C. PCR products were analyzed using the GelDoc-It Imaging Systems (UVP, Upland, CA, USA) after electrophoresis on agarose gel (Sigma, St. Louis, MO, USA), stained with Midori Green DNA Stain (Nippon Genetics Europe, Duren, Germany). Direct sequencing was performed using standard procedures and amplification primers; obtained sequences were analyzed using GeneStudio™ Professional (Thermo Fisher Scientific, Waltham, MA, USA) and compared with the sequences available in the GenBank using NCBI BLAST (identification of Acanthamoeba isolates to species level) (http://www.ncbi.nlm.nih.gov/BLAST (accessed on 1 September 2021–30 January 2023).
Simultaneously, to assess in vitro dynamics of particular strain, the cultivation of the samples was performed under axenic conditions in the absence of external live food organisms, as in our earlier studies [31,39,50,58,59]. Cultures were grown in vitro in sterile 15 mL tubes with the liquid medium composed of Bacto Casitone, Difco (BSC) dissolved in water enriched with 10% calf serum, with addition of aqueous solution of antibiotics, namely streptomycin and penicilin, at 24 °C and sub-cultured into this medium twice a month. The dynamics of Acanthamoeba strains parallel cultivated were in vitro monitored and compared to one another. Changes in overall numbers of amoebae, the ability of trophozoites to multiply, and trophozoite and cyst proportions were directly counted with aid of the Bürker hemocytometer. Ranges of three counts of amoebae calculated for 1 mL of the medium were compared for particular strains and assays. Samples of several amoeba strains were also exposed to 37 °C (near human eye temperature) to test a tolerance to changes in temperature on 5th day after a sub-culturing and monitored from 7th day 3–5 times a week in the exponential growth phase during in vitro cultivation. Dynamics of amoebic strains were monitored during each sub-culturing for 7 days in the logarithmic growth phase. Results were analyzed statistically (ANOVA, Student–Newman–Keuls method; the level of statistical significance was set at p < 0.05).
During laboratory differential diagnosis, samples obtained from corneal material were also routinely tested with microbiological techniques. Preliminary identification of Gram-positive and Gram-negative bacteria strains and conventional in vitro techniques were used for detection of fungi and bacteria.

3. Results

The material assessed in our study originated from 20 keratitis cases in which one of the two eyes was affected. In 14 of the incidents (70%), antibacterial or/and antifungal medications were unsuccessfully applied in other units; thus, misdiagnoses were taken into account by us. Investigations were performed to identify the etiological factors of keratitis to verify diagnoses.
Wearing contact lenses (CL), which is a predisposing risk factor for amoebic eye infections, was documented in 17 cases (85%). Among these cases, several were associated with washing CL in tap water and showering and/or swimming in a pool with CL on. In the patients who were not wearing contact lenses, swimming in lakes and swimming in pools were probable risk factors.
There were different durations as well as intensities of clinical symptoms in 18 keratitis cases—ranging from 5 to 38 days—until proper diagnosis and various times when the anti-Acanthamoeba therapy was started. In two other misdiagnosed keratitis cases, the affected eyes were treated unsuccessfully over six months. Drug-combined therapy involved mainly chlorhexidine digluconate, polyhexamethylene biguanide PHMB, and propamidine isethionate Brolene with an addition of antibiotics; steroids were also used. In some cases of AK, surgical interventions, deep anterior lamellar keratoplasty (DALK) or penetrating keratoplasty, amniotic membrane transplantations, or cataract surgery were needed.
In the clinical picture of the keratitis incidents included in our study, photophobia, reduced visual acuity, lid edema, and redness appeared in all cases with different intensities. Symptoms that were visible in slit-lamp and in vivo confocal microscopy, appearing in the early and advanced infection stages, were taken into account. The hyperreflective tissues, epithelial inflammation, size and depth of stromal infiltration or ulcer, and presence or absence of hypopyon were assessed by non-invasive in vivo tests in the slit-lamp biomicroscopy. The occurrence of unbearable pain, epithelial diffuse edema progress to dendriform ulcer, and characteristic ring-shaped infiltration successively involving deep stromal layers, which were considered as factors indicating Acanthamoeba keratitis, were found in 12 incidents during the monitoring of clinical pictures.
In vivo confocal microscopy was applied in 14 cases for the assessment/verification of the diagnosis. The presence of hyper-reflective objects scattered or arranged in characteristic chains—double-walled, polygonal, or round Acanthamoeba cysts, with their outer wall more reflective than the internal walls—was detected by this technique. The visualization of hyper-reflective objects was positive in 16 incidents (80%). However, there were various effects of monitoring related to the previous lack of progress of therapy; in the majority of incidents, hyper-reflective objects, namely amoeba cysts, were detected in the confocal microscopy three weeks after the first keratitis symptoms appeared. The duration of the severe keratitis symptoms was longer, and proper diagnosis was delayed, ranging from 21 to 38 days. Representative confocal microscopy images of corneal layers showed the presence of the hyper-reflective objects; the double-walled Acanthamoeba cysts are presented in Figure 1.

3.1. Laboratory Differential Diagnosis

During the differential diagnosis, the material obtained from affected eyes was tested in the parasitological laboratory for confirmation of Acanthamoeba keratitis. Initially, during the light microscopy examinations, samples of scrapings were directly examined in wet-mount slides using a phase-contrast light microscope (100× and 400×) to visualize cysts or/and trophozoites and assess amoebic strains at the cellular level. Isolated amoebae were identified at the group level (Acanthamoeba spp., group I–III), according to Pussard and Pons (1977) [60], mainly based on size, cyst morphology, and the number of opercula. The most commonly detected amoebae corneal isolates were identified and classified as belonging to Acanthamoeba sp., group II: live trophozoites (14–38 μm), with pseudopodia and characteristic protrusions, acanthopodia with a nucleus and a prominent centrally placed nucleolus, cysts (7–24 μm) with their two cyst walls wrinkled ectocyst, and a polygonal or round-to-ovoid endocyst.
The results of 10 corneal isolates examined at the molecular level revealed 99.1–100% homology in the obtained sequences, with those available in the GenBank identifying particular isolates as belonging to the T4 genotypes. The material was derived from AK cases: eight contact lens wearers and two non-contact-lens wearers. The obtained sequences are deposited in GenBank under accession numbers MZ401143–MZ401152; the cultured subsequent isolates were in line with A. mauritanensis, A. culbertsoni, and A. castellanii, genotype T4. These results were in line with those from the corneal isolates that were identified on the cellular level as species belonging to the Acanthamoeba genus.
A compilation of data on the material investigated for the confirmation of Acanthamoeba keratitis (AK) is presented in Table 1.

Assessment of In Vitro Cultivation

The cultures were maintained as long as Acanthamoeba corneal strains survived. In vitro cultured corneal samples were examined with a phase-contrast light microscope as the direct scraping material. Regular monitoring confirmed AK for 12 cases by the detection of live amoebae. The Acanthamoeba infections were confirmed based on the morpho-physiology of the developmental stages. The trophozoites (~18–40 μm) moving by acanthopodia with spine-like protrusions and the double-walled cysts of Acanthamoeba (~10–20 μm) were revealed. Light micrographs of live Acanthamoeba trophozoites and cysts in the wet-mount slides from cultured corneal isolates are presented in Figure 2.
A comparative assessment of the cultures showed changes in protozoan density that appeared with varying intensity in particular amoebic populations. A low overall number of amoebae was detected in the cultures of some strains with short symptom duration before proper diagnosis.
Acanthamoeba corneal isolate dynamics were evaluated in regard to in vitro viability of the particular strains and were expressed as, among others, the trophozoites’ ability to intensely multiply, the overall amoeba number, and the duration of the survival time of the cultivated amoebae. For example, the lowest number of amoebae, 12.0–28.0 × 103 (in the range of three counts), detected in the log growth phase was revealed for the weak corneal strain that indicated a short survival time of about one cycle of sub-culturing. For comparison, a distinctly higher number of amoebae was revealed in the corneal strains, which indicated high in vitro activity during 6 or 24 cycles of sub-culturing, in the range of amoeba numbers 24.0–60.0 × 103, 54.3–80.0 × 103, respectively (the level of statistical significance was set at p < 0.05).
A comparison of the in vitro dynamics of particular Acanthamoeba strains cultured in BSC medium is presented in Table 2.
The population density of subsequent Acanthamoeba isolates with the long-time cultivation (3.5 months and more) transferred to 37 °C and monitored during many cycles of sub-culturing was compared with the effect obtained for samples of the strain that were surviving in a culture medium during only one cycle of sub-culturing; there was a statistically significantly higher overall number of amoebae cells revealed in strains after exposure to 37 °C in comparison with their density in 24 °C. Simultaneously, some reduction in Acanthamoeba population density was found in the strain, with short survival times in cultures exposed to changed, higher temperatures.
The representative effects of Acanthamoeba T4 corneal strains to changed temperatures in the exponential growth phase of the cultivation are presented in Table 3.
The microbiological examinations of scrapings from corneas performed for the verification of initial diagnoses revealed concomitant infections in 10 of 20 AK incidents. The Gram-positive strain Enterococcus faecalis, the Gram-negative Pantoea agglomerans, Enterobacter cloacae, Pseudomonas aeruginosa, and fungal co-infections with Fusarium sp. and Candida spp. were detected. In this interdisciplinary study, the data on infections with Acanthamoeba spp. alone as well as the etiologically mixed keratitis, namely Acanthamoeba spp. and concomitant fungal and/or bacterial infections, have been included.

4. Discussion

The progressive, devastating, sight-threatening Acanthamoeba keratitis is still considered a rare eye disease but is an emerging public health threat worldwide, including in Poland; during the last decades, incidents of human infections caused by pathogenic Acanthamoeba strains have been detected and reported in a constantly increasing frequency [24,26,30,31,38,39,40,54,55,61,62,63,64].
The cases included in the study presented challenges in terms of AK. There was a wide range of initial non-specific, confusing clinical symptoms, the incorrect identification of pathogenic factors, and ambiguous initial diagnoses or misdiagnoses influencing the prolonged and severe course of this eye disease.
Although a standardized protocol is missing in AK management, it is emphasized that the clinical picture alone is not sufficient to identify the etiological agent of amoebic keratitis in humans [38,39,48]. Clinical manifestations of AK are similar to those appearing in viral, bacterial, or fungal keratitis. Moreover, the amoebae are known as vehicles/reservoirs/sources of various bacteria, fungi, viruses, and protists, which can survive and multiply within the amphizoic amoebae [32,33,34,35,36,37]. These microorganisms may be causative agents of concomitant/secondary/mixed corneal infections.
In the present study, mistakes in the initial identification of the infectious causative agents of keratitis were found in most cases. It is noteworthy that while AK was finally shown in all 20 incidents, concomitant infections with bacteria and/or fungi that are pathogenic for humans were revealed in 50% of the analyzed cases. It was not possible to assess if the microorganisms were endogenous or exogenous in origin; however, their influence on the difficulties of the correct assessment of corneal isolates under suspicion with AK cannot be excluded.
Diagnostic approaches for AK include methods with different sensitivities: in vivo confocal microscopy, direct microscopic examinations of corneal material, in vitro cultures useful for the detection of causative factors of keratitis, and PCR-based techniques. It is considered that the direct detection of a causative agent in a cornel scrape specimen is the only reliable diagnostic method for AK; culture remains the gold standard of the Acanthamoeba laboratory diagnosis, and several PCR-based techniques have been well-established and have increased sensitivity significantly [38,52,57,64].
In this study, the direct detection of the causative agents—amoeba developmental forms—was very important for the proper diagnosis as well as for the verification of common misdiagnoses. A comparison of characteristics of the successively detected isolates identified on the cellular level as Acanthamoeba sp. showed the suitability of contrast phase microscopy for the direct visualization of trophozoites and cysts derived from both corneal isolate material and from in vitro cultures, particularly for cases with a long duration of symptoms until proper diagnosis.
Molecular examinations of cultured samples deriving from ten corneal isolates revealed 99.1–100% homology obtained sequences with those available in the GenBank—identifying the individual isolates to species level, e.g., A. mauritanensis, A. culbertsoni, and A. castellanii belonging to the T4 genotype. The results of molecular tests were in line with the effect of a cellular-level direct microscopic examination of Acanthamoeba based on the morpho-physiology of trophozoites and cysts.
It is known that Acanthamoeba spp. are able to tolerate various conditions in natural and man-made environments and growth in different culture media, e.g., non-nutrient agar plates seeded with Escherichia coli, the most commonly used medium peptone–yeast extract–glucose medium PYG, Bacto Casitone, Difco (Bactocasitone, BSC), and the hardly used PYG–Bactocasitone [38,50,63,64].
In our comparative investigations, we used mainly BSC [31,53,59,62]. We considered the axenic medium with the absence of external live food organisms suitable in this study for in vitro cultivation and for monitoring the subsequent Acanthamoeba strains.
In the present study, the evaluation of in vitro cultivation of the Acanthamoeba corneal strain populations performed under axenic conditions showed different durations of high in vitro activity of amoebic strains from one cycle of sub-culturing to many months and high viability. The thermo-tolerance detected in the subsequent Acanthamoeba isolates cultured in vitro expressed that clear strong population dynamics, higher amoeba density, and the ability to intense multiply at high temperatures corresponded to strong viability and long survival time in the axenic culture medium. The ability shown in this study for subsequent Acanthamoeba isolates is considered the indicator of the pathogenic potential of a given isolate [31,38,53].

5. Conclusions

Our work, based on data from the verification process of Acanthamoeba corneal isolates from complicated AK cases, provides information about the differences in amoeba population density and in the duration and the in vitro ability to intensely multiply. To our best knowledge, this is the first Polish study evaluating the amoeba strains A. mauritanensis and A. culbertsoni in terms of their possibility to grow in vitro that resulted in the confirmation of long survival time of the amoebae isolates in this cultivation conditions. Furthermore, we demonstrated that some of the Acanthamoeba strains under dynamic assessments indicated enough adaptive capability to grow in an axenic culture medium, allowing them to exhibit significant thermal tolerance that is considered an indirect marker of pathogenic strains. The in vitro monitoring was especially useful to reveal variability in the dynamics of these Acanthamoeba strains that were obtained from keratitis cases with a long duration of symptoms until proper diagnosis.
The results of the presented study, our experience, and the literature data indicate the various levels of usefulness/value of particular methods of keratitis assessment that depend on, among others, the amoebic population viability and density. Therefore, in complicated incidents that are suspected to be AK, a combined approach involving different methods is highly recommended.

Author Contributions

Conceptualization, L.C., J.P.S., B.S., W.B., J.S. and A.K.; methodology, L.C., J.P.S., B.S., W.B. and A.K.; software, L.C., J.P.S., B.S., W.B. and A.K., investigation, L.C., J.P.S., B.S., W.B., J.I., M.Ł.-G., A.K. and A.M.; resources, L.C., J.P.S., B.S., W.B., J.S., A.K. and A.M.; data curation, L.C., B.S., J.P.S., J.I., A.K., A.M. and J.S.; writing—original draft preparation, L.C., B.S., A.K., W.B., J.I. and M.Ł.-G.; writing—review and editing, L.C., J.P.S., B.S., A.K., A.M., P.J.Z. and J.S.; visualization, L.C., J.P.S., B.S., W.B., J.I., M.Ł.-G., A.K. and A.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki. It has been taken note of Bioethic Commission of Medical University of Warsaw (11.2022,01.2023,AKBE/4) and did not require ethical approval.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data are not publicly available due to patient’s privacy and ethical reasons.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Rodriguez-Zaragoza, S. Ecology of free-living amoebae. Crit. Rev. Microbiol. 1994, 20, 225–241. [Google Scholar] [CrossRef] [PubMed]
  2. Martinez, A.J.; Visvesvara, G.S. Free-living, amphizoic and opportunistic amoebas. Brain Pathol. 1997, 7, 583–598. [Google Scholar] [CrossRef] [PubMed]
  3. Walochnik, J.; Obwaller, A.; Aspöck, H. Correlations between morphological, molecular biological, and physiological characteristics in clinical and nonclnical isolates of Acanthamoeba spp. Appl. Environ. Microbiol. 2000, 66, 4408–4413. [Google Scholar] [CrossRef] [PubMed]
  4. Rohr, U.; Weber, S.; Michel, R.; Selenka, F.; Wilhelm, M. Comparison of free-living amoebae in hot water systems of hospitals with isolates from moist sanitary areas by identifying genera and determining temperature tolerance. Appl. Environ. Microbiol. 1998, 64, 1822–1824. [Google Scholar] [CrossRef] [PubMed]
  5. Schuster, F.L.; Visvesvara, G.S. Free-living amoebae as opportunistic and non-opportunistic pathogens of humans and animals. Int. J. Parasitol. 2004, 34, 1001–1027. [Google Scholar] [CrossRef]
  6. Caumo, K.; Frasson, A.P.; Pens, C.J.; Panatieri, L.F.; Frazzon, A.P.; Rott, M.B. Potentially pathogenic Acanthamoeba in swimming polls: In survey in the southern Brazilian city of Porto Alegre. Ann. Trop. Med. Parasitol. 2009, 103, 477–485. [Google Scholar] [CrossRef]
  7. Gianinazzi, C.; Schild, M.; Wüthrich, F.; Müller, N.; Schürch, N.; Gottstein, B. Potentially human pathogenic Acanthamoeba isolated from a heated indoor swimming pool in Switzerland. Exp. Parasitol. 2009, 121, 180–186. [Google Scholar] [CrossRef]
  8. Marciano-Cabral, F.; Cabral, G. Acanthamoeba spp. as agents of disease in humans. Clin. Microbiol. Rev. 2003, 16, 273–307. [Google Scholar] [CrossRef]
  9. van Hamme, C.; Dumont, M.; Delos, M.; Lachapelle, J.M. Cutaneous acanthamoebiasis in a lung transplant patient. Ann. Dermatol. Vénéréol. 2001, 28, 1237–1240. [Google Scholar]
  10. Teknos, T.N.; Poulin, M.D.; Laruentano, A.M.; Li, K.K. Acanthamoeba rhinosinusitis: Characterization, diagnosis and treatment. Am. J. Rhinol. Allergy 2000, 14, 387–391. [Google Scholar] [CrossRef]
  11. Visvesvara, G.S. Amebic meningoencephalitides and keratitis: Challenges in diagnosis and treatment. Curr. Opin. Infect. Dis. 2010, 23, 590–594. [Google Scholar] [CrossRef] [PubMed]
  12. Naginton, J.; Watson, P.G.; Playfair, T.J.; McGill, J.; Jones, B.R.; Steele, A.D. Amoebic infection of the eye. Lancet 1974, 2, 1537–1540. [Google Scholar] [CrossRef] [PubMed]
  13. Moore, M.B.; McCulley, J.P.; Luckenbach, M.; Gelender, H.; Newton, C.; McDonald, M.B.; Visvesvara, G.S. Acanthamoeba keratitis associated with soft contact lenses. Am. J. Ophthalmol. 1985, 100, 396–403. [Google Scholar] [CrossRef] [PubMed]
  14. Khan, N.A. Pathogenesis of Acanthamoeba infections. Microb. Pathog. 2003, 34, 277–285. [Google Scholar] [CrossRef] [PubMed]
  15. Ibrahim, Y.W.; Boase, D.L.; Cree, I.A. Factors affecting the epidemiology of Acanthamoeba keratitis. Ophthalmic Epidemiol. 2007, 14, 53–60. [Google Scholar] [CrossRef]
  16. Chomicz, L.; Piekarczyk, J.; Starościak, B.; Fiedor, P.; Piekarczyk, B.; Szubińska, D.; Zawadzki, P.J.; Walski, M. Comparative studies on the occurrence of protozoans, bacteria and fungi in the oral cavity of patients with systemic disorders. Acta Parasitol. 2002, 47, 147–153. [Google Scholar]
  17. Khan, N.A. Acanthamoeba: Biology and increasing importance in human health. FEMS Microbiol. Rev. 2006, 30, 564–595. [Google Scholar] [CrossRef]
  18. Trabelsi, H.; Sellami, A.; Dendena, F.; Sellami, H.; Cheikh-Rouhou, F.; Makni, F.; Dhiaa, S.B.; Ayadi, A. Free-living amoebae (FLA): Morphological and molecular identification of Acanthamoeba in dental unit water. Amibes libres: Identification morphologique et moléculaire d’Acanthamoeba dans l’eau des unités dentaires. Parasite 2010, 17, 67–70. [Google Scholar] [CrossRef]
  19. Zawadzki, P.J.; Perkowski, K.; Padzik, M.; Mierzwińska-Nastalska, E.; Szaflik, J.P.; Conn, D.B.; Chomicz, L. Examination of oral microbiota diversity in adults and older adults as an approach to prevent spread of risk factors for human infections. BioMed Res Int. 2017, 2017, 8106491. [Google Scholar] [CrossRef]
  20. Siddiqui, R.; Khan, N.A. Biology and pathogenesis of Acanthamoeba. Parasites Vectors 2012, 5, 6. [Google Scholar] [CrossRef]
  21. Wesołowska, M.; Cisowska, A.; Myjak, P.; Marek, J.; Jurowskaka-Liput, J.; Jakubaszko, J. Acanthamoeba keratitis in contact lens wearers in Poland. Adv. Clin. Exp. Med. 2006, 15, 553–555. [Google Scholar]
  22. Gatti, S.; Rama, P.; Matuska, S.; Berrilli, F.; Cavallero, A.; Carletti, S.; Bruno, S.; Maserati, R.; Di Cave, D. Isolation and genotyping of Acanthamoeba strains from corneal infections in Italy. J. Med. Microbiol. 2010, 59, 1324–1330. [Google Scholar] [CrossRef]
  23. Verani, J.R.; Lorick, S.A.; Yoder, J.S.; Beach, M.J.; Braden, C.R.; Roberts, J.M.; Conover, C.S.; Chen, S.; McConnell, K.A.; Chang, D.C.; et al. National outbreak of Acanthamoeba keratitis associated with use of a contact lens solution, United States. Emerg. Infect. Dis. 2009, 15, 1236–1242. [Google Scholar] [CrossRef]
  24. Duarte, J.L.; Furst, C.; Klisiowicz, D.R.; Klassen, G.; Costa, A.O. Morphological, genotypic, and physiological characterization of Acanthamoeba isolates from keratitis patients and the domestic environment in Vitoria, Espírito Santo, Brazil. Exp. Parasitol. 2013, 135, 9–14. [Google Scholar] [CrossRef]
  25. Page, M.A.; William, D.M. Acanthamoeba Keratitis: A 12-year experience covering a wide spectrum of presentations, diagnoses, and outcomes. J. Ophthalmol. 2013, 2013, 670242. [Google Scholar] [CrossRef]
  26. Król-Turmińska, K.; Olender, A. Human infections caused by free-living amoebae. Ann. Agric. Environ. Med. 2017, 24, 254–260. [Google Scholar] [CrossRef]
  27. Sharma, S.; Garg, P.; Rao, G.N. Patient characteristics, diagnosis, and treatment of non-contact lens related Acanthamoeba keratitis. Br. J. Ophthalmol. 2000, 84, 1103–1108. [Google Scholar] [CrossRef]
  28. Syam, P.P.; Narendran, R.; van der Hoek, J. Persistent Acanthamoeba keratitis in a non-contact lens wearer following exposure to bird seed dust. Br. J. Ophthalmol. 2005, 89, 388–389. [Google Scholar] [CrossRef]
  29. Ertabaklar, H.; Türk, M.; Dayanir, V.; Ertug, S.; Walochnik, J. Acanthamoeba keratitis due to Acanthamoeba genotype T4 in a non-contact lens wearer in Turkey. Parasitol. Res. 2007, 100, 241–246. [Google Scholar] [CrossRef]
  30. Garg, P.; Kalra, P.; Joseph, J. Non-contact lens related Acanthamoeba keratitis. Indian J. Ophthalmol. 2017, 65, 1079–1086. [Google Scholar] [CrossRef]
  31. Chomicz, L.; Conn, D.B.; Padzik, M.; Szaflik, J.P.; Walochnik, J.; Zawadzki, P.J.; Pawlowski, W.; Dybicz, M. Emerging threats for human health in Poland: Pathogenic isolates from drug resistant Acanthamoeba keratitis monitored in terms of their in vitro dynamics and temperature adaptability. BioMed Res. Int. 2015, 2015, 231285. [Google Scholar] [CrossRef] [PubMed]
  32. Walochnik, J.; Picher, O.; Aspöck, C.; Ullmann, M.; Sommer, R.; Aspöck, H. Interactions of “Limax amoebae” and gramnegative bacteria: Experimental studies and review of current problems. Tokai J. Exp. Clin. Med. 1999, 23, 273–278. [Google Scholar]
  33. Berger, P.; Papazian, L.; Drancourt, M.; Lascolat, B.; Auffray, J.P.; Raoult, D. Amoeba associated microorganisms and diagnosis of nosocomial pneumonia. Emerg. Infect. Dis. 2006, 12, 248–255. [Google Scholar] [CrossRef] [PubMed]
  34. Gómez-Couso, H.; Paniagua-Crespo, E.; Ares-Mazás, E. Acanthamoeba as a temporal vehicle of Cryptosporidium. Parasitol. Res. 2007, 100, 1151–1154. [Google Scholar] [CrossRef]
  35. Thomas, V.; McDonnell, G.; Denyer, S.P.; Maillard, J.-Y. Free-Living Amoebae and their intracellular pathogenic microorganisms: Risks for Water Quality. FEMS Microbiol. Rev. 2010, 34, 231–259. [Google Scholar] [CrossRef]
  36. Cateau, E.; Verdon, J.; Fernandez, B.; Hechard, Y.; Rodier, M.H. Acanthamoeba sp. promotes the survival and growth of Acinetobacter baumannii. FEMS Microbiol. Lett. 2011, 319, 19–25. [Google Scholar] [CrossRef]
  37. Guimaraes, A.J.; Gomes, K.X.; Cortines, J.R.; Peralta, J.M. Peralta RHS Acanthamoeba spp. as an universal host for pathogenic microorganisms: One bridge from environment to host virulence. Microbiol. Res. 2016, 193, 30–38. [Google Scholar] [CrossRef]
  38. Lorenzo-Morales, J.; Khan, N.A.; Walochnik, J. An update on Acanthamoeba keratitis: Diagnosis, pathogenesis and treatment. Parasite 2015, 22, 10–15. [Google Scholar] [CrossRef]
  39. Chomicz, L.; Szaflik, J.P.; Padzik, M.; Izdebska, J. Acanthamoeba keratitis: The emerging vision-threatening corneal disease. In Advances in Common Eye Infections; Rumelt, S., Ed.; IntechOpen: London, UK, 2016; Volume 4, pp. 99–120. [Google Scholar]
  40. Maycock, N.J.; Jayaswal, R. Update on Acanthamoeba Keratitis: Diagnosis, treatment, and outcomes. Cornea 2016, 35, 713–720. [Google Scholar] [CrossRef]
  41. Shimmura-Tomita, M.; Takano, H.; Kinoshita, N.; Toyoda, F.; Tanaka, Y.; Takagi, R.; Kobayashi, M.; Kakehashi, A. Risk factors and clinical signs of severe Acanthamoeba keratitis. Clin. Ophthalmol. 2018, 12, 2567–2573. [Google Scholar] [CrossRef]
  42. Tu, E.Y.; Joslin, C.E.; Sugar, J.; Booton, G.C.; Shoff, M.E.; Fuerst, P.A. The relative value of confocal microscopy and superficial corneal scrapings in the diagnosis of Acanthamoeba keratitis. Cornea 2008, 27, 764–772. [Google Scholar] [CrossRef]
  43. Rezaei Kanavi, M.; Naghshgar, N.; Javadi, M.A.; Sadat Hashemi, M. Various confocalscan features of cysts and trophozoites in cases with Acanthamoeba keratitis. Eur. J. Ophthalmol. 2012, 22, 46–50. [Google Scholar] [CrossRef]
  44. Huang, P.; Tepelus, T.; Vickers, L.A.; Baghdasaryan, E.; Huang, J.; Irvine, J.A.; Hsu, H.Y.; Sadda, S.; Lee, O.L. Quantitative analysis of depth, distribution, and density of cysts in Acanthamoeba keratitis using confocal microscopy. Cornea 2017, 36, 927–932. [Google Scholar] [CrossRef]
  45. Wei, Z.; Cao, K.; Wang, L.; Baudouin, C.; Labbe, A.; Liang, Q. Corneal changes in Acanthamoeba keratitis at various levels of severity: An in vivo confocal microscopic study. Transl. Vis. Sci. Technol. 2021, 10, 10. [Google Scholar] [CrossRef]
  46. Varacalli, G.; Di Zazzo, A.; Mori, T.; Dohlman, T.H.; Spelta, S.; Coassin, M.; Bonini, S. Challenges in Acanthamoeba Keratitis: A Review. J. Clin. Med. 2021, 10, 942. [Google Scholar] [CrossRef]
  47. Juárez, M.M.; Tártara, L.I.; Cid, A.G.; Real, J.P.; Bermúdez, J.M.; Rajal, V.B.; Palma, S.D. Acanthamoeba in the eye, can the parasite hide even more? Latest developments on the disease. Contact Lens Anterior Eye 2018, 41, 245–251. [Google Scholar] [CrossRef]
  48. Szentmary, N.; Daas, L.; Shi, L.; Lenke Laurik, K.; Lepper, S.; Milioti, G.; Seitz, B. Acanthamoeba keratitis—Clinical signs, differential diagnosis and treatment. J. Curr. Ophthalmol. 2019, 31, 16–23. [Google Scholar] [CrossRef]
  49. Niederkorn, J.Y. The biology of Acanthamoeba keratitis. Exp. Eye Res. 2021, 202, 108365. [Google Scholar] [CrossRef]
  50. Chomicz, L.; Padzik, M.; Szaflik, J.P.; Nahorski, W.L.; Kryczka, T.; Szaflik, J. Monitoring of in vitro dynamics of Acanthamoeba strains isolated from infected eyes as a useful tool in keratitis management. Exp. Parasitol. 2014, 145, 73–77. [Google Scholar] [CrossRef]
  51. Khan, N.A. Acanthamoeba: Biology and Pathogenesis, 2nd ed.; Caister Academic Press: Poole, UK, 2015. [Google Scholar]
  52. Köhsler, M.; Leitsch, D.; Mülle, N.; Walochnik, J. Validation of reference genes for the normalization of RT-qPCR gene expression in Acanthamoeba spp. Sci. Rep. 2020, 10, 10362. [Google Scholar] [CrossRef]
  53. Baltaza, W.; Padzik, M.; Szaflik, J.P.; Dybicz, M.; Grochowska, A.; Kuryłowicz, A.; Chomicz, L. Comparative examination on selected amphizoic amoebae in terms of their in vitro temperature tolerance—A possible indirect marker of potential pathogenicity of Acanthamoeba strains. Ann. Parasitol. 2018, 64, 317–322. [Google Scholar] [CrossRef] [PubMed]
  54. Martin-Perez, T.; Criado-Fornelio, A.; Martinez, J.; Blanco, M.A.; Fuentes, I.; Perez-Serrano, J. Isolation and molecular characterization of Acanthamoeba from patients with keratitis in Spain. Eur. J. Protistol. 2017, 61, 244–252. [Google Scholar] [CrossRef] [PubMed]
  55. Derda, M.; Solarczyk, P.; Cholewiński, M.; Hadaś, E. Genotypic characterization of amoeba isolated from Acanthamoeba keratitis in Poland. Parasitol. Res. 2015, 114, 1233–1237. [Google Scholar] [CrossRef] [PubMed]
  56. Lass, A.; Szostakowska, B.; Idzińska, A.; Chomicz, L. The first genotype determination of Acanthamoeba potential threat to human health, isolated from natural water reservoirs in Poland. Parasitol. Res. 2014, 113, 2693–2699. [Google Scholar] [CrossRef] [PubMed]
  57. Schroeder, J.M.; Booton, G.C.; Hay, J.; Niszl, I.A.; Seal, D.V.; Markus, M.B.; Fuerst, P.A.; Byers, T.J. Use of subgenic 18S ribosomal DNA PCR and sequencing for genus and genotype identification of Acanthamoebae from humans with keratitis and from sewage sludge. J. Clin. Microbiol. 2001, 2, 1903–1911. [Google Scholar] [CrossRef]
  58. Červa, L.; Novak, K. Amoebic meningoencephalitis: Sixteen fatalities. Science 1968, 160, 92. [Google Scholar] [CrossRef]
  59. Chomicz, L.; Żebrowska, J.; Piekarczyk, J.; Starościak, B.; Myjak, P.; Walski, M.; Kazimierczuk, Z. In vitro studies on susceptibility of Acanthamoeba castellanii to selected chemical agents. Acta Parasitol. 2005, 50, 25–31. [Google Scholar]
  60. Page, F.C. A revised classification of the Gymnamoebia (Protozoa: Sarcodina). Zool. J. Linn. Soc. 1976, 58, 61–77. [Google Scholar] [CrossRef]
  61. Bonini, S.; Di Zazzo, A.; Varacalli, G.; Coassin, M. Acanthamoeba Keratitis: Perspectives for Patients. Curr. Eye Res. 2020, 46, 771–776. [Google Scholar]
  62. Padzik, M.; Baltaza, W.; Conn, D.B.; Szaflik, J.P.; Chomicz, L. Effect of povidone iodine, chlorhexidine digluconate and toyocamycin on amphizoic amoebic strains, infectious agents of Acanthamoeba keratitis—A growing threat to human health worldwide. Ann. Agric. Environ. Med. 2018, 25, 725–731. [Google Scholar] [CrossRef]
  63. Heredero-Bermejo, I.; San Juan Martin, C.; Soliveri de Carranza, J.; Copa-Patino, J.L.; Pérez-Serrano, J. Acanthamoeba castellanii: In vitro UAH-T17c3 trophozoite growth study in different culture media. Parasitol. Res. 2012, 110, 2563–2567. [Google Scholar] [CrossRef]
  64. Bouten, M.; Elsheikha, H.M. Diagnosis and Management of Acanthamoeba Keratitis: A Continental Approach. Parasitologia 2022, 2, 167–197. [Google Scholar] [CrossRef]
Microorganisms 11 01174 g001 550
Figure 1. Representative in vivo confocal microscopy of corneal epithelial layer showing the presence of hyper-reflective objects—double-walled Acanthamoeba cysts scattered or/and arranged in characteristic chains. (A–C) HRT3 RCM images (Heidelberg Engineering, Heidelberg, Germany), (D–F) ConfoScan4TM images (Nidek Technologies, Padua, Italy).
Figure 1. Representative in vivo confocal microscopy of corneal epithelial layer showing the presence of hyper-reflective objects—double-walled Acanthamoeba cysts scattered or/and arranged in characteristic chains. (A–C) HRT3 RCM images (Heidelberg Engineering, Heidelberg, Germany), (D–F) ConfoScan4TM images (Nidek Technologies, Padua, Italy).
Microorganisms 11 01174 g001
Microorganisms 11 01174 g002 550
Figure 2. Light micrographs of live Acanthamoeba trophozoites and cysts in wet-mount slides from axenically cultured corneal isolates. (A), 9m A. castellanii trophozoite and double-walled cyst; (B), 8m dividing A.castellanii trophozoite; (C), 5f trophozoites A.mauritanensis with numerous acanthopodia; (D), 1f A.polyphaga trophozoites with numerous digestive vacuoles; (E,F) Acanthamoeba sp. cysts and trophozoites; note characteristic acanthopodia and double-walled cysts. Scale bars = 10 µm.
Figure 2. Light micrographs of live Acanthamoeba trophozoites and cysts in wet-mount slides from axenically cultured corneal isolates. (A), 9m A. castellanii trophozoite and double-walled cyst; (B), 8m dividing A.castellanii trophozoite; (C), 5f trophozoites A.mauritanensis with numerous acanthopodia; (D), 1f A.polyphaga trophozoites with numerous digestive vacuoles; (E,F) Acanthamoeba sp. cysts and trophozoites; note characteristic acanthopodia and double-walled cysts. Scale bars = 10 µm.
Microorganisms 11 01174 g002
Table
Table 1. Compilation of data on material investigated for confirmation of Acanthamoeba Keratitis (AK).
Table 1. Compilation of data on material investigated for confirmation of Acanthamoeba Keratitis (AK).
Corneal
Sample		Acanthamoeba StrainProbable Factors
Predisposing to AK		Duration of Symptoms Before Proper DiagnosisAmoebic Forms Visualized in Contrast Phase
Microscopic Slides of:
Corneal ScrapingsIn vitro Cultures
1fA. polyphagaswimming
in a lake		35 days #cysts and moving trophozoitescysts and trophozoites
2fA. castellaniiCL30 dayscystscysts and trophozoites
3fA. castellaniinot identified24 daysno amoebae detecteda few cysts and trophozoites
4fA. castellaniiCL5 daysno amoebae detectedcysts and trophozoites
5fA. mauritanensisCL35 days #cystsmultiple cysts and trophozoites
6fA. mauritanensisCL, washing
in tap water		30 days #cysts and trophozoitesmultiple cysts and trophozoites
7fAcanthamoeba sp.CL7 daysa few cysts detectedno amoebae detected
8mA. castellaniiCL, swimming
in a pool		26 days #cystscysts and trophozoites
9mA. castellaniiCL38 days #cystscysts and trophozoites
10fAcanthamoeba sp.CL, eye
injuries		6 months #;
misdiagnosis		cystscysts and trophozoites
11fA. culbertsoniCL8 days #a few cysts detectedcysts and trophozoites
12fAcanthamoeba sp.CL10 days #cystscysts and trophozoites
13mA. castellaniiCL26 days #multiple cysts
and trophozoites		cysts and trophozoites
14mAcanthamoeba sp.swimming with CL
in a pool		10 days #several cystsno amoebae detected
15m Acanthamoeba sp.CL21 days #cystscysts and trophozoites
16f Acanthamoeba sp.CL8 days #cystsand trophozoites
17mAcanthamoeba sp.swimming with CL in a pool8 days #no scrapingsnot cultivated
18mAcanthamoeba sp.not identified6 months #;
misdiagnosis		cystscysts and trophozoites
19f Acanthamoeba sp.showering with CL 26 days #cystsno amoebae developed
20mAcanthamoeba sp.CL, swimming
in a pool		8 days #no scrapingsnot cultivated
CL-wearing contact lenses; # cysts detected by in vivo confocal microscope.
Table
Table 2. Comparison of in vitro dynamics of particular Acanthamoeba strains cultured in BSC medium.
Table 2. Comparison of in vitro dynamics of particular Acanthamoeba strains cultured in BSC medium.
Corneal SampleAcanthamoeba
Strain/Accession
No in GenBank		Duration of Cultures SurvivalAbility to Intense Multiply
in Culture Medium
1fA. polyphaga
MZ401143		35 months, still activeall time of cultivation, still
3fA. castellanii
MZ401144		15 daysduring 2 cycles of sub-culturing
4fA. castellanii
MZ401145		10 daysduring 1 cycle of sub-culturing
5fA. mauritanensis
MZ401146		25 months, still activeall time of cultivation
8mA. castellanii
MZ401150		3 monthsduring 2 cycles of sub-culturing
9mA. castellanii
MZ401151		3.5 monthsduring 3 cycles of sub-culturing
10fAcanthamoeba sp.
MZ401148		6 months, still activeduring 10 cycles of sub-culturing
11fA. culbertsoni
MZ401149		7 months, still activeall time of cultivation
13mA. castellanii
MZ401152		2 monthsduring 2 cycles of sub-culturing
15mAcanthamoeba sp.4 weeksduring 2 cycles of sub-culturing
16fAcanthamoeba sp.5 weeksduring 2 cycles of sub-culturing
18mAcanthamoeba sp.2.5 monthsduring 5 cycles of sub-culturing
Table
Table 3. Effect of in vitro exposure of Acanthamoeba corneal strains from exponential growth phase of the cultivation to changed temperature.
Table 3. Effect of in vitro exposure of Acanthamoeba corneal strains from exponential growth phase of the cultivation to changed temperature.
No.Acanthamoeba
Strain		Range of Overall Acanthamoeba Number (×103)
Range of Cysts (%)		AVGSDRange of Overall Acanthamoeba Number (×103)
Range of Cysts (%)		AVGSD
24 °C37 °C
1fA. polyphaga66.7597.50114.6092.9524.25105.00120.80140.65122.1517.86
1.202.803.202.401.062.003.003.502.830.76
4fA. castellanii12.4015.7528.1218.768.2810.1514.0515.8013.332.89
2.206.0012.206.805.052.403.507.204.372.51
5fA. mauritanensis52.2460.5573.4062.0610.6661.3079.30105.5082.0322.23
5.207.008.206.801.514.006.508.006.172.02
9mA. castellanii24.0545.6062.2443.9619.1546.5062.4080.8263.2417.18
2.304.006.004.101.853.003.807.004.602.12
11fA. culbertsoni55.5075.2088.0072.9016.3767.0087.7897.8084.1915.71
1.803.205.503.501.873.004.705.304.331.19
The range of three counts calculated for 1 mL of culture medium is compared for five strains. The level of statistical significance was set at p < 0.05; statistically significant differences in relation to data of 24 °C have been bolded.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chomicz, L.; Szaflik, J.P.; Szostakowska, B.; Izdebska, J.; Baltaza, W.; Łazicka-Gałecka, M.; Kuligowska, A.; Machalińska, A.; Zawadzki, P.J.; Szaflik, J. Successive Acanthamoeba Corneal Isolates Identified in Poland Monitored in Terms of In Vitro Dynamics. Microorganisms 2023, 11, 1174. https://doi.org/10.3390/microorganisms11051174

AMA Style

Chomicz L, Szaflik JP, Szostakowska B, Izdebska J, Baltaza W, Łazicka-Gałecka M, Kuligowska A, Machalińska A, Zawadzki PJ, Szaflik J. Successive Acanthamoeba Corneal Isolates Identified in Poland Monitored in Terms of In Vitro Dynamics. Microorganisms. 2023; 11(5):1174. https://doi.org/10.3390/microorganisms11051174

Chicago/Turabian Style

Chomicz, Lidia, Jacek P. Szaflik, Beata Szostakowska, Justyna Izdebska, Wanda Baltaza, Monika Łazicka-Gałecka, Agnieszka Kuligowska, Anna Machalińska, Paweł J. Zawadzki, and Jerzy Szaflik. 2023. "Successive Acanthamoeba Corneal Isolates Identified in Poland Monitored in Terms of In Vitro Dynamics" Microorganisms 11, no. 5: 1174. https://doi.org/10.3390/microorganisms11051174

APA Style

Chomicz, L., Szaflik, J. P., Szostakowska, B., Izdebska, J., Baltaza, W., Łazicka-Gałecka, M., Kuligowska, A., Machalińska, A., Zawadzki, P. J., & Szaflik, J. (2023). Successive Acanthamoeba Corneal Isolates Identified in Poland Monitored in Terms of In Vitro Dynamics. Microorganisms, 11(5), 1174. https://doi.org/10.3390/microorganisms11051174

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop